Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (119)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lunn, R. M.
Right arrow Articles by Taylor, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lunn, R. M.
Right arrow Articles by Taylor, J. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 20, No. 9, 1727-1731, September 1999
© 1999 Oxford University Press


Molecular Epidemiology and Cancer Prevention

Prostate cancer risk and polymorphism in 17 hydroxylase (CYP17) and steroid reductase (SRD5A2)

Ruth M. Lunn, Douglas A. Bell, James L. Mohler2 and Jack A. Taylor1,3

Laboratory of Computational Biology and Risk Assessment and
1 Epidemiology Branch and Laboratory of Molecular Carcinogenesis, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 and
2 Department of Surgery, Division of Urology, University of North Carolina, Chapel Hill, NC, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Prostate cancer is the most common malignancy in males and is the second most common cause of cancer mortality in American men. Polymorphisms have been identified in two genes, the 17-hydroxylase cytochrome P450 gene (CYP17) and the steroid 5-reductase type II gene (SRD5A2) that are involved with androgen biosynthesis and metabolism. The CYP17 A2 allele contains a T->C transition in the 5' promoter region that creates an additional Sp1-type (CCACC box) promoter site. The SRD5A2 valine to leucine (V89L) polymorphism has been correlated with lower dihydroxytestosterone levels. We tested genotypes in 108 prostate cases and 167 controls along with samples (n = 340) from several different ethnic groups. The CYP17 A2 allele (combined A1/A2 and A2/A2 genotypes) occurred at a higher frequency in Caucasian patients with prostate cancer (70%) than in Caucasian clinical control urology patients (57%), suggesting that the A2 allele may convey increased risk for prostate cancer [odds ratio (OR) = 1.7, 95% confidence interval (CI) = 1.0–3.0]. Blacks and Caucasians had a similar frequency of the A2 genotype (16 and 17%, respectively) while Taiwanese had the highest frequency (27%). The SRD5A2 leucine genotype was most frequent in Taiwanese (28%), intermediate in Caucasians (8.5%) and lowest in Blacks (2.5%). Genotypes having a SRD5A2 leucine allele were somewhat more common in prostate cancer cases (56%) than in controls (49%) (OR = 1.4, 95% CI = 0.8–2.2) but this difference was not significant. These results support the hypothesis that some allelic variants of genes involved in androgen biosynthesis and metabolism may be associated with prostate cancer risk.

Abbreviations: AR, androgen receptor; AR–DHT, androgen receptor–dihydroxytestosterone complex; BPH, benign prostate hypertrophy; CI, confidence interval; CYP17, 17-hydroxylase cytochrome P450; DHT, dihydroxytestosterone; OR, odds ratio; PCR, polymerase chain reaction; SRD5A2, steroid 5-reductase type II.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Prostate cancer is the most common malignancy and is the second most common cause of cancer mortality in American men (1). Despite its impact on public health, little is known about its etiology. Studies of risk factors such as occupation, diet, smoking, alcohol and sexual activity are inconclusive (25). However, age, ethnicity and family history clearly affect the risk of prostate cancer (68). Eighty percent of prostate cancer develops in men over 65 years of age. Prostate cancer incidence is 20- to 30-fold higher in American Blacks than in Asians and is intermediate in American Caucasians (6,7). Men having two or more affected first-degree relatives are 5 to 11 times more likely to develop prostate cancer (9).

Steroid hormones appear to be important determinants of prostate cancer risk. Androgens are potent prostate mitogens (10) and elevated androgen levels may be associated with prostate cancer risk. Gann et al. (11) reported increasing risk of prostate cancer with increasing levels of plasma testosterone; however, other studies have failed to observe an association (1214) and plasma levels of testosterone may not accurately measure the amount of free testosterone in the prostate (11). Testosterone is synthesized from cholesterol by a series of enzymatic reactions involving several of the cytochrome P450 enzymes (for a review, see ref. 15) (Figure 1Go). Of interest is CYP17, which catalyzes two sequential reactions in the steroid biosynthesis pathway. The first step is the conversion of pregnenolone to 17-hydroxypregnenolone, which is subsequently converted to C19 steroid dehydroepiandrosterone, a compound with androgenic activity (15). A T->C transition (A2 allele) in the 5' promotor region of CYP17 creates an additional Sp1-type (CCACC box) promoter site, suggesting that the A2 allele may have an increased rate of transcription. Although the effect of this allele on phenotype has not been demonstrated, it has been associated with elevated serum estrogen and progesterone concentration in nulliparous women (16).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. Model of steroid-dependent prostate carcinogenesis. A simplified diagram of the biosynthesis pathway of testosterone and its conversion to DHT is shown. Testosterone is converted into DHT in the prostate epithelial cells. Both DHT and testosterone can bind the AR; DHT binds the AR with 4- to 5-fold higher affinity than testosterone. The activated AR–DHT complex binds to androgen-responsive elements of target genes involved in prostate cell proliferation. T, testosterone (36).

 
Testosterone is converted to 5{alpha}-dihydroxytestosterone (DHT) in the prostate by the enzyme 5{alpha}-reductase, type II (SRD5A2). DHT binds to the androgen receptor (AR) forming a complex (AR–DHT) which translocates to the nucleus and transactivates target genes (17, 18; Figure 1Go). A decrease in the length of the polymorphic trinucleotide CAG repeat in the AR gene enhances transactivation (19). Shorter repeats are found in Blacks and are associated with increased prostate cancer risk (17,20).

SRD5A2 activity (conversion of testosterone to DHT) varies in different ethnic populations, and polymorphisms in the SRD5A2 gene have been identified which correlate with enzyme activity and/or ethnicity (2124). Ross et al. (25) reported higher SRD5A2 activity in Blacks than in Asians, which parallels observed ethnic differences in prostate cancer risk. A valine to leucine polymorphism at codon 89 (V89L) has been reported, with the leucine allele (L) associated with lower steroid 5{alpha}-reductase activity and a lower prevalence in Blacks (21).

Using a case control study design, we studied the association between genetic polymorphism and prostate cancer risk in the putative protective allele (leucine) of the SRD5A2 gene and the hypothesized risk allele (A2) of the CYP17 gene.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Subjects
Subjects have been described previously in a study of vitamin D receptor polymorphisms and prostate cancer risk (26). Briefly, they consisted of 108 consecutive prostatectomy patients (96 Caucasians and 12 Blacks) at the University of North Carolina Hospitals in Chapel Hill, NC and 167 male non-cancer controls (159 Caucasians and eight Blacks) enrolled at the urology clinics at University of North Carolina Hospitals and at nearby Duke University Medical Center in Durham, NC. Most control subjects presented to the urology clinic for evaluation and treatment of voiding symptoms due to prostatic hypertrophy or impotence. Control subjects had no history of cancer other than non-melanoma skin cancer. Blood was collected from both cases and controls and DNA was extracted using standard phenol–chloroform methodology.

As an independent measure of allele frequency in different ethnic populations in North Carolina, gene frequencies were also determined for North Carolinian Black and Caucasian populations who have been described previously and been used in other genotyping studies (2730). Briefly, DNA was extracted from blood samples drawn from a community-based sample comprised of over 400 healthy unrelated Blacks and Caucasians from Durham and Chapel Hill, NC. A subset (n > 100) of each ethnic group (Blacks and Caucasians) were used for estimating CYP17 and SRD5A2 genotype frequencies. A larger sample of 176 Caucasians was used for SRD5A2 genotyping in order to provide a more precise estimate of the uncommon LL genotype. Allele frequency was also measured in 110 Taiwanese. Placenta DNA (kindly provided by Dr L.L.Hsieh) was isolated from 110 unrelated full-term maternity patients with uncomplicated pregnancy at the Chang Gung Memorial Hospital, Taiwan (31).

Genotyping
CYP17.
Polymorphisms in CYP17 were detected using polymerase chain reaction (PCR)–restriction fragment length polymorphism analysis. A 629 kb DNA fragment including the A1/A2 polymorphic site was amplified from 50 ng genomic DNA using the PCR primers CYP17214F (TCCTGAGCCCAGATACCAT) and CYP823R (CCGCCCAGAGAAGTCCT). The PCR reaction consisted of an initial 4 min denaturation step followed by 30 cycles of 30 s at 94°C, 30 s at 60°C and 30 s at 72°C. The presence of the A2 allele creates a MspAl restriction site in the PCR fragment. The PCR product was digested with MspA1 for 2 h at 37°C and run on 3% Nusieve 3:1 agarose gels (FMC Bioproducts, Rockland, ME). The A1/A1, A1/A2 and A2/A2 genotypes resulted in 577; 577, 305 and 272; and 305 and 272 bp digestion products, respectively. A 52 bp fragment was present in all samples due to an invariant MspA1 site that served as an internal control for complete digestion.

SRD5A2.
Fifty nanograms of genomic DNA was used in a 15 µl PCR reaction containing PCR primers SRD5A2415F (TCCAGAAGTTGCCGCATCAG) and SRD5A2039R (CGGTGCGCGCTCCAC) and 1x additive Q reagent (Qiagen, Santa Chatsworth, CA). Q reagent provided higher yields in optimization experiments. Cycling conditions were the same as for CYP17 except the annealing was at 65°C. The presence of the valine (V) at base 1007 results in an RsaI restriction site. The 639 bp PCR product encompassing the polymorphic site was digested with RsaI for 2 h at 37°C and the digestion products were separated using 2.5% Metaphor agarose gels (FMC Bioproducts). Polymorphic specific digestion products consisted of 100 and 20; 120, 100 and 20; and 120 bp fragments for the VV, VL and LL genotypes, respectively. Two fragments, 404 and 168 bp, were present in all samples due to invariant RsaI sites and served as internal controls for completed digestion.

Statistical analysis
Differences in genotype or allele frequency between the various ethnic groups (Blacks, Caucasians and Asians) were tested by pair-wise comparisons of {chi}2 2x3 or 2x2, contingency table analysis. The association between genetic polymorphisms and prostate cancer was evaluated by traditional 2x2 table analysis. Fisher exact odds ratio (OR) and the corresponding 95% confidence intervals (CIs) were calculated for each ethnic strata, and the Mantel–Haenszel weighted ORs (ORMH) were calculated for combined strata using the software EGRET [Epidemiological Graphics, Estimation, and Testing package analysis module (PECAN), v.0.22].


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Ethnic variation
We estimated genotype frequencies of CYP17 A1/A2 and SRD5A2 V/L genes in sample populations of North Carolinian Blacks and Caucasians and in Taiwanese (Table IGo). The genotype distribution for both CYP17 and SRD5A2 were found in Hardy–Weinberg equilibrium for each ethnic group. While the frequency of the CYP17 A2 allele (and resulting genotypes) was similar in Blacks (0.36) and Caucasians (0.38), the A2 allele was significantly more prevalent in Taiwanese (0.52), with P < 0.01 and P = 0.04 for Taiwanese versus Blacks and Caucasians, respectively. The distribution of the SRD5A genotypes was significantly different between all three populations, with the L allele occurring the highest in the Taiwanese (0.56), intermediate in Caucasians (0.38) and the lowest in Blacks (0.19) (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. SRD5A2 and CYP17 genotype and allele frequency among Taiwanese and North Carolinian populations of Caucasians and Blacks (community-based sample)
 
Case-control study
Caucasian prostate cancer cases more frequently carried the CYP17 A2 allele (70%) than did clinic controls (57%; OR = 1.7, 95%CI = 1.0–3.1; P = 0.05; Table IIGo). The same magnitude of effect was apparent when comparing the referent A1 homozygotes with heterozygotes or with homozygotes for the A2 allele (Table IIGo). Small sample sizes precluded calculations of OR for Blacks alone, but Blacks were included as a weighted strata in a combined ORMH of 1.7, 95% CI = 1.0–3.0; P = 0.04.


View this table:
[in this window]
[in a new window]
 
Table II. CYP17 genotypes among prostate cancer patients and controls
 
Stratified analyses were performed according to age at diagnosis (Table IIIGo). The cases and clinic controls were grouped according to the mean age of the Caucasian clinic controls (64 years) which was similar to the mean age of cases (63 years). Among those who were <=64 years at diagnosis, CYP17 A2-containing genotypes were significantly associated with prostate cancer (OR = 2.3, CI = 1.0–5.4; P = 0.03). Among older men, there was some evidence of increased risk from the A2 allele although this was not statistically significant. There was no evidence of an association between genotype and aggressiveness of tumor when comparing cases with Gleason grade <7 with those with Gleason grade >=7 ({chi}2 = 0.165, P = 0.684; data not shown). Stage data were not available for analysis.


View this table:
[in this window]
[in a new window]
 
Table III. CYP17 genotypes in prostate cancer stratified by age in Blacks and Caucasians
 
We were concerned that the controls included men with a clinical diagnosis of benign prostate hypertrophy (BPH) which could potentially be associated with differences in steroid metabolism. Therefore, we stratified the controls into those with BPH and those without BPH and evaluated the CYP17 genotype distribution in these populations. The OR estimate for the CYP17 A2 allele was higher when prostate cancer cases were compared with controls with BPH (OR = 2.3, 95% CI = 1.1–4.5) than when compared with controls without BPH (OR = 1.4, 95% CI = 0.7–2.7). However, these two estimates do not differ statistically from each other, and CYP17 genotype distribution of controls with BPH did not differ from controls without BPH ({chi}2 = 1.8, P = 0.18) or from Caucasian community population ({chi}2 = 0.95, P = 0.33). We also evaluated other diagnoses of the clinical controls, e.g. impotence, and found no relationship with genotype distribution.

Comparison of cases and controls for the SRD5A2 L allele revealed an association in the opposite direction to that predicted for this putative protective allele (Caucasians: OR = 1.4, 95% CI = 0.8–2.4) although this finding was not statistically significant (Table IVGo). The small number of Blacks precluded any analysis. No association was observed after stratifying by age or BPH classification (data not shown).


View this table:
[in this window]
[in a new window]
 
Table IV. SRD5A2 genotypes among prostate cancer patients and controls
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We evaluated the association between prostate cancer and polymorphisms in the CYP17 and SRD5A2 genes, two genes involved in the biosynthesis and metabolism of testosterone. Because testosterone and DHT are potent prostate mitogens, elevated levels in prostate tissue are hypothesized to play a role in unregulated prostate growth and tumorigenesis and have been shown to be associated with increased risk of prostate cancer (10,11). We found some evidence that the putative high activity allele (A2) of the CYP17 gene, which would be predicted to increase levels of testosterone, may be associated with prostate cancer (OR = 1.7, 95% CI = 1.0–3.0; P = 0.04).

The association between the A2 allele and prostate cancer was present in all men and stratifying by age revealed greater risk among men who developed disease at an earlier age (OR = 2.3, 95% CI = 1.0–5.4; P = 0.03). Testosterone levels decrease and sex hormone binding globin levels increase with increasing age (32). Thus, the proposed increased production of testosterone due to the A2 allele may be most important in early onset disease. Interestingly, the high-risk allele of the AR receptor is also primarily a risk factor in men under 60 years of age (17). We found no association between the CYP17 A2 allele and Gleason grade. However, because our sample was restricted to men undergoing prostectomy and who may, therefore, have less aggressive disease, we cannot rule out the possibility that the A2 allele may be associated with disease severity.

The observed difference between prostate cancer cases and clinical controls is unlikely to be the result of biased population sampling. Allele frequency in controls is consistent among Caucasians. There was no significant difference in our estimate of the A2 allele frequency from the Caucasian clinical controls (0.34, n = 158) than that of the Caucasian community population (0.38, n = 115; P = 0.38; Table IGo). Moreover, both of these allele frequency measurements are similar to that observed in Caucasian women controls from North Carolina (0.36, n = 379) and London (0.36 n = 47) (33) and not significantly different to two recent reports of Caucasian women controls from New York (0.42, n = 148) and Maryland (0.42, n = 113) (34,35).

One concern of our study was that the inclusion of BPH patients in our clinical controls could potentially bias results since BPH may be related to steroid hormone levels. The association between the A2 allele and prostate cancer was greatest when the controls with BPH were used as a referent (OR = 2.3, 95% CI = 1.1–4.5). However, the distribution of CYP17 A2 allele of Caucasian controls with BPH was not significantly different to that of Caucasian controls without BPH or the Caucasian community reference group, allowing us to use the combined BPH, non-BPH as the clinical control group

The A2 allele of the CYP17 gene occurred at a higher frequency in Taiwanese than in Blacks or Caucasians, which does not correlate with ethnic differences in cancer incidence. Indirect correlation between allele frequency, ethnicity and cancer incidence can be misleading, and the association between Cyp17 genotypes and prostate cancer remains to be tested in a Taiwanese population. The difference between risk due to genotype and risk due to ethnicity may be a result of the multiple genes involved in the predisposition to prostate cancer, or due to dietary or lifestyle differences between ethnic groups.

Following the hypothesis of Makridakis et al. (21) that the L allele of the SRD5A2 gene should be protective for prostate cancer, we evaluated the genotype distribution in our case-control population. We did not detect evidence of a protective effect from the L allele in Caucasian men in our prostate case-control study and in fact found a slight, but not statistically significant elevated risk from the allele. The L allele is associated with lower serum levels of 3{alpha}-androstanediol glucuronide (AAG), which is a measure of 5{alpha}-reductase activity (21). Weak associations between serum AAG and prostate cancer have been observed (11). This is the first case-control study to our knowledge investigating the valine/leucine alleles of the SRD5A2 gene. Studies of a TA repeat polymorphism in the 3'-untranslated region of the SRD5A2 gene have also failed to demonstrate significant difference between cases and controls (18,23). Because the number of Blacks in our study was small, we were unable to evaluate the effect of the L allele in this population. The effect of various polymorphisms of the SRD5A2 allele may vary in different ethnic groups, warranting more extensive multi-ethnic studies.

Although sex hormones appear to be involved in prostate carcinogenesis, the role of various polymorphisms in genes comprising the steroid biogenesis pathway are still unclear. Our study provides some evidence that the CYP17 A2 allele may correlate with risk for developing prostate cancer, but does not support the hypothesis that the SRD5A2 L allele is protective. Functional characterization of the different polymorphisms and their effect on steroid hormones in prostate tissue remain an important but relatively unexplored area.


    Acknowledgments
 
We thank Patricia Blanton and Lyle Lansdell for their assistance in sample management and data analysis. We gratefully acknowledge David Paulson and Cary Robertson at Duke University Medical center for providing some of the samples used in this study.


    Notes
 
3 To whom correspondence should be addressed at Molecular and Genetic Epidemiology Section, NIEHS, Mail Drop A3–05, PO Box 12233, Research Triangle Park, NC 27709, USA Email: taylor{at}niehs.nih.gov Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Landis,S.H., Murray,T., Bolden,S. and Wingo,P.A. (1998) Cancer statistics, 1998. CA Cancer J. Clin., 48, 6–29.[Abstract]
  2. Ilic,M., Vlajinac,H. and Marinkovic,J. (1996) Case-control study of risk factors for prostate cancer. Br. J. Cancer, 74, 1682–1686.[Web of Science][Medline]
  3. Daviglus,M.L., Dyer,A.R., Persky,V., Chavez,N., Drum,M., Goldberg,J., Liu,K., Morris,D.K., Shekelle,R.B. and Stamler,J. (1996) Dietary beta-carotene, vitamin C, and risk of prostate cancer: results from the Western Electric Study [see comments]. Epidemiology, 7, 472–477.[Web of Science][Medline]
  4. Lumey,L.H. (1996) Prostate cancer and smoking: a review of case-control and cohort studies [published erratum appears in Prostate (1996) 29, 402]. Prostate, 29, 249–260.[Web of Science][Medline]
  5. van der Gulden,J.W., Kolk,J.J. and Verbeek,A.L. (1992) Prostate cancer and work environment [see comments]. J. Occup. Med., 34, 402–409.[Web of Science][Medline]
  6. Whittemore,A.S. (1994) Trends in prostate cancer incidence and mortality. In Doll,R., Fraumeni,J.F. and Muir,C.S. (eds), Cancer Surveys. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  7. Parkin,D.M., Pisani,P. and Ferlay,J. (1993) Estimates of the worldwide incidence of eighteen major cancers in 1985. Int. J. Cancer, 54, 594–606.[Web of Science][Medline]
  8. Neuhausen,S.L., Skolnick,M.H. and Cannon-Albright,L. (1997) Familial prostate cancer studies in Utah. Br. J. Urol., 79 (Suppl. 1), 15–20.
  9. Steinberg,G.D., Carter,B.S., Beaty,T.H., Childs,B. and Walsh,P.C. (1990) Family history and the risk of prostate cancer. Prostate, 17, 337–347.[Web of Science][Medline]
  10. Lee,C. (1997) Cellular interactions in prostate cancer. Br. J. Urol., 79 (Suppl. 1), 21–27.
  11. Gann,P.H., Hennekens,C.H., Ma,J., Longcope,C. and Stampfer,M.J. (1996) Prospective study of sex hormone levels and risk of prostate cancer [see comments]. J. Natl Cancer Inst., 88, 1118–1126.[Abstract/Free Full Text]
  12. Carter,H.B., Pearson,J.D., Metter,E.J., Chan,D.W., Andres,R., Fozard,J.L., Rosner,W. and Walsh,P.C. (1995) Longitudinal evaluation of serum androgen levels in men with and without prostate cancer. Prostate, 27, 25–31.[Web of Science][Medline]
  13. Nomura,A.M., Stemmermann,G.N., Chyou,P.H., Henderson,B.E. and Stanczyk,F.Z. (1996) Serum androgens and prostate cancer. Cancer Epidemiol. Biomarkers Prev., 5, 621–625.[Abstract]
  14. Vatten,L.J., Ursin,G., Ross,R.K., Stanczyk,F.Z., Lobo,R.A., Harvei,S. and Jellum,E. (1997) Androgens in serum and the risk of prostate cancer: a nested case-control study from the Janus serum bank in Norway. Cancer Epidemiol. Biomarkers Prev., 6, 967–969.[Abstract]
  15. Waterman,M.R. and Keeney,D.S. (1992) Genes involved in androgen biosynthesis and the male phenotype. Horm. Res., 38, 217–221.[Web of Science][Medline]
  16. Feigelson,H.S., Shames,L.S., Pike,M.C., Coetzee,G.A., Stanczyk,F.Z. and Henderson,B.E. (1998) Cytochrome P450c17alpha gene (CYP17) polymorphism is associated with serum estrogen and progesterone concentrations. Cancer Res., 58, 585–587.[Abstract/Free Full Text]
  17. Stanford,J.L., Just,J.J., Gibbs,M., Wicklund,K.G., Neal,C.L., Blumenstein, B.A. and Ostrander,E.A. (1997) Polymorphic repeats in the androgen receptor gene: molecular markers of prostate cancer risk. Cancer Res., 57, 1194–1198.[Abstract/Free Full Text]
  18. Feigelson,H.S., Ross,R.K., Yu,M.C., Coetzee,G.A., Reichardt,J.K. and Henderson,B.E. (1996) Genetic susceptibility to cancer from exogenous and endogenous exposures. J. Cell Biochem., 25 (suppl.), 15–22.
  19. Choong,C.S., Kemppainen,J.A., Zhou,Z.X. and Wilson,E.M. (1996) Reduced androgen receptor gene expression with first exon CAG repeat expansion. Mol. Endocrinol., 10, 1527–1535.[Abstract/Free Full Text]
  20. Ingles,S.A., Ross,R.K., Yu,M.C., Irvine,R.A., La Pera,G., Haile,R.W. and Coetzee,G.A. (1997) Association of prostate cancer risk with genetic polymorphisms in vitamin D receptor and androgen receptor [see comments]. J. Natl Cancer Inst., 89, 166–170.[Abstract/Free Full Text]
  21. Makridakis,N., Ross,R.K., Pike,M.C., Chang,L., Stanczyk,F.Z., Kolonel, L.N., Shi,C.Y., Yu,M.C., Henderson,B.E. and Reichardt,J.K. (1997) A prevalent missense substitution that modulates activity of prostatic steroid 5{alpha}-reductase. Cancer Res., 57, 1020–1022.[Abstract/Free Full Text]
  22. Reichardt,J.K., Makridakis,N., Henderson,B.E., Yu,M.C., Pike,M.C. and Ross,R.K. (1995) Genetic variability of the human SRD5A2 gene: implications for prostate cancer risk. Cancer Res., 55, 3973–3975.[Abstract/Free Full Text]
  23. Kantoff,P.W., Febbo,P.G., Giovannucci,E., Krithivas,K., Dahl,D.M., Chang,G., Hennekens,C.H., Brown,M. and Stampfer,M.J. (1997) A polymorphism of the 5{alpha}-reductase gene and its association with prostate cancer: a case-control analysis. Cancer Epidemiol. Biomarkers Prev., 6, 189–192.[Abstract]
  24. Davis,D.L. and Russell,D.W. (1993) Unusual length polymorphism in human steroid 5{alpha}-reductase type 2 gene (SRD5A2). Hum. Mol. Genet., 2, 820.[Free Full Text]
  25. Ross,R.K., Bernstein,L., Lobo,R.A., Shimizu,H., Stanczyk,F.Z., Pike,M.C. and Henderson,B.E. (1992) 5-alpha-reductase activity and risk of prostate cancer among Japanese and US white and black males. Lancet, 339, 887–889.[Web of Science][Medline]
  26. Taylor,J.A., Hirvonen,A., Watson,M., Pittman,G., Mohler,J.L. and Bell, D.A. (1996) Association of prostate cancer with vitamin D receptor gene polymorphism. Cancer Res., 56, 4108–4110.[Abstract/Free Full Text]
  27. Bell,D.A., Taylor,J.A., Butler,M.A., Stephens,E.A., Wiest,J., Brubaker, L.H., Kadlubar,F.F. and Lucier,G.W. (1993) Genotype/phenotype discordance for human arylamine N-acetyltransferase (NAT2) reveals a new slow-acetylator allele common in African-Americans. Carcinogenesis, 14, 1689–1692.[Abstract/Free Full Text]
  28. Bell,D.A., Taylor,J.A., Paulson,D.F., Robertson,C.N., Mohler,J.L. and Lucier,G.W. (1993) Genetic risk and carcinogen exposure: a common inherited defect of the carcinogen-metabolism gene glutathione S-transferase M1 (GSTM1) that increases susceptibility to bladder cancer. J. Natl Cancer Inst., 85, 1159–1164.[Abstract/Free Full Text]
  29. Stephens,E.A., Taylor,J.A., Kaplan,N., Yang,C.H., Hsieh,L.L., Lucier,G.W. and Bell,D.A. (1994) Ethnic variation in the CYP2E1 gene: polymorphism analysis of 695 African-Americans, European-Americans and Taiwanese. Pharmacogenetics, 4, 185–192.[Web of Science][Medline]
  30. Watson,M.A., Stewart,R.K., Smith,G.B., Massey,T.E. and Bell,D.A. (1998) Human glutathione S-transferase P1 polymorphisms: relationship to lung tissue enzyme activity and population frequency distribution. Carcinogenesis, 19, 275–280.[Abstract/Free Full Text]
  31. Hsieh,L.L. and Hsieh,T.T. (1993) Detection of aflatoxin B1–DNA adducts in human placenta and cord blood. Cancer Res., 53, 1278–1280.[Abstract/Free Full Text]
  32. Wu,A.H., Whittemore,A.S., Kolonel,L.N., John,E.M., Gallagher,R.P., West,D.W., Hankin,J., Teh,C.Z., Dreon,D.M. and Paffenbarger,R.S.Jr (1995) Serum androgens and sex hormone-binding globulins in relation to lifestyle factors in older African-American, white, and Asian men in the United States and Canada. Cancer Epidemiol. Biomarkers Prev., 4, 735–741.[Abstract]
  33. Gharani,N., Waterworth,D.M., Williamson,R. and Franks,S. (1996) 5' polymorphism of the CYP17 gene is not associated with serum testosterone levels in women with polycystic ovaries [letter]. J. Clin. Endocrinol. Metab., 81, 4174.[Free Full Text]
  34. Helzlsouer,K.J., Huang,H.Y., Strickland,P.T., Hoffman,S., Alberg,A.J., Comstock,G.W. and Bell,D.A. (1998) Association between CYP17 polymorphisms and the development of breast cancer. Cancer Epidemiol. Biomarkers Prev., 7, 945–949.[Abstract]
  35. Weston,A., Pan,C.F., Bleiweiss,I.J., Ksieski,H.B., Roy,N., Maloney,N. and Wolff,M.S. (1998) CYP17 genotype and breast cancer risk [In Process Citation]. Cancer Epidemiol. Biomarkers Prev., 7, 941–944.[Abstract]
  36. Galbraith,S.M. and Duchesne,G.M. (1997) Androgens and prostate cancer: biology, pathology and hormonal therapy. Eur. J. Cancer, 33, 545–554.
Received December 15, 1998; revised April 21, 1999; accepted May 17, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J AndrolHome page
S. Rajender, K. Vijayalakshmi, S. Pooja, S. Madhavi, S. F. D. Paul, V. Vettriselvi, S. Shroff, L. Singh, and K. Thangaraj
Longer (TA)n Repeat but Not A49T and V89L Polymorphisms in SRD5A2 Gene May Confer Prostate Cancer Risk in South Indian Men
J Androl, November 1, 2009; 30(6): 703 - 710.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Beuten, J. A.L. Gelfond, J. L. Franke, K. S. Weldon, A. C. Crandall, T. L. Johnson-Pais, I. M. Thompson, and R. J. Leach
Single and Multigenic Analysis of the Association between Variants in 12 Steroid Hormone Metabolism Genes and Risk of Prostate Cancer
Cancer Epidemiol. Biomarkers Prev., June 1, 2009; 18(6): 1869 - 1880.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
I. Boger-Megiddo, N. S. Weiss, M. J. Barnett, G. E. Goodman, and C. Chen
V89L Polymorphism of the 5{alpha}-Reductase Type II Gene (SRD5A2), Endogenous Sex Hormones, and Prostate Cancer Risk
Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 286 - 291.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Beesley, S. J. Jordan, A. B. Spurdle, H. Song, S. J. Ramus, S. K. Kjaer, E. Hogdall, R. A. DiCioccio, V. McGuire, A. S. Whittemore, et al.
Association Between Single-Nucleotide Polymorphisms in Hormone Metabolism and DNA Repair Genes and Epithelial Ovarian Cancer: Results from Two Australian Studies and an Additional Validation Set
Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2557 - 2565.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
E.-K. Bentz, C. Schneeberger, L. A. Hefler, M. van Trotsenburg, U. Kaufmann, J. C. Huber, and C. B. Tempfer
A Common Polymorphism of the SRD5A2 Gene and Transsexualism
Reproductive Sciences, October 1, 2007; 14(7): 705 - 709.
[Abstract] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Park, L. Chen, L. Ratnashinge, T. A. Sellers, J.-P. Tanner, J.-H. Lee, N. Dossett, N. Lang, F. F. Kadlubar, C. B. Ambrosone, et al.
Deletion Polymorphism of UDP-Glucuronosyltransferase 2B17 and Risk of Prostate Cancer in African American and Caucasian Men.
Cancer Epidemiol. Biomarkers Prev., August 1, 2006; 15(8): 1473 - 1478.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
N. Tsuchiya, L. Wang, H. Suzuki, T. Segawa, H. Fukuda, S. Narita, M. Shimbo, T. Kamoto, K. Mitsumori, T. Ichikawa, et al.
Impact of IGF-I and CYP19 Gene Polymorphisms on the Survival of Patients With Metastatic Prostate Cancer
J. Clin. Oncol., May 1, 2006; 24(13): 1982 - 1989.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Mononen, E. H. Seppala, P. Duggal, V. Autio, T. Ikonen, P. Ellonen, J. Saharinen, J. Saarela, M. Vihinen, T. L.J. Tammela, et al.
Profiling Genetic Variation along the Androgen Biosynthesis and Metabolism Pathways Implicates Several Single Nucleotide Polymorphisms and Their Combinations as Prostate Cancer Risk Factors
Cancer Res., January 15, 2006; 66(2): 743 - 747.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M K Akhtar, S L Kelly, and M A Kaderbhai
Cytochrome b5 modulation of 17{alpha} hydroxylase and 17-20 lyase (CYP17) activities in steroidogenesis
J. Endocrinol., November 1, 2005; 187(2): 267 - 274.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. A. Douglas, K. A. Zuhlke, J. Beebe-Dimmer, A. M. Levin, S. B. Gruber, D. P. Wood, and K. A. Cooney
Identifying Susceptibility Genes for Prostate Cancer--A Family-Based Association Study of Polymorphisms in CYP17, CYP19, CYP11A1, and LH-{beta}
Cancer Epidemiol. Biomarkers Prev., August 1, 2005; 14(8): 2035 - 2039.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. Stone, L. D. Ratnasinghe, G. L. Emerson, R. Modali, T. Lehman, G. Runnells, A. Carroll, W. Carter, S. Barnhart, A. A. Rasheed, et al.
CYP3A43 Pro340Ala Polymorphism and Prostate Cancer Risk in African Americans and Caucasians
Cancer Epidemiol. Biomarkers Prev., May 1, 2005; 14(5): 1257 - 1261.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
L. Sharp, A. H. Cardy, S. C. Cotton, and J. Little
CYP17 Gene Polymorphisms: Prevalence and Associations with Hormone Levels and Related Factors. A HuGE Review
Am. J. Epidemiol., October 15, 2004; 160(8): 729 - 740.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
H. Yamada, F. Sata, E. H. Kato, Y. Saijo, S. Kataoka, M. Morikawa, S. Shimada, T. Yamada, R. Kishi, and H. Minakami
A polymorphism in the CYP17 gene and intrauterine fetal growth restriction
Mol. Hum. Reprod., January 1, 2004; 10(1): 49 - 53.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. H. van Gils, N. C. Onland-Moret, M. Roest, P. A. H. van Noord, and P. H. M. Peeters
The V89L Polymorphism in the 5-{alpha}-Reductase Type 2 Gene and Risk of Breast Cancer
Cancer Epidemiol. Biomarkers Prev., November 1, 2003; 12(11): 1194 - 1199.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
F. Sata, H. Yamada, A. Yamada, E. H. Kato, S. Kataoka, Y. Saijo, T. Kondo, J. Tamaki, H. Minakami, and R. Kishi
A polymorphism in the CYP17 gene relates to the risk of recurrent pregnancy loss
Mol. Hum. Reprod., November 1, 2003; 9(11): 725 - 728.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
W. G. Nelson, A. M. De Marzo, and W. B. Isaacs
Prostate Cancer
N. Engl. J. Med., July 24, 2003; 349(4): 366 - 381.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Ntais, A. Polycarpou, and J. P. A. Ioannidis
SRD5A2 Gene Polymorphisms and the Risk of Prostate Cancer: A Meta-Analysis
Cancer Epidemiol. Biomarkers Prev., July 1, 2003; 12(7): 618 - 624.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Sasaki, T. Ogata, T. Ishii, K. Kosaki, S. Sato, K. Homma, T. Takahashi, T. Hasegawa, and N. Matsuo
Micropenis and the 5{alpha}-Reductase-2 (SRD5A2) Gene: Mutation and V89L Polymorphism Analysis in 81 Japanese Patients
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3431 - 3436.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
R Lehtonen, M Kiuru, A Rokman, T Ikonen, J M Cunningham, D J Schaid, M Matikainen, N N Nupponen, A Karhu, O-P Kallioniemi, et al.
No fumarate hydratase (FH) mutations in hereditary prostate cancer
J. Med. Genet., March 1, 2003; 40(3): e19 - 19.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Ntais, A. Polycarpou, and J. P. A. Ioannidis
Association of the CYP17 Gene Polymorphism with the Risk of Prostate Cancer: A Meta-Analysis
Cancer Epidemiol. Biomarkers Prev., February 1, 2003; 12(2): 120 - 126.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
T. R. Rebbeck
Inherited Genotype and Prostate Cancer Outcomes
Cancer Epidemiol. Biomarkers Prev., October 1, 2002; 11(10): 945 - 952.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Simard, M. Dumont, P. Soucy, and F. Labrie
Perspective: Prostate Cancer Susceptibility Genes
Endocrinology, June 1, 2002; 143(6): 2029 - 2040.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. L. Pearce, N. M. Makridakis, R. K. Ross, M. C. Pike, L. N. Kolonel, B. E. Henderson, and J. K. V. Reichardt
Steroid 5-{alpha} Reductase Type II V89L Substitution Is Not Associated with Risk of Prostate Cancer in a Multiethnic Population Study
Cancer Epidemiol. Biomarkers Prev., April 1, 2002; 11(4): 417 - 418.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. L. Stanford, E. A. Noonan, L. Iwasaki, S. Kolb, R. B. Chadwick, Z. Feng, and E. A. Ostrander
A Polymorphism in the CYP17 Gene and Risk of Prostate Cancer
Cancer Epidemiol. Biomarkers Prev., March 1, 2002; 11(3): 243 - 247.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M.-W. Yu, Y.-C. Yang, S.-Y. Yang, S.-W. Cheng, Y.-F. Liaw, S.-M. Lin, and C.-J. Chen
Hormonal Markers and Hepatitis B Virus-Related Hepatocellular Carcinoma Risk: a Nested Case-Control Study Among Men
J Natl Cancer Inst, November 7, 2001; 93(21): 1644 - 1651.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
V. Nwosu, J. Carpten, J. M. Trent, and R. Sheridan
Heterogeneity of genetic alterations in prostate cancer: evidence of the complex nature of the disease
Hum. Mol. Genet., October 1, 2001; 10(20): 2313 - 2318.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. W. Hsing, C. Chen, A. P. Chokkalingam, Y.-T. Gao, D. A. Dightman, H. T. Nguyen, J. Deng, J. Cheng, I. A. Sesterhenn, F. K. Mostofi, et al.
Polymorphic Markers in the SRD5A2 Gene and Prostate Cancer Risk: A Population-based Case-control Study
Cancer Epidemiol. Biomarkers Prev., October 1, 2001; 10(10): 1077 - 1082.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
R. A. Kittles, R. K. Panguluri, W. Chen, A. Massac, C. Ahaghotu, A. Jackson, F. Ukoli, L. Adams-Campbell, W. Isaacs, and G. M. Dunston
CYP17 Promoter Variant Associated with Prostate Cancer Aggressiveness in African Americans
Cancer Epidemiol. Biomarkers Prev., September 1, 2001; 10(9): 943 - 947.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. E. Taplin and S.-M. Ho
The Endocrinology of Prostate Cancer
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3467 - 3477.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. A. Haiman, M. J. Stampfer, E. Giovannucci, J. Ma, N. E. Decalo, P. W. Kantoff, and D. J. Hunter
The Relationship between a Polymorphism in CYP17 with Plasma Hormone Levels and Prostate Cancer
Cancer Epidemiol. Biomarkers Prev., July 1, 2001; 10(7): 743 - 748.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
N. E. Allen, M. S. Forrest, and T. J. Key
The Association between Polymorphisms in the CYP17 and 5{{alpha}}-Reductase (SRD5A2) Genes and Serum Androgen Concentrations in Men
Cancer Epidemiol. Biomarkers Prev., March 1, 2001; 10(3): 185 - 189.
[Abstract] [Full Text]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
R. E. Myers, T. Hyslop, K. Jennings-Dozier, T. A. Wolf, D. Y. Burgh, J. A. Diehl, C. Lerman, and G. W. Chodak
Intention to Be Tested for Prostate Cancer Risk among African-American Men
Cancer Epidemiol. Biomarkers Prev., December 1, 2000; 9(12): 1323 - 1328.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
T. Habuchi, Z. Liqing, T. Suzuki, R. Sasaki, N. Tsuchiya, H. Tachiki, N. Shimoda, S. Satoh, K. Sato, Y. Kakehi, et al.
Increased Risk of Prostate Cancer and Benign Prostatic Hyperplasia Associated with a CYP17 Gene Polymorphism with a Gene Dosage Effect
Cancer Res., October 1, 2000; 60(20): 5710 - 5713.
[Abstract] [Full Text]


Home page
J Natl Cancer Inst MonogrHome page
M. C. Bosland
Chapter 2: The Role of Steroid Hormones in Prostate Carcinogenesis
J Natl Cancer Inst Monographs, July 1, 2000; 2000(27): 39 - 66.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (119)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lunn, R. M.
Right arrow Articles by Taylor, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lunn, R. M.
Right arrow Articles by Taylor, J. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?