Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (62)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lechevrel, M.
Right arrow Articles by Wild, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lechevrel, M.
Right arrow Articles by Wild, C. P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 20, No. 2, 243-248, February 1999
© 1999 Oxford University Press

Characterization of cytochrome P450 expression in human oesophageal mucosa

Mathilde Lechevrel1,6, Alan G. Casson3,7, C. Roland Wolf4, Laura J. Hardie5, Marcella B. Flinterman5, Ruggero Montesano2 and Christopher P. Wild1,5,8

1 Unit of Environmental Carcinogenesis and
2 Unit of Mechanisms of Carcinogenesis, International Agency for Research on Cancer, 150 cours Albert Thomas, 69372 Lyon Cedex 08, France,
3 Division of Thoracic Surgery, University of Toronto, Ontario, Canada,
4 Imperial Cancer Research Fund, Molecular Pharmacology Unit, Biomedical Research Centre, Dundee, UK and
5 Molecular Epidemiology Unit, University of Leeds, Leeds LS2 9JT, UK


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The expression of cytochrome (CYP) P450 enzymes in human oesophageal mucosa was investigated in a total of 25 histologically non-neoplastic surgical tissue specimens by using specific antibodies in immunoblots and by RT–PCR mRNA analysis. The presence of CYP1A, 2E1, 3A and 4A enzymes was demonstrated by both techniques; CYP2A reactive protein was also detected by immunoblot. The presence of CYP4B1 mRNA was established but no specific antibody was available for detection of the corresponding protein by immunoblot. CYP2B6/7 mRNA was not detected in any sample. The mRNA transcripts for CYP1A1, 2E1, 4A11 and 4B1 were consistently detected in the majority of samples (>84%), whereas CYP1A2 mRNA was only detected in 11 of 19 specimens examined. An RT–PCR method to differentiate CYP3A4 and 3A5 mRNA was developed. This demonstrated CYP3A5 mRNA expression in all samples tested, whereas CYP3A4 mRNA was not detectable, suggesting that CYP3A5 is the major CYP3A protein in human oesophagus. There were significant interindividual variations in the amount of proteins, ranging from 8-fold for CYP4A to 43-fold for CYP2E1. For each patient, data on exposure to risk factors for oesophageal cancer were available, including tobacco smoke, alcohol, gastro-oesophageal reflux and hot beverage consumption. None of these risk factors or other patient characteristics (age, sex, tumour location and tumour stage) were correlated with the protein level of the individual CYP enzymes as determined by quantitation of immunoblot staining. However, the small series of samples precludes any strong conclusion concerning the lack of such correlations. There were no differences between squamous cell carcinomas and adenocarcinomas in either the qualitative or quantitative expression of the CYP enzymes. These data demonstrate that a range of CYP enzymes are expressed in human oesophageal mucosa and indicate that this tissue has the capacity to activate chemical carcinogens to reactive DNA binding metabolites.

Abbreviations: CYP, cytochrome P450; NNO, N-nitrosamines.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The marked geographical variation in incidence of oesophageal cancer implies the involvement of environmental factors in the aetiology of this disease. Ninety per cent of cases of squamous cell carcinoma of the oesophagus in Europe and North America are attributable to tobacco smoke and alcohol; there is a multiplicative increase in risk in individuals exposed to both factors and having a diet deficient in fresh fruit and vegetables (1). Conversely, a diet rich in fresh fruit and vegetables and fresh meat reduces the risk of developing this tumour (2). The molecular mechanisms involved in the interaction between alcohol and tobacco are unclear. Other risk factors for squamous cell carcinoma are less well characterized but include consumption of hot drinks, N-nitroso compounds present preformed in foods or formed endogenously, a diet deficient in micronutrients and possibly exposure to mycotoxins (35). The incidence of adenocarcinoma of the oesophagus is increasing rapidly in Europe and North America (6). The risk of developing this tumour has been associated with chronic gastro-oesophageal reflux disease and tobacco smoking (6), with a recent multicentre case–control study in the USA concluding that smoking accounted for 40% of cases (7).

Most environmental carcinogens require enzymatic metabolism to reactive intermediates which bind to critical cellular macromolecules initiating toxic and carcinogenic events. The cytochrome P450 (CYP) comprises a multigene family of microsomal enzymes that carry out the oxidative metabolism of numerous endogenous and exogenous compounds. Interindividual differences in CYP gene expression are observed and this may contribute to interindividual susceptibility to environmental carcinogens (8,9). The major CYP enzymes involved in the metabolic activation of chemical carcinogens are in the CYP 1, 2 and 3 families (10,11). Individual CYP enzymes vary in tissue distribution, mechanism of regulation and substrate specificity. The majority are expressed in the liver, with extrahepatic expression being less well characterized. In particular there are few studies which have investigated CYP expression in human oesophagus (1216). CYP2E1 has not been reported in human oeosophageal mucosa, yet given the interaction between tobacco and alcohol in the aetiopathogenesis of oesophageal cancer and the ethanol inducibility of human hepatic CYP2E1 (17), there is a particular interest in this enzyme. CYP2E1 is involved in the bioactivation of low molecular weight compounds, including the tobacco-specific N-nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, other N-nitrosamines (NNO) and various other compounds present in tobacco smoke, e.g. acrolein and 1,3 butadiene (5,1821). The modulation of hepatic and extrahepatic metabolism of tobacco-related carcinogens by alcohol ingestion could represent one mechanism of interaction between these two risk factors. Therefore, the expression of various CYPs in human oesophageal mucosa was studied as a first step to developing a better understanding of the role of metabolism of chemical carcinogens in the development of cancer at this site. The oesophageal mucosa in this study was obtained from oesophageal cancer patients (both those with adenocarcinoma and squamous cell carcinoma) at sites distant from the tumour. Patients with either histological type of tumour were included because the aim of the study was to examine normal oesophageal mucosa for CYP expression rather than to study expression of these enzymes in the tumour cells.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patient description
A total of 25 oesophageal tissue specimens were obtained at the time of oesophagectomy from oesophageal cancer patients (all Causcasians) who had undergone no prior chemotherapy or radiotherapy. Patients underwent surgery within 24 h of admission to the Mount Sinai Hospital, Toronto, Canada. Specimens of tissue were from regions distant (>8 cm) from the tumour at the proximal resection margin and were histologically normal. The mucosa was separated from the underlying connective tissue immediately after resection and snap-frozen in liquid nitrogen prior to long-term storage at –80°C. The amount of extracted microsomal protein was sufficient to investigate several enzymes (see below): 0.13–7 mg microsomal protein were obtained from 0.1–1.5 g oesophageal mucosa. Nineteen of the patients included in the study were diagnosed as having primary adenocarcinomas of the oesophagus (according to strict criteria) and six had squamous cell carcinomas. Questionnaire information was obtained on age, sex and history of tobacco smoking (cigarettes/dayxduration in years and current or ex-smoker), alcohol consumption [categorized as heavy (>6 U/day), light (<6 U/day) or none], duration of medically significant symptoms of gastro-oesophageal reflux and hot beverage intake [no. of hot drinks per dayxheat of drink on a linear scale of 0 (cold) to 10 (very hot)]. The histological characteristics of the tumour, location in the oesophagus and the UICC stage of the disease were also known for all subjects (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. Patient characteristics
 
Microsome preparation
The mucosal sample (0.1–1.5 g tissue) was homogenized gently on ice in 0.15 M KCl, pH 7.4, 10 mM K2EDTA, 0.1 mM DTT. The homogenate was centrifuged at 9000 g for 20 min at 4°C, the supernatant removed and centrifuged (105 000 g for 60 min at 4°C). The microsomal fraction was resuspended and stored in 0.1 M potassium phosphate buffer, pH 7.4, 0.5 mM K2EDTA, 0.1 mM DTT and 0.25 M sucrose at –80°C. Protein concentrations were determined by a Bradford protein dye-binding assay using Coomassie brilliant blue G-250 dye (Bio-Rad, Richmond, CA).

Immunoblot analysis
Aliquots (25 µg) of microsomal protein were applied to polyacrylamide gels and separated by electrophoresis in the presence of SDS according to the manufacturer's instructions (Bio-Rad). Resolved proteins were transferred to nitrocellulose and incubated with different polyclonal antibodies. The rabbit polyclonal antibodies raised against rat CYP1A1/2, CYP2A1, CYP3A1 and CYP4A1 were described previously (22). All these antibodies have been shown in previous studies to cross-react with known human counterparts. The CYP3A1 antibody reacts with both CYP3A4 and 3A5 while the antibody to CYP4A1 reacts with CYP4A human proteins, but the specific enzymes in this sub-family have not been determined. The rabbit polyclonal antibody raised against human CYP2E1 was a gift from Professor P.Beaune (Paris). While cross-reactivity of the antibodies with further, as yet uncharacterized, CYP enzymes cannot be ruled out it is most likely that the proteins observed are those previously shown to be recognized by the antibodies. The secondary antibodies were peroxidase-conjugated anti-rabbit IgG (Sigma, St Louis, MO). The CYP staining was visualized using the ECL-TM method (Amersham, Little Chalfont, UK) and intensity of staining was measured by densitometry (Bio-Rad model GS670). As a positive control on the immunoblots, microsomes prepared from human liver and lung were loaded using the same amount of proteins (25 µg), except where specified in the figure legends. Staining intensity of CYP in samples examined on different membranes were normalized with respect to the staining intensity of the liver control.

Reverse transcriptase polymerase chain reaction (RT–PCR)
Total RNA was extracted from oesophageal mucosa as described (23) and was reverse transcribed to cDNA with Moloney murine leukemia virus reverse transcriptase and priming oligo(dT) (Appligene Oncor, Illkirch, France). The cDNA was stored at –20°C. The PCR reaction comprised 10 µl out of the total 40 µl cDNA, 2.5 U Taq DNA polymerase (Appligene), 5 µl 10x Taq buffer, 2.5 µM dNTP, 1 pmol each primer and water to a final volume of 50 µl. The primers, their location and their size for all but CYP3A4, CYP3A5 and CYP4A11 were as described (24). Briefly, the samples were denaturated at 94°C for 2 min and submitted to 30 cycles of amplification as follows: 1 min at 94°C, 1 min at 55°C, 2 min at 72°C, followed by a final polymerase extension step at 72°C for 10 min. The PCRs with CYP2E1 were performed with co-amplification with ß-actin primers to control for the efficiency of reaction. For the other enzymes, the cDNAs of CYP1A1, CYP1A2, CYP2B6/7 and CYP4B1 were co-amplified with GAPDH primers. The primers to CYP 1A1, CYP1A2, CYP2E1 and CYP4B1 are specific to one enzyme while others (CYP2A6/7 and CYP2B6/7) can detect more than one (24). The primers (all 5'->3' sequences) used were as follows, with the location given in parentheses. CYP1A1: sense, TCACAGACAGCCTGATTGAG (928–947); antisense, GATGGGTTGACCCATAGCTT (1341–1360). CYP1A2: sense, TGGCTTCTACATCCCCAAGAAAT (1199–1221); antisense, TTCATGGTCAGCCCGTAGAT (1488–1507). CYP 2B6/2B7: sense, CCATACACAGAGGCAGTCAT (1045–1064): antisense, GGTGTCAGATCGATGTCTTC (1402–1421). CYP 2E1: sense, AGCACAACTCTGAGATATGG (925–944); antisense ATAGTCACTGTACTTGAACT (1271–1290). CYP 3A3/4: sense CCAAGCTATGCTCTTCACCG (1279–1298); antisense, TCAGGCTCCACTTACGGTGC (1583–1602). CYP4B1: sense TGACCATGTGCATCAAAGGAG (1109–1128); antisense AAAGCCATTCTTGGAGCGCA (1487–1506). Original references are cited in Hakkola et al. (24).

To detect CYP3A4 and CYP3A5 oesophageal cDNA samples (0.5 µl) were initially amplified with universal primers (sense, 5'-GAAACRCTCAGATTATTCCC-3'; antisense, 5'-AGCAAACCTCATGCC-3') directed against 261 and 258 bp fragments of CYP3A4 and CYP3A5, respectively (nt 1170–1429 for CYP3A5) (25). The PCR reaction mix contained 2.5 U Amplitaq Gold (Perkin-Elmer-Cetus, Norwalk, CT), 1 pmol each primer, 2.5 µl 10x Taq buffer, 2.5 µM dNTPs, 3 mM MgCl2 and water to a final volume of 25 µl. Cycling conditions were as follows: 95°C for 15 min; 35 cycles of 1 min at 95°C, 1 min at 50°C, 1 min at 72°C; followed by a final extension step for 10 min at 72°C. The presence of one or two DpnII cut sites in the resulting PCR product enabled discrimination between CYP3A5 and CYP3A4, respectively. PCR product (10 µl) was digested with DpnII (5 U) for 16 h at 37°C and subjected to agarose gel electrophoresis. The presence of the CYP3A4 isoform yielded a 136, 63 and 62 bp restriction profile compared with 195 and 63 bp fragment lengths for CYP3A5.

To further validate CYP3A5 status, a second round of digestion with 5 U AciI for 16 h at 37°C was performed. The presence of a solitary AciI cut site on the 195 bp DpnII fragment of CYP3A5 yields two further fragments of 159 and 36 bp. NIH 3T3 cells transfected with human CYP3A4 cDNA (kindly provided by Dr Fink-Gremmel, University of Utrecht) served as one control source of cDNA while cloned CYP3A5 cDNA was provided by Dr Voice (University of Dundee).

For CYP4A11, cDNA samples (0.5 µl) were amplified with primers (sense, 5'-CTCCTCTCCATTTATGGC-3'; antisense, 5'-GGAGGCCCTCAAAGCTGGTCCTTGT-3') spanning nt 1266–1599 of CYP4A11 (26). PCR reaction conditions were as described for CYP3A4/5, except the annealing temperature was raised to 52°C. Cloned CYP4A11 cDNA (from Dr Voice) and CYP1A2 cDNA obtained from CYP1A2 cDNA-transfected NIH 3T3 cells (provided by Dr Fink-Gremmel) served as positive and negative control material during amplification reactions. GADPH amplification was used throughout CYP3A and CYP4A11 analysis to ensure integrity of oesophageal cDNA samples in PCR reactions.

PCR reaction and digestion products were electrophoresed in 2% agarose gels and stained with ethidium bromide. All analyses were repeated at least twice. Unfortunately, for six of the 25 samples no RT–PCR product could be generated due to partial degradation of the mRNA. No attempt was made to obtain quantitative RT–PCR data, rather these results were used as a qualitative confirmation of the presence of mRNA encoding the proteins identified in the immunoblots.

Statistical analysis
Subjects were categorized for the various clinical and lifestyle parameters considered in the study. Mean intensities of staining by immunoblot were calculated for each group and compared either by Student's t-test or the alternate t-test depending on the similarity or otherwise of the standard deviations. Statistical significance was considered at P = 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
CYP protein detection by immunoblot
The CYPs investigated by immunoblot were CYP1A1/2, CYP2A6, CYP2E1, CYP3A4/5 and CYP4A. All the tissue specimens tested revealed a single immunoreactive protein with each of the antibodies at a molecular weight equivalent to that observed in the human liver and lung preparations. However, there were marked interindividual variations in the amount of protein, ranging from 8-fold with CYP4A to 43-fold with CYP2E1. Some individuals (e.g. patients 1, 2 and 12; Figure 1Go) appeared to express high levels of several CYP enzymes but this was not related to any of the patient information collected in the study (see below). Comparisons of the intensities of staining between liver, lung and oesophagus show tissue-specific differences in expression of these enzymes. The antibody directed to human CYP2E1 revealed a single band in oesophageal microsomes but in most cases with 5- to 20-fold lower intensity than the equivalent band stained in liver microsomes. The intensity of staining in oesophagus was of a similar order to that in the lung. One immunoreactive CYP1A1/2 protein band was observed in oesophagus with an intensity of staining similar in amount to that in lung but somewhat greater (up to 10-fold) than in liver microsomes. CYP4A staining was weak in all oesophageal samples examined and proved to be relatively constant between individuals. CYP2A6 and CYP3A4/5 were also detected clearly in oesophageal microsomes and at similar amounts to those in liver. However, given that liver and lung microsomes from only one individual were included for comparison the relative amounts of P450 in oesophageal microsomes compared with these tissues can only be considered preliminary. In addition, it should be noted that while the CYP protein level for a given quantity of microsomes in oesophagus and liver may be similar, the absolute quantities of protein and therefore metabolic capacity are higher in the liver.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. Immunoblotting of oesophageal cytochrome P450s: CYP1A1/2, CYP2A6, CYP2E1, CYP3A4/5 and CYP4A. Microsomes (25 µg protein) from individual oesophageal mucosa were analysed by immunoblotting as described in Materials and methods. In this figure a representative sample of those specimens analysed is presented. Microsomal protein (25 µg protein except for the liver on the immunoblot for CYP4A where 5 µg protein was loaded) from human lung (A) and liver (B) were analysed on the same membrane for comparison. Densitometric values of staining intensity for each patient were adjusted for staining intensity of the liver microsomes on the same immunoblot for calculation of interindividual variations in protein levels. The fold variation in intensity of staining between samples on these particular immunoblots was 5.2, 1.9, 15, 5.4 and 5.2 for CYP 1A1/2, CYP2A6, CYP2E1, CYP3A4/5 and CYP4A, respectively. Variation in staining intensities for a given CYP between all samples examined was greater than that in the samples presented in the figure, namely 14.5-, 22-, 43-, 12.6- and 8-fold for CYP 1A1/2, CYP2A6, CYP2E1, CYP3A4/5 and CYP4A, respectively.

 
Patient characteristics and CYP protein levels
The level of expression of the individual enzymes in the normal mucosa, as determined by quantitation of immunoblot staining intensities, was not associated with histological type or other characteristics (stage and location) of the tumour (data not shown). Data concerning smoking and drinking were collected from all patients by questionnaire, but no significant correlation was observed between these exposures and the level of cytochrome P450 proteins. Similarly, neither the index of gastro-oesophageal reflux nor hot beverage intake were correlated with any of the specific CYP enzyme levels. However, for each of these parameters the small number of patients limited the statistical power of such an analysis.

CYP-specific mRNA detected by RT–PCR
The RT–PCR data on CYP3A4 and CYP3A5 demonstrated a strong positive signal with the primers specific for the latter isoenzyme in all 16 oesophageal samples tested (Figure 2Go); the specificity of the assay was confirmed using cDNA for these two enzymes. None of these samples expressed the CYP3A4 isoform.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2. Representative RT–PCR and restriction digest for CYP3A4/5 mRNA differentiation in oesophageal cDNA. Results obtained for control CYP3A5 (1) and CYP3A4 (2) cDNA after (a) primary amplification, (b) post-DpnII and (c) post-DpnII and AciI digestion are depicted in lanes 1a–c and 2a–c, respectively. Restriction results for two representative oesophageal samples are displayed in lanes 4a–c and 5a–c. Cyp1A2 plasmid cDNA served as a negative control for the primary amplification (lane 3). Outside lanes contain 50 bp ladder standards.

 
The results obtained by RT–PCR for other CYPs also demonstrated the presence of CYP2E1, CYP1A1, CYP1A2 and CYP4A11 mRNA in the oesophageal epithelium (data not shown). The RT–PCR data were only evaluated on a qualitative level (Table IIGo), but it is notable that CYP1A2 mRNA was only detected in 11 out of 19 oesophageal mucosal specimens while CYP1A1 and 2E1 were detected in the majority (16 and 17, respectively). CYP2B6/7 mRNA was not detected in any sample, whereas CYP4B1 was detected in all cases. CYP4A11 mRNA was present in all but one sample, as evidenced by the presence of a 333 bp product.


View this table:
[in this window]
[in a new window]
 
Table II. Qualitative analysis of CYP mRNA expression in normal human oesophageal mucosa
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The expression of cytochrome P450s was investigated by use of specific antibodies in immunoblots and by specific mRNA analysis by RT–PCR in a series of 25 histologically normal non-tumourous oesophageal mucosa specimens from cancer patients. Evidence for expression of a number of carcinogen metabolizing enzymes was obtained by these methods. The presence of CYP1A, 2E1, 3A5 and 4A was demonstrated by both techniques; CYP2A reactive protein was also detected by immunoblot but no cDNA could be generated for 2A6/7. Finally, CYP4B1 protein, but not CYP2B6 mRNA, was detected.

The extrahepatic expression of CYP enzymes in man is still relatively poorly characterized. Two previous studies have examined human oesophagus for P450s in some detail (12,13). Murray et al. (12) examined a small series of 10 non-tumourous oesophageal mucosa specimens obtained from cancer patients. They examined CYP1A, 2C9 and 3A protein expression and obtained positive results only for CYP1A (three of 10 cases). In contrast, in 50 oesophageal tumour specimens positive staining for all three enzymes was frequently observed; there were no differences in CYP expression between patients with squamous cell or adenocarcinoma. Nakajima et al. (13) studied only five non-tumourous oesophageal mucosal samples from Chinese oesophageal cancer patients by immunoblot and reported the presence of CYP1A1/2 in all of these; protein levels were higher still in tumourous mucosa in a larger series of patients. CYP2B6 and 3A staining was observed in a proportion of samples, but it appears from their report that only tumour samples were examined for these enzymes.

The data in the current paper concern a larger series of normal oesophageal mucosa than previously studied and the rapid freezing of samples post-surgery allowed the more specific approach of mRNA transcript analysis to be performed. The CYP3A protein, which could be CYP3A4 or CYP3A5 based on antibody cross-reactivity, was detected by immunoblot. This is consistent with the immunoblot data of Nakajima et al. (13). An in situ hybridization study performed on four oesophageal mucosa specimens using a CYP3A4 probe revealed a positive signal but, as this probe also hybridized with CYP3A5 and CYP3A3, no definitive conclusions about CYP3A enzyme expression could be drawn (24). Development of an RT–PCR assay which discriminates between CYP3A4 and CYP3A5 mRNA (Figure 2Go) permitted us to assign the CYP3A protein present in oesophageal mucosa as predominantly CYP3A5. In our series of patients CYP3A5 mRNA was detectable in all oesophageal mucosa samples, whilst CYP3A4 mRNA was not detectable in any.

The current data confirm the previous observations (12,13) that enzymes of the CYP1A family are present in oesophagus. Only a single immunoreactive protein is revealed by immunoblot (Figure 1Go) with an antibody preparation which recognizes CYP1A1 and 1A2. CYP1A1 is expressed in human lung and the human lung microsomes used as a positive control on the immunoblot revealed a single band at the same position on the gel as that seen in oesophagus. However, in the liver microsomes, in which only CYP1A2 is expected to be expressed, a single band was also revealed on all immunoblots. Under the conditions used with these antibodies we could not discern a difference in the molecular weight of the lung and liver bands. Consequently, from the immunoblot data we cannot conclude whether only CYP1A1 or both 1A1 and 1A2 are present. Although CYP1A2 has been shown to be mainly expressed in the liver, some extrahepatic expression occurs (27,28). CYP1A1 mRNA was detected in all the samples examined, whereas CYP1A2 mRNA was observed in only about half. Those samples without the presence of CYP1A2 mRNA did not have noticeably lower CYP1A protein levels and CYP1A2 mRNA detection was not associated with a particular exposure group (e.g. smokers or alcohol drinkers). From the combined mRNA and protein data we therefore conclude that CYP1A1 is expressed in human oesophagus. Further study is needed, using other molecular and immunological approaches, e.g. more specific monoclonal antibodies, to reach a conclusion with respect to CYP1A2.

The identification of CYP2E1 in human oesophagus is a novel finding supported both by presence of the protein using an antibody to human CYP2E1 and its mRNA transcript. Of relevance to the association between alcohol consumption and cancer risk is the fact that CYP2E1 was also identified in human larynx, as were CYP1A, 2C, 3A4 and 2A6 (29). CYP2E1 has been reported previously in mouse oesophagus (30). In addition, oesophageal microsomes have been shown to metabolize the N-nitrosamine N-nitrosodimethylamine, an activity catalysed by CYP2E1 (31).

The proteins of CYP2A and 4A were detected in the current study and identification of at least one member of the CYP4A family, CYP4A11, was confirmed by RT–PCR. Finally, mRNA of CYP4B1 was also demonstrated. In the case of CYP2A and CYP4B1, where only one technique was used for analysis, confirmation of their expression will require further study. CYP2B6 mRNA was absent in this study, somewhat in contradiction of the immunoblot data of Nakajima et al. (13), where up to half the samples were positive. This difference may be a function of increased expression of CYP in oesophageal tumours compared with normal mucosa. However, more recently we have used an anti-rat CYP2B antibody for immunoblotting on a few of the oesophageal microsomal preparations and obtained a positive signal (unpublished data), suggesting that the mRNA data may reflect a limited stability of CYP2B6 mRNA in oesophageal cells. Finally, it should be noted that these data were obtained on subjects from different populations and consequently ethnic group differences in the expression of CYP enzymes could occur.

Significant interindividual variations in hepatic P450 levels are known to occur (22) and a similar variation is seen in the oesophagus. Several endogenous parameters and environmental factors modulate the constitutive expression and the inducibility of these enzymes (3234). For example, smoking and alcohol are known to induce CYP1A and 2E1, respectively, in human lung (27) and liver (35,36). It is unknown whether these exposures also induce these enzymes in oesophageal mucosa. We attempted to examine this question by correlating questionnaire data on environmental exposures with presence and levels of specific CYP, in particular whether alcohol intake was associated with higher CYP2E1 in oesophagus as in liver. No such association was found, although it is important to emphasize that the small number of patients studied prevents firm conclusions being drawn concerning this question. Apart from the small size of the study, the lack of association could reflect the short-term duration of any induction combined with the delay in obtaining specimens after the exposure last occurred. Patients were operated on within 10–14 days of diagnosis and 24 h after admission, consequently, the delays between diagnosis, admission and surgery are relatively short. In this regard it is of note that hepatic CYP2E1 (mRNA and protein) was shown to be still elevated in heavy drinkers 36 h after the last alcohol intake (36).

The oesophageal mucosal specimens studied were from both squamous cell carcinoma and adenocarcinoma patients. The aetiology of these types of carcinoma is thought to differ; squamous cell carcinoma is more strongly associated with tobacco and alcohol while adenocarcinoma is associated both with smoking and gastro-oesophageal reflux, with little evidence to date for a role of alcohol (1,6,7). However, our primary objective was to examine histologically normal oesophageal mucosa for the expression of CYP enzymes and in this respect the histological type of the tumour was of limited significance. This was also suggested by the fact that samples from the two groups of patients did not differ qualitatively or quantitatively in CYP expression.

The presence of a number of different CYP enzymes in oesophageal mucosa suggests that several xenobiotic chemicals to which humans are exposed could be metabolized in the basal cell layer of the epithelium. Indeed CYP1A1/2 and 3A4 are involved in the metabolism of many polycyclic aromatic hydrocarbons, including benzo[a]pyrene (8), while CYP2A6 and 2E1 are known to activate NNO and other carcinogens to DNA-damaging metabolites (19,37,38). This is consistent with earlier studies showing the presence of carcinogen–DNA adducts in oesophageal epithelium (39). Carcinogen metabolism and subsequent DNA damage will also be influenced by expression of phase II metabolizing enzymes and several glutathione S-transferases are also expressed in human oesophagus (13). In considering the impact of CYP expression in oesophagus on the carcinogenic process it is important to also consider the impact of environmental exposures on hepatic metabolism. George et al. (40,41) described a reduction in CYP1A2, 2E1 and 3A4 mRNA and CYP protein levels in patients suffering from chronic liver disease. This decrease, due for example to cirrhosis induced by chronic alcohol consumption, could result in a decreased metabolism of carcinogens in the liver and consequently in a higher systemic exposure of oesophageal mucosa to these compounds (42,43). Complementary studies on P450 enzymatic activities (31) will be valuable in further elucidating the role of these enzymes in the process of oesophageal carcinogenesis in man.


    Acknowledgments
 
The authors would like to thank Anne-Marie Camus for provision of human lung and liver microsomes. The excellent work of Alain Schouft in the mRNA analysis was essential to the success of this project. NIH 3T3 cell lines transfected with CYP1A2 and 3A4 cDNA were kindly donated by Professor J.Fink-Gremmel (University of Utrecht, The Netherlands) and served as control sources of cDNA. Control CYP4A11 and CYP3A5 cDNA were provided by Dr M.Voice (Biomedical Research Centre, University of Dundee, UK).


    Notes
 
6 Present address: Centre Francois Baclesse, CJF9603-EA1772, Caen, France Back

7 Present address: Department of Surgery, Dalhousie University, Halifax, Nova Scotia, Canada Back

8 To whom correspondence should be addressed at Molecular Epidemiology Unit, School of Medicine, Algernon Firth Building, University of Leeds, Leeds LS2 9JT, UK Email: c.p.wild{at}leeds.ac.uk Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Tuyns,A.J., Péquignot,G. and Jensen,O.M. (1977) Le cancer de l'oesophage en Ille-et-Villaine en fonction de niveau de consommation d'alcool et de tabac. Des risques qui se multiplient. Bull. Cancer, 64, 45–60.[Web of Science][Medline]
  2. Tuyns,A.J., Riboli,E., Doornbos,G. and Péquignot,G. (1987) Diet and oesophageal cancer in Calvados (France). Nutr. Cancer, 9, 81–92.[Medline]
  3. O'Neill,I.K., Chen,J. and Bartsch,H. (1991) Relevance to Human Cancer of N-Nitroso Compounds, Tobacco Smoke and Mycotoxins. IARC Scientific Publications no. 105, IARC, Lyon.
  4. De Stefani,E., Munoz,N., Esteve,J., Vasallo,A., Victora,C.G. and Teuchmann,S. (1990) Mate drinking, alcohol, tobacco, diet and esophageal cancer in Uruguay. Cancer Res., 50, 426–431.[Abstract/Free Full Text]
  5. Yang,C.S. (1980) Research on esophageal cancer in China: a review. Cancer Res., 40, 2633–2644.[Abstract/Free Full Text]
  6. Kim,R., Weissfeld,J.L., Reynolds,J.C. and Kuller,L.H. (1997) Etiology of Barrett's metaplasia and esophageal adenocarcinoma. Cancer Epidemiol. Biomarkers Prev., 6, 369–377.[Abstract]
  7. Gammon,M.D., Schoenberg,J.B., Ahsan,H. et al. (1997) Tobacco, alcohol, socioeconomic status and adenocarcinomas of the esophagus and gastric cardia. J. Natl Cancer Inst., 89, 1277–1284.[Abstract/Free Full Text]
  8. Gonzalez,F.J. and Gelboin,H.V. (1992) Human cytochromes P450: evolution and cDNA-directed expression. Environ. Health Perspect., 98, 81–85.[Web of Science][Medline]
  9. Wolf,C.R., Smith,C.A.D. and Forman,D. (1994) Metabolic polymorphisms in carcinogen metabolising enzymes and cancer susceptibility. Br. Med. Bull., 50, 718–731.[Abstract/Free Full Text]
  10. Guengerich,F.P. (1988) Roles of cytochrome P-450 enzymes in chemical carcinogenesis and cancer chemotherapy. Cancer Res., 48, 2946–2954.[Free Full Text]
  11. Kawajiri,K. and Fujii-Kuriyama,Y. (1991) P450 and human cancer. Jpn. J. Cancer Res., 82, 1325–1335.[Web of Science][Medline]
  12. Murray,G.I., Shaw,D., Weaver,R.J., McKay,J.A., Ewen,S.W., Melvin,W.T. and Burke,M.D. (1994) Cytochrome P450 expression in oesophageal cancer. Gut, 35, 599–603.[Abstract/Free Full Text]
  13. Nakajima,T., Wang,R.S., Nimura,Y., Pin,Y.M., He,M., Vainio,H., Murayama,N., Aoyama,T. and Iida,F. (1996) Expression of cytochrome P450s and glutathione S-transferases in human esophagus with squamous-cell carcinomas. Carcinogenesis, 17, 1477–1481.[Abstract/Free Full Text]
  14. McKinnon,R.A., Burgess,W.M., Hall,P.M., Roberts-Thomson,S.J., Gonzalez,F.J. and McManus,M.E. (1995) Characterisation of CYP3A gene subfamily expression in human gastrointestinal tissues. Gut, 36, 259–267.[Abstract/Free Full Text]
  15. McDonnell,W.M., Scheiman,J.M. and Traber,P.G. (1992) Induction of cytochrome P4501A genes (CYP1A) by omeprazole in the human alimentary tract. Gastroenterology, 103, 1509–1516.[Web of Science][Medline]
  16. Huang,Q., Stoner,G., Resau,J., Nichols,J. and Mirvish,S.S. (1992) Metabolism of N-nitrosomethyl-N-amylamine by microsomes from human and rat esophagus. Cancer Res., 52, 3547–3551.[Abstract/Free Full Text]
  17. Perrot,N., Nalpas,B., Yang,C.S. and Beaune,P.H. (1989) Modulation of cytochrome P450 isozymes in human liver, by ethanol and drug intake. Eur. J. Clin. Invest., 19, 549–555.[Web of Science][Medline]
  18. Crespi,C.L., Penman,B.W., Gelboin,H.V. and Gonzalez,F.J. (1991) A tobacco smoke derived nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone is activated by multiple human cytochrome P450s including the polymorphic human cytochrome P450 2D6. Carcinogenesis, 12, 1197–1201.[Abstract/Free Full Text]
  19. Guengerich,F.P. (1991) Oxidation of toxic and carcinogenic chemicals by human cytochrome P-450 enzymes. Chem. Res. Toxicol., 4, 391–407.[Web of Science][Medline]
  20. Yang,C.S., Yoo,J.S., Ishizaki,H. and Hong,J.Y. (1990) Cytochrome P450IIE1: roles in nitrosamine metabolism and mechanisms of regulation. Drug Metab. Rev., 22, 147–159.[Web of Science][Medline]
  21. Yoo,J.S., Guengerich,F.P. and Yang,C.S. (1988) Metabolism of N-nitrosodialkylamines by human liver microsomes. Cancer Res., 48, 1499–1504.[Abstract/Free Full Text]
  22. Forrester,L.M., Henderson,C.J., Glancey,M.J., Back,D.J., Park,B.K., Ball,S.E., Kitteringham,N.R., McLaren,A.W., Miles,J.S., Skett,P. and Wolf,C.R. (1992) Relative expression of cytochrome P450 isoenzymes in human liver and association with the metabolism of drugs and xenobiotics. Biochem. J., 281, 359–368.
  23. Casson,A.G., Wilson,S.E., McCart,J.A., O'Malley,F., Ozcelik,H., Tsao,M.S. and Chambers,A.F. (1997) Ras mutation and the expression of the ras regulated genes osteopontin and cathepsin L, in human oesophageal cancer. Int. J. Cancer, 72, 739–745.[Web of Science][Medline]
  24. Hakkola,J., Pasanen,M., Purkunen,R., Saarikoski,S., Pelkonen,O., Maenpaa,J., Rane,A. and Raunio,H. (1994) Expression of xenobiotic-metabolizing cytochrome P450 forms in human adult and fetal liver. Biochem. Pharmacol., 48, 59–64.[Web of Science][Medline]
  25. Aoyama,T., Yamano,S., Waxman,D.J. et al. (1989) Cytochrome P-450 hPCN3, a novel cytochrome P-450 IIIA gene product that is differentially expressed in adult human liver. J. Biol. Chem., 264, 10388–10395.[Abstract/Free Full Text]
  26. Palmer,C., Richardson,T.H., Griffin,K.J., Hsu,M.H., Muerhoff,A.S., Clark,J.E. and Johnson,E.F. (1993) Characterisation of a cDNA encoding a human kidney cytochrome P450 4A fatty acid omega-hydroxylase and the cognate enzyme expressed in Escherichia coli. Biochim. Biophys. Acta, 1172, 161–166.[Medline]
  27. Eaton,D.L., Gallagher,E.P., Bammler,T.K. and Kunze,K.L. (1995) Role of cytochrome P4501A2 in chemical carcinogenesis: implications for human variability in expression and enzyme activity. Pharmacogenetics, 5, 259–274.[Web of Science][Medline]
  28. McKinnon,R.A., Hall,P.D., Quattrochi,L.C., Tukey,R.H. and McManus,M.E. (1991) Localization of CYP1A1 and CYP1A2 messenger RNA in normal human liver and in hepatocellular carcinoma by in situ hybridization. Hepatology, 14, 848–856.[Web of Science][Medline]
  29. Degawa,M., Stern,S.J., Martin,M.V., Guengerich,F.P., Fu,P.P., Ilett,K.F., Kaderlik,R.K. and Kadlubar,F.F. (1994) Metabolic activation and carcinogen–DNA adduct detection in human larynx. Cancer Res., 54, 4915–4919.[Abstract/Free Full Text]
  30. Freeman,J.E., Stirling,D., Russell,A.L. and Wolf,C.R. (1992) cDNA sequence, deduced amino acid sequence, predicted gene structure and chemical regulation of mouse Cyp2e1. Biochem. J., 281, 689–695.
  31. Smith,T.J., Liao,A., Wang,L.-D., Yang,G.-Y., Starcic,S., Philbert,M.A. and Yang,C.S. (1998) Characterization of xenobiotic-metabolizing enzymes and nitrosamine metabolism in the human esophagus. Carcinogenesis, 19, 667–672.[Abstract/Free Full Text]
  32. Watkins,P.B., Wrighton,S.A., Maurel,I., Schuetz,E.G., Mendez-Picon,G., Parker,G.A. and Guzelian,P.S. (1985) Identification of an inducible form of cytochrome P-450 in human liver. Proc. Natl Acad. Sci. USA, 82, 6310–6314.[Abstract/Free Full Text]
  33. Johansson,I., Eliasson,E. and Ingelman-Sundberg,M. (1991) Hormone controlled phosphorylation and degradation of cyp2B1 and cyp2E1 in isolated rat hepatocytes. Biochem. Biophys. Res. Commun., 174, 37–42.[Web of Science][Medline]
  34. Brown,L.M., Hoover,R.N., Greenberg,R.S., Schoenberg,J.B., Schwartz,A.G., Swanson,G.M., Liff,J.M., Silverman,D.T., Hayes,R.B. and Pottern,L.M. (1994) Are racial differences in squamous cell esophageal cancer explained by alcohol and tobacco use? J. Natl Cancer Inst., 86, 1340–1345.[Abstract/Free Full Text]
  35. Girre,C., Lucas,D., Hispard,E., Menez,C., Dally,S. and Menez,J.F. (1994) Assessment of cytochrome P4502E1 induction in alcoholic patients by chlorzoxazone pharmacokinetics. Biochem. Pharmacol., 47, 1503–1508.[Web of Science][Medline]
  36. Takahashi,T., Lasker,J.M., Rosman,A.S. and Lieber,C.S. (1993) Induction of cytochrome P-4502E1 in the human liver by ethanol is caused by a corresponding increase in encoding messenger RNA. Hepatology, 17, 236–245.[Web of Science][Medline]
  37. Camus,A.M., Geneste,O., Honkakoski,P., Bereziat,J.C., Henderson,C.J., Wolf,C.R., Bartsch,H. and Lang,M.A. (1993) High variability of nitrosamine metabolism among individuals: role of cytochromes P450 2A6 and 2E1 in the dealkylation of N-nitrosodimethylamine and N-nitrosodiethylamine in mice and humans. Mol. Carcinogen., 7, 268–275.[Web of Science][Medline]
  38. Crespi,C.L., Penman,B.W., Leakey,J.A., Arlotto,M.P., Stark,A., Parkinson,A., Turner,T., Steimel,D.T., Rudo,K. and Davies,R.L. (1990) Human cytochrome P450IIA3: cDNA sequence, role of the enzyme in the metabolic activation of promutagens, comparison to nitrosamine activation by human cytochrome P450IIE1. Carcinogenesis, 11, 1293–1300.[Abstract/Free Full Text]
  39. Umbenhauer,D., Wild,C.P., Montesano,R., Saffhill,R., Boyle,J.M., Huh,N., Kirstein,U., Thomale,J., Rajewsky,M.F. and Lu,S.H. (1985) O(6)-methyldeoxyguanosine in oesophageal DNA among individuals at high risk of oesophageal cancer. Int. J. Cancer, 36, 661–665.[Web of Science][Medline]
  40. George,J., Liddle,C., Murray,M., Byth,K. and Farrell,G.C. (1995) Pre-translational regulation of cytochrome P450 genes is responsible for disease-specific changes of individual P450 enzymes among patients with cirrhosis. Biochem. Pharmacol., 49, 873–881.[Web of Science][Medline]
  41. George,J., Murray,M., Byth,K. and Farrell,G.C. (1995) Differential alterations of cytochrome P450 proteins in livers from patients with severe chronic liver disease. Hepatology, 21, 120–128.[Web of Science][Medline]
  42. Swann,P.F., Coe,A.M. and Mace,R. (1984) Ethanol and dimethylnitrosamine and diethylnitrosamine metabolism and disposition in the rat. Possible relevance to the influence of ethanol on human cancer incidence. Carcinogenesis, 5, 1337–1343.[Abstract/Free Full Text]
  43. Montesano,R. and Hall,J. (1984) Nitrosamine metabolism and carcinogenesis. In Chu,E.H.Y. and Generoso,W.M. (eds) Mutation, Cancer and Malformation. Plenum, New York, NY, pp. 447–464.
Received November 17, 1997; revised October 2, 1998; accepted October 5, 1998.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Drug Metab. Dispos.Home page
M. Shou and A. Y. H. Lu
Antibodies as a Probe in Cytochrome P450 Research
Drug Metab. Dispos., May 1, 2009; 37(5): 925 - 931.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
F. Kamangar, M. M. Schantz, C. C. Abnet, R. B. Fagundes, and S. M. Dawsey
High Levels of Carcinogenic Polycyclic Aromatic Hydrocarbons in Mate Drinks
Cancer Epidemiol. Biomarkers Prev., May 1, 2008; 17(5): 1262 - 1268.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Rossini, D.C.M. Rapozo, S.C. Soares Lima, D.P. Guimaraes, M.A. Ferreira, R. Teixeira, C.D.P. Kruel, S.G.S. Barros, N.A. Andreollo, R. Acatauassu, et al.
Polymorphisms of GSTP1 and GSTT1, but not of CYP2A6, CYP2E1 or GSTM1, modify the risk for esophageal cancer in a western population
Carcinogenesis, December 1, 2007; 28(12): 2537 - 2542.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
C. Dandara, D.-P. Li, G. Walther, and M.I. Parker
Gene-environment interaction: the role of SULT1A1 and CYP3A5 polymorphisms as risk modifiers for squamous cell carcinoma of the oesophagus
Carcinogenesis, April 1, 2006; 27(4): 791 - 797.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
J. Hukkanen, P. Jacob III, and N. L. Benowitz
Metabolism and Disposition Kinetics of Nicotine
Pharmacol. Rev., March 1, 2005; 57(1): 79 - 115.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Michael and M.M. Doherty
Tumoral Drug Metabolism: Overview and Its Implications for Cancer Therapy
J. Clin. Oncol., January 1, 2005; 23(1): 205 - 229.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
W. Ye, M. Held, J. Lagergren, L. Engstrand, W. J. Blot, J. K. McLaughlin, and O. Nyren
Helicobacter pylori Infection and Gastric Atrophy: Risk of Adenocarcinoma and Squamous-Cell Carcinoma of the Esophagus and Adenocarcinoma of the Gastric Cardia
J Natl Cancer Inst, March 3, 2004; 96(5): 388 - 396.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
P. D. Terry, J. Lagergren, A. Wolk, G. Steineck, and O. Nyren
Dietary Intake of Heterocyclic Amines and Cancers of the Esophagus and Gastric Cardia
Cancer Epidemiol. Biomarkers Prev., September 1, 2003; 12(9): 940 - 944.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W. Godoy, R. M. Albano, E. G. Moraes, P. R. A. Pinho, R. A. Nunes, E. H. Saito, C. Higa, I. M. Filho, C. D. P. Kruel, C. C. Schirmer, et al.
CYP2A6/2A7 and CYP2E1 expression in human oesophageal mucosa: regional and inter-individual variation in expression and relevance to nitrosamine metabolism
Carcinogenesis, April 1, 2002; 23(4): 611 - 616.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
L. F. Ribeiro Pinto, E. Moraes, R. M. Albano, M. C. Silva, W. Godoy, T. Glisovic, and M. A. Lang
Rat oesophageal cytochrome P450 (CYP) monooxygenase system: comparison to the liver and relevance in N-nitrosodiethylamine carcinogenesis
Carcinogenesis, November 1, 2001; 22(11): 1877 - 1883.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
S. C. Chen, L. Zhou, X. Ding, and S. S. Mirvish
Depentylation of the Rat Esophageal Carcinogen, Methyl-n-pentylnitrosamine, by Microsomes from Various Human and Rat Tissues and by Cytochrome P450 2A3
Drug Metab. Dispos., September 1, 2001; 29(9): 1221 - 1228.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
W. Tan, N. Song, G.-Q. Wang, Q. Liu, H.-J. Tang, F. F. Kadlubar, and D.-X. Lin
Impact of Genetic Polymorphisms in Cytochrome P450 2E1 and Glutathione S-Transferases M1, T1, and P1 on Susceptibility to Esophageal Cancer among High-Risk Individuals in China
Cancer Epidemiol. Biomarkers Prev., June 1, 2000; 9(6): 551 - 556.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (62)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lechevrel, M.
Right arrow Articles by Wild, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lechevrel, M.
Right arrow Articles by Wild, C. P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?