Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Owens, D. M.
Right arrow Articles by Smart, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Owens, D. M.
Right arrow Articles by Smart, R. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 20, No. 9, 1837-1844, September 1999
© 1999 Oxford University Press


Carcinogenesis

A multihit, multistage model of chemical carcinogenesis

David M. Owens2, S.-J. Caroline Wei1 and Robert C. Smart3

Molecular and Cellular Toxicology, Department of Toxicology, North Carolina State University, Raleigh, NC 27695-7633 and
1 Laboratory for Cancer Research, Rutgers University, Piscataway, NJ 08855, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Carcinogenesis involves the accumulation of genetic changes within a single cell. Tumor promotion functions in the initial clonal expansion of an initiated cell but is generally not considered to influence later stages. To investigate whether tumor promotion can influence later stages of carcinogenesis we developed a two-hit 7,12-dimethylbenz[a]anthracene (D) protocol designed to enrich for keratinocytes that contain at least two D-induced genetic alterations. FVB/N mice were initiated with D and promoted with 12-O-tetradecanoylphorbol-13-acetate (T) or treated with acetone (A) vehicle for 6 weeks. At 7 weeks after the start of promotion, but before visible papilloma development, groups of mice were treated with a second dose of D or A and 1 week later T promotion was resumed. D/T/A/T mice developed 2.8 papillomas/mouse and D/A/D/T mice demonstrated an additive tumor response and developed 5.8 papillomas/mouse. Importantly, D/T/D/T mice developed 12.4 papillomas/mouse, thereby demonstrating a synergistic tumor response compared with D/A/D/T and D/T/A/T mice. D/T/D/T papillomas exhibited increases in suprabasal S phase cells and keratin 13 expression when compared with D/T/A/T papillomas. D/T/D/T mice developed squamous cell carcinomas (SCCs) 10 weeks earlier than D/T/A/T mice and demonstrated a 96% malignancy incidence and 1.71 SCC/mouse compared with D/T/A/T mice, which demonstrated a 28% malignancy incidence and 0.32 SCC/mouse. Greater than 90% of D/T/A/T and D/T/D/T papillomas and SCCs contained mutant Ha-ras, while a normal Ha-ras allele persisted in all cases, indicating that a gene other than the remaining normal allele of Ha-ras was a target gene for the second D hit. These data demonstrate that: (i) promotion between the first and second hits has a profound outcome on carcinogenesis, presumably by increasing the probability that a second hit will occur in a previously initiated cell; (ii) continued promotion after the second hit is required for full expression of malignancy; (iii) the classic initiation–promotion protocol can be extended to a multihit, multistage model.

Abbreviations: A, acetone; BrdU, 5-bromo-2'-deoxyuridine; D, 7,12-dimethylbenz[a]anthracene; MNNG, N-methyl-N'-nitro-N-nitroguanidine; SCC, squamous cell carcinoma; SSCP, single-strand conformation polymorphism; SURF, selective UV radiation fractionation; T, 12-O-tetradecanoylphorbol-13-acetate.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
As suggested by Knudson (1) and Nowell (2) and now proven on a molecular basis, carcinogenesis involves the accumulation of multiple genetic lesions or hits in a single cell. Epidemiological studies on age-dependent cancer incidence have indicated that four to six genetic events or hits are necessary for tumor development (3). Chromosomal and molecular analyses of human colorectal tumors have shown that on average four to five genetic alterations are required for colon carcinogenesis (4). Numerous studies have indicated that a mutator phenotype or genetic instability is necessary for a single cell to accumulate these multiple discrete alterations (5). Lifestyle factors such as diet, smoking, age of menarche and age of childbirth all greatly influence the carcinogenesis process in humans and many of these factors are thought to function at the promotion level. Therefore, while effecting the clonal expansion of initiated cells, tumor promotion may also be influencing later stages of carcinogenesis.

Numerous models exist to study carcinogenesis and one of the better characterized models is the mouse skin tumor promotion model. In this model, a single sub-threshold dose of a carcinogen such as 7,12-dimethylbenz[a]anthracene (D) is administered followed by the repetitive application of a tumor promoter such as 12-O-tetradecanoylphorbol-13-acetate (T). Benign squamous papillomas generally develop within 10 weeks and virtually all of these papillomas contain Ha-ras mutations (6). A small percentage of these papillomas eventually progress to malignant squamous cell carcinomas (SCC). The progression of papillomas to SCC has been characterized phenotypically by inappropriate expression of certain membrane receptor/adhesion molecules (7,8), keratins (912), growth factors (1315) and cyclins/cyclin-dependent kinases (16,17) and genotypically with respect to alterations in p53 and further alterations in Ha-ras (1822).

Different approaches have been taken to expand this initiation/promotion model to a multihit model of carcinogenesis in an effort to better understand the factors which influence malignant conversion. For example, fractionating a single dose of 51.2 µg D into 50 treatments of 1 µg D on mouse skin increases the papilloma yield ~5-fold and, more importantly, increases the number of SCCs 40-fold (23) and D-initiated papillomas repeatedly treated with additional mutagenic agents such as N-methyl-N'-nitro-N-nitroguanidine (MNNG) and urethane have a higher incidence of malignant conversion over papillomas treated with T only (24). Collectively these experiments indicate that the later stages of carcinogenesis are influenced by further genetic alterations and that repetitive exposure to mutagenic agents such as D and MNNG affects the accumulation of further genetic alterations. While tumor promoters are thought to have little influence on the later stages of carcinogenesis, it has been suggested that promotion between genetic hits could also influence the rate and frequency of malignant conversion by increasing the target population of the genetically altered cells for the next genetic hit (25,26). In addition, cells with additional genetic damage may be further selected for by the promoter. With regard to hepatocarcinogenesis, Pitot and Dragen utilized an initiation–promotion–progression–promotion model and demonstrated how, after 70% partial heptectomy, the administration of ethylnitrosourea to diethylnitrosoamine-initiated/phenobarbital-promoted liver profoundly increases the incidence of hepatocellular carcinoma (27). Indeed, a multihit/promotion process may occur in human populations and, therefore, experimental models to investigate how promotion between genetic hits influences carcinogenesis would be very useful.

In order to determine if clonal expansion between genetic hits could influence the rate and/or frequency of malignant conversion, we employed a D two-hit treatment protocol where D-initiated mice received either T or acetone (A) vehicle promotion for 6 weeks before the second hit of D was applied. By clonally expanding D-initiated cells for 6 weeks of T promotion we have greatly increased the probability of a second hit of D occurring in a cell with pre-existing D-induced alterations. Using this two-hit approach we have demonstrated that tumor promotion between two genetic hits produces synergistic tumor responses, a decrease in malignancy latency and increases the frequency of malignant conversion.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Materials
7,12-dimethylbenz[a]anthracene was purchased from Acros Organics (Pittsburgh, PA). 12-O-tetradecanoylphorbol-13-acetate was purchased from Alexis Biochemicals (San Diego, CA). Acetone was purchased from Fisher Scientific (Pittsburgh, PA). [{alpha}-32P]dATP was purchased from Dupont NEN Research Products (Boston, MA). Biotinylated goat anti-rabbit IgG was purchased from Boehringer Mannheim (Indianapolis, IN) and biotinylated goat anti-mouse IgG from Dako Corp. (Carpinteria, CA). Antigen Retrieval Solution, the Supersensitive Multilink-HRP kit and Liquid DAB Substrate pack were purchased from Biogenex Corp. (San Ramon, CA). 5-Bromo-2'-deoxyuridine (BrdU) was purchased from Sigma Chemical Co. (St Louis, MO).

Animals
Female FVB/N mice, 4 weeks of age, were obtained from Taconic Farms (Germantown, NY). Mice were housed in our facility for at least 2 weeks prior to use. Mice were fed rodent chow (Purina 5001 Rodent Chow; Purina Mills, Richmond, IN) and water ad libitum. The mice were housed 12–15 per cage on corn cob bedding and were placed on a 12 h light/dark cycle.

Tumor studies
Female FVB/N mice, 6 weeks old, were shaved on the dorsal surface with electric clippers. After 2 weeks, those mice that did not display signs of hair regrowth received one topical application of 200 nmol D in 200 µl A or 200 µl A alone. One week later, mice were treated topically twice a week for a period of just 6 weeks with 5 nmol T in 200 µl A or 200 µl A alone. T or A treatment was then stopped for 1 week, after which mice were treated topically with 200 nmol D in 200 µl A or A alone. One week later, treatment with 5 nmol T or A was resumed for either 17, 25 or 32 more weeks (for schematic see Figure 1Go). Papillomas and skin malignancies were scored once weekly. The D/T/A/T, D/T/D/T and D/A/D/T groups contained 25 mice each and the remaining treatment groups contained 15 mice each. Papilloma and squamous cell carcinoma responses were compared between the D/T/D/T group and all other groups utilizing a two-tailed Student's t-test.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. 7,12-Dimethylbenz[a]anthracene two-hit experimental design in FVB/N mice.

 
Tumor harvesting
FVB/N mice received a 100 mg/kg BrdU i.p. injection 1 h prior to killing. Skin tumors were harvested and portions from each tumor were fixed in acetone at 4°C for 24 h, processed through graded alcohols and xylenes and paraffin embedded for histopathological evaluation and immunohistochemistry. The remaining tumor portions were flash frozen in liquid nitrogen for molecular analysis. Acetone-fixed tumor sections were stained with hematoxylin and eosin and histopathologically evaluated to be either a papilloma, SCC or fibrosarcoma (28).

Immunohistochemistry
Acetone-fixed FVB/N mouse skin tumor sections were deparaffinized in xylene and rehydrated through graded alcohols and Automation Buffer (Biomedia Corp., Foster City, CA).

Cornifin-{alpha}, keratin K8 and keratin K13
Endogenous peroxidases were quenched by a 3% H2O2 incubation for 10 min. Following a 30 min block in 10% normal goat serum, tissue sections were incubated with either rabbit polyclonal SQ37A cornifin-{alpha}/SPRR1 (29) (1:10 000; courtesy of Anton M.Jetten), rabbit polyclonal keratin K13 (10) (1:500; courtesy of Claudio J.Conti) or rat monoclonal keratin K8 (TROMA 1; courtesy of Helene Baribault) antisera overnight at 4°C in a humidified chamber.

Bromodeoxyuridine
Prior to 3% endogenous peroxidase block, tissue sections were placed in Antigen Retrieval Solution (Biogenex) and microwaved on high for 5 min. Following a 30 min block in 10% normal goat serum tissue sections were incubated with mouse BrdU antisera (1:25; Becton-Dickinson, San Jose, CA) for 1 h at room temperature in a humidified chamber.

For all antibodies, detection was carried out using biotin-linked streptavidin–peroxidase (Biogenex) with diaminobenzidine as the chromagen (DAB Substrate Kit; Biogenex). Light counterstaining was performed with Harris-modified hematoxylin. Positive controls included FVB/N mouse vaginal epithelium for keratin K13 (9), FVB/N mouse small intestine for keratin K8 (30) and D-initiated/T-promoted CD-1 squamous cell carcinoma for cornifin-{alpha}/SPRR1 (29), and A-treated mouse epidermis served as a negative control for all antibodies. Papilloma sections were also stained with biotinylated secondary IgG antibodies followed by biotin-linked streptavidin–peroxidase detection without using primary antibodies to control for non-specific binding.

Ha-ras selective UV radiation fractionation (SURF)–PCR–single-strand conformation polymorphism (SSCP) analysis
Acetone-fixed D/T/A/T and D/T/D/T tumor samples were processed for histopathological analysis with hematoxylin and eosin staining. SURF followed by PCR was used to specifically analyze keratinocyte populations in each tumor on stained microscope sections (31). Using a marker pen, black dots were placed directly on the cells of interest and slides were placed on a UV transilluminator model TN-36 (UVP, San Gabriel, CA) tissue side down and irradiated for 3 h at 8000 µW/cm2. Each genomic DNA sample was derived from ~100–200 cells. DNA samples isolated from normal epidermis and tumor tissues were amplified with primers specific for Ha-ras exon 1 (H1A, GCAGCCGCTGTAGAAGCTATGA; H1B, GTAGGCAGAGCTCACCTCTATA) and exon 2 (H2A, GTTGTTTTGCAGGACTCCTA; H2B, GCCATAGGTGGCTCACCTGTA). SSCP analysis was then performed for both exon 1 and exon 2 amplification products for each sample on a 9 or 7% non-denaturing polyacrylamide gel, respectively. In each PCR reaction for SSCP analysis, one primer was 32P-end-labeled. Each mutation was confirmed at least twice by independent PCR reactions with the original DNA extract from each tissue section examined. An A->T transversion in the middle base of Ha-ras codon 61 (CAA->CTA) creates a new XbaI restriction site. XbaI digestion of the 207 bp PCR products of Ha-ras exon 2 from DNA containing an A182->T transversion produces a 122 bp fragment from the 3'-end. PCR products derived from 32P-labeled H2B primer were subjected to complete digestion with 5 U of XbaI at 37°C overnight, the products were analyzed on 6% denaturing and 7% non-denaturing polyacrylamide gels. The disappearance of the aberrant bands from the SSCP gel after XbaI digestion demonstrated complete digestion of the PCR products from the mutant allele. The presence of the 122 or the 207 bp bands on an autoradiogram after complete XbaI digestion indicates the existence of the mutant or the wild-type allele, respectively.

p53 PCR–SSCP analysis
Total RNA was isolated from D/T/A/T and D/T/D/T papillomas using the single-step method of RNA isolation by acid guanidinium thiocyanate/phenol/chloroform extraction as described previously (32). First strand cDNA synthesis was carried out using 1 µg total RNA and 0.5 µg oligo(dT)12–18 primer (Gibco BRL, Gaithersburg, MD). The reaction volume was 20 µl and contained 50 mM Tris–HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 500 µM each dATP, dCTP, dGTP and dTTP and 200 U of M-MLV reverse transcriptase (Gibco BRL). Samples were incubated at 37°C for 1 h and 2 µl of each reaction was directly used for PCR. cDNA samples were subjected to PCR amplification of four 300–400 bp overlapping fragments which constitute the entire coding region of the p53 gene. The PCR reaction volume was 20 µl and contained 200 µM each dATP, dCTP, dGTP and dTTP, 1 µM primers (listed in Table IGo), 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 and 2.5 U of Taq DNA polymerase. Samples underwent 30 amplification cycles (denaturation at 95°C for 30 s, annealing at 58°C for 30 s and extension at 72°C for 1 min). Aliquots of 2 µl of each PCR reaction were heated with 4 µl of sample buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue) at 95°C for 5 min and 1 µl of each sample mixture was loaded onto a 5% non-denaturing acrylamide gel. Electrophoresis was conducted at 20 W for 8 h with cooling by a fan. Gels were transferred to filter paper, dried at 80°C for 30 min and exposed to film for 24–48 h at room temperature. A 193 bp PCR fragment from Ha-ras exon 2 containing a codon 61 A->T mutation served as a positive control.


View this table:
[in this window]
[in a new window]
 
Table I. p53 PCR primers
 

    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
D/T/D/T mice exhibit greater than additive papilloma responses
FVB/N mice were initiated with a single dose of 200 nmol D or treated with A vehicle alone. One week later groups of mice were treated with either 5 nmol T or A for a period of 6 weeks. One week later and before any papillomas developed, groups of mice received an additional single dose of D or A. One week later, promotion with T or A was resumed (Figure 1Go). The D/T/A/T, D/T/D/T and D/A/D/T groups all received a total of 25 weeks of T promotion although the start time of T promotion was different for D/A/D/T mice (Figure 1Go). A/T/D/T mice were treated with T for a total of 32 weeks and D/T/A/A and D/T/D/A groups only received a total of 6 weeks of T promotion (Figure 1Go). As shown in Figure 2Go, D/T/A/T mice developed an average of 2.8 papillomas/mouse, while D/A/D/T mice developed an average of 5.8 papillomas/mouse. A/T/D/T mice developed an average of 2.7 papillomas/mouse (Figure 2Go) and when added to the D/T/A/T papilloma yield of 2.8 papillomas/mouse, the sum approximates the papilloma yield in the D/A/D/T group. Together these results indicate that when two doses of D are applied 7 weeks apart without any T promotion intervening between the D doses, the papilloma yield is additive and approximates the sum of the papilloma yield of the two groups of mice receiving a single D dose. However, when T promotion is conducted between the two D doses a synergistic papilloma response is observed. As shown in Figure 2Go, D/T/D/T mice demonstrated an average of 12.4 papillomas/mouse, which is an approximate 4- and 2-fold increase over the papilloma yields observed in the D/T/A/T and D/A/D/T groups, respectively. These results indicate that T promotion between the first and second hits of D is necessary to produce the increased papilloma responses observed in the D/T/D/T mice. It appears that the initial T promotion allows for clonal expansion of D-initiated keratinocytes, thereby increasing the likelihood that the second D mutagenic event(s) will occur in a previously initiated keratinocyte. This clonal expansion followed by D treatment may ensure the survival of previously initiated keratinocytes which then contribute to the observed increases in papilloma yields in the D/T/D/T mice. A comparison of the papilloma yields of the D/T/A/A (1.26 papillomas/mouse) and the D/T/D/A (2.6 papilloma/mouse) groups provides additional support for this notion (derived from Table IIGo). Similar differences in papilloma responses between D/T/D/T, D/T/A/T and D/A/D/T mice were observed in a repeat experiment (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Synergistic effect of D treatment in D-initiated/T-promoted preneoplastic FVB/N mouse skin. Female FVB/N mice were treated with a single dose of 200 nmol D in 200 µl A. One week later, mice were treated with 5 nmol T in 200 µl A or 200 µl A alone twice a week for 6 weeks. One week after T treatment was stopped, mice received a second dose of 200 nmol D in 200 µl A or 200 µl A alone. One week later, treatment with 5 nmol T or A alone twice a week was resumed for 17 more weeks (25 weeks total).

 

View this table:
[in this window]
[in a new window]
 
Table II. Papilloma and carcinoma responses in D one-hit and D two-hit FVB/N mouse skin
 
D/T/D/T papillomas demonstrate an increase in suprabasal S phase cells and alterations in keratin 13 expression
The above results suggest that some D/T/D/T papillomas may result from keratinocytes that have sustained two D hits and thus may represent a distinct population of papillomas that are not observed in D/T/A/T mice. Therefore, we wanted to determine whether some D/T/D/T papillomas were phenotypically distinct from D/T/A/T papillomas. Subset populations of D-initiated papillomas with an increased rate of pre-malignant progression and increased risk of malignant conversion have been phenotypically characterized by changes in the size of the proliferative compartment of the papilloma (7) and aberrant keratin 13 expression (9,10). In addition, aberrant keratin K8 expression in mouse skin tumors has been shown to be a marker of malignant conversion (11). Recently we reported alterations in the expression of cornifin-{alpha}/SPRR1, a cornified envelope precursor protein, in D-initiated mouse skin papillomas and SCC (29). To determine if D/T/D/T papillomas were phenotypically distinct from D/T/A/T papillomas, a repeat tumor experiment was conducted and D/T/D/T and D/T/A/T mouse skin papillomas were harvested at 21 weeks after the start of T promotion. Immunohistochemical characterization of BrdU incorporation and cornifin-{alpha}/SPRR1, keratin K8 and keratin K13 expression in D/T/D/T and D/T/A/T papillomas was then performed. Suprabasal BrdU incorporation in papillomas is an indication of an increase in the proliferative compartment and has been associated with papillomas at high risk of malignant conversion (7). D/T/D/T and D/T/A/T papillomas were scored as to the percentage area of each tumor which exhibited either basal only, <25% suprabasal, 25–50% suprabasal or >50% suprabasal BrdU incorporation. Figure 3A and BGo illustrates BrdU nuclear staining in a D/T/A/T papilloma graded as <25% suprabasal incorporation and Figure 3C and DGo demonstrates BrdU nuclear staining in a D/T/D/T papilloma graded as >50% suprabasal incorporation. As shown in Table IIIGo, 26% of D/T/D/T papillomas exhibited a level of suprabasal BrdU incorporation that was not observed in any of the D/T/A/T papillomas. No substantial differences in cornifin-{alpha}/SPRR1 levels could be detected between D/T/A/T and D/T/D/T papillomas (data not shown). As shown in Table IIIGo, no differences in K8 expression were observed between D/T/D/T and D/T/A/T papillomas, however, there were differences in K13 expression. Within the D/T/D/T papillomas there was a trend toward more extensive K13 staining and all the D/T/D/T papillomas displayed some degree of K13 expression, however, 20% of D/T/A/T papillomas did not display any detectable K13 expression. Thus, a portion of D/T/D/T papillomas displayed phenotypic differences with respect to suprabasal BrdU incorporation and K13 expression when compared with D/T/A/T papillomas. These results support the notion that some D/T/D/T papillomas resulted from keratinocytes that sustained at least two D hits.






View larger version (520K):
[in this window]
[in a new window]
 
Fig. 3. Immunohistochemical detection of BrdU S phase cells in D one-hit and D two-hit papillomas. D one-hit (D/T/A/T) and D two-hit (D/T/D/T) papilloma sections were probed for BrdU incorporation. The arrow points to an example of BrdU-positive nuclei; all dark nuclei are BrdU-positive. (A and B) A typical D one-hit papilloma at low (A) and high (B) magnification with minimal BrdU suprabasal positive nuclei. (C and D) A dysplastic area frequently observed in D two-hit papillomas at low (C) and high (D) magnification.

 

View this table:
[in this window]
[in a new window]
 
Table III. Phenotypic characterization of D one-hit and D two-hit FVB/N papillomas
 
D/T/D/T papillomas exhibit an increased rate of malignant conversion
In order to determine if in this two-hit model D also had the capacity to influence malignant conversion, all groups of mice were maintained under observation for 52 weeks (Figure 4Go and Table IIGo). As shown in Figure 4Go, D/T/A/T mice developed their first malignancy at 26 weeks after the start of promotion and 16% incidence of mice developed malignancies by 35 weeks after the start of promotion. However, D/T/D/T mice developed their first malignancy at 16 weeks after the start of promotion and 84% of D/T/D/T mice developed malignancies by 32 weeks after the start of promotion (Figure 4Go). D/T/D/T mice exhibited a 7-fold increase in the average number of malignancies per mouse over D/T/A/T mice (Figure 4Go). D/T/D/T mice also displayed an ~2-fold increase in the average number of malignancies and a decreased latency when compared with D/A/D/T-treated mice. All malignancies were subjected to histopathological analysis and were evaluated to be SCCs (28). As shown in Table IIGo, all groups with the exception of D/T/D/A and D/A/D/A exhibited a similar carcinoma/papilloma ratio. However, it should be noted that the propensity of D/T/D/T papillomas to undergo malignant conversion is underestimated because mice were killed 2–3 weeks after the onset of malignant tumor formation in order to harvest the tumors and conduct histological analysis. Regardless, it is evident that profound differences in malignancy latency and incidence exist between D/T/D/T and D/T/A/T mice (Figure 4Go).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Incidence of malignancies in D one-hit and D two-hit FVB/N mouse skin. Female FVB/N mice were treated with a single dose of 200 nmol D in 200 µl A. One week later, mice were treated with 5 nmol T in 200 µl A or 200 µl A alone twice a week for 6 weeks. One week after T treatment was stopped, mice received a second dose of 200 nmol D in 200 µl A or 200 µl A alone. One week later, treatment with 5 nmol T twice a week was resumed for 17 more weeks (25 weeks total). Groups were maintained under observance for skin malignancies for 52 weeks.

 
The molecular target of the second D hit is not the remaining normal Ha-ras allele
Mutations in Ha-ras have been shown to be an early and frequent D-induced event in mouse skin carcinogenesis (6,33) and further genetic alterations favoring an increase in mutant Ha-ras gene dosage are also observed in the progression of D-initiated papillomas (1820), making mutant Ha-ras a highly influential event at various stages in mouse skin carcinogenesis. One possibility in our model is that if the second hit of D occurs in a cell which already contains one mutant Ha-ras allele, then it could induce a mutation in the remaining normal Ha-ras allele, thereby rendering that cell with two mutant Ha-ras alleles. This increase in mutant Ha-ras gene dosage could be responsible for the observed increases in papilloma multiplicity and malignant conversion. To determine if the normal Ha-ras allele was the target for the second D hit, SURF of D/T/D/T and D/A/D/T papilloma keratinocytes was employed to exclusively collect keratinocyte genomic DNA over DNA from infiltrative cells, stroma-derived cells or other contaminating cell sources (31). Exons 1 and 2 of the Ha-ras gene were amplified and PCR products were subjected to SSCP analysis. All mutations found by SSCP were confirmed by a separate PCR reaction followed by XbaI restriction analysis, which selectively cuts PCR products containing a mutant Ha-ras (CTA) over a normal codon 61 (CAA). Amplified Ha-ras exon 2 products that were cut (mutant) or uncut (normal) were visualized on an autoradiogram after complete digestion with XbaI. As shown in Table IVGo, all D/T/D/T papillomas were found to contain at least one normal Ha-ras allele with respect to codon 61. No mutations in exon 1 of Ha-ras were found in either D/T/D/T or D/T/A/T papillomas (Table IVGo). In addition, all D/T/D/T SCCs were also found to contain at least one normal Ha-ras allele (Table IVGo).


View this table:
[in this window]
[in a new window]
 
Table IV. Incidence of Ha-ras mutations in D one-hit papillomas, D two-hit papillomas and SCC
 
Although the p53 tumor suppressor gene has been shown not to be a molecular target for D (34), we conducted SSCP analysis of p53 in six D/T/D/T papillomas in order to exclude the unique possibility of p53 alterations being involved in our multihit/promotion model. Four overlapping PCR fragments were generated which together comprised the entire coding region of p53. No band shifts were observed in any of the six papillomas analyzed when compared with PCR fragments from A-treated epidermis (data not shown). SSCP results were confirmed by direct sequencing of two of six D/T/D/T papillomas. No mutations in p53 were found in either of the papillomas analyzed by direct sequencing (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The results obtained in D/T/D/T mice are consistent with the notion that the initial T treatment clonally expands D-initiated keratinocytes which increases the probability of a second D hit occurring in a cell with pre-existing D-induced alterations. Perhaps the clearest evidence for the existence of a distinct population of D two-hit keratinocytes in our model lies in the 10 week decrease in malignancy latency observed in the D/T/D/T group over both D/T/A/T and D/A/D/T groups. This decrease in malignancy latency indicates that cells sustaining two D hits have acquired an accelerated rate of malignant conversion that is not observed in D one-hit cells.

While initiation in mouse skin is considered to be an infrequent event, recent studies in mouse epidermis have indicated that upwards of 0.1% of Ha-ras genes sustain a codon 61 mutation 24 h following topical carcinogen application (35), which results in the generation of ~6000 initiated basal keratinocytes (36). At 9 days post-carcinogen application the levels of Ha-ras genes containing codon 61 mutations are undetectable (35). In our model it is unlikely that additional hits from a second application of carcinogen would occur in the small population of pre-initiated cells in the absence of clonal expansion. However, the population of mutant Ha-ras-containing cells is increased by a factor of >104 during tumor promoter-driven clonal expansion of pre-neoplastic mouse skin (35), which would greatly increase the target population of initiated cells to sustain a second hit of carcinogen. Therefore, in our model it is probable that two D hits occur in a single cell at some frequency in D/T/D/T mice. Perhaps the observed increases in papilloma yields in the D/T/D/T mice are due to increased survival of initiated keratinocytes resulting from a second D hit. We have previously demonstrated that D has the capacity to increase papilloma frequency and induce further genetic alterations in genetically initiated v-Ha-ras transgenic mouse skin (37).

The carcinoma to papilloma ratio represents the percentage of total papillomas in a group of mice which undergo malignant conversion and as such can be used to delineate between benign tumorigenic responses versus carcinogenic responses. Experiments in FVB/N mice have shown that reducing the initiating dose of D reduces the total papilloma yield but does not change the total carcinoma yield, thereby increasing the carcinoma to papilloma ratio (38). In our study there was a synergistic increase in total carcinoma yield observed in D/T/D/T mice over D/T/A/T and D/A/D/T mice, but there was no difference in the carcinoma to papilloma ratio between D/T/D/T mice and D/T/A/T or D/A/D/T mice, due to the observed increase in papilloma multiplicity in D/T/D/T mice. Our results demonstrate a strong carcinogenic response in D/T/D/T mice despite the increased papilloma yield. In addition, and as mentioned previously, D/T/D/T mice display a 10 week decrease in carcinoma latency, thus the propensity of D/T/D/T papillomas to undergo malignant conversion is significantly underestimated because mice were killed 2–3 weeks after the onset of malignant tumor formation in order to harvest the tumors and conduct histological analysis. In addition, nearly 100% of the D/T/D/T mice developed carcinomas. Further evidence for promotion between genetic hits having a carcinogenic effect can be gathered from the comparison of the carcinoma to papilloma ratio in D/T/D/A mice (0.23) with D/T/A/A mice (0.15). In these two treatment groups the last regimen of T promotion is replaced with A vehicle so the carcinogenic effects in D/T/D/A mice are not as strongly masked by an increased papilloma yield.

Greater than 90% of D-initiated mouse skin papillomas harbor an A182->T mutation in Ha-ras from a wide variety of tumor promoters (6,39,40) and exon 1 Ha-ras mutations are also highly selected for in mouse skin papillomas induced with other chemical initiators (41), collectively indicating that Ha-ras activation is a highly favorable early event in skin tumorigenesis. Furthermore, both the pre-malignant progression and malignant progression stages in mouse skin multistage carcinogenesis are associated with a further imbalance in favor of mutant Ha-ras (1820,42), making mutant Ha-ras a prominent theme throughout carcinogenesis. Hence, it is likely that if a second D hit occurred in a cell that already contained one mutant Ha-ras allele and this second hit induced a mutation in the remaining normal Ha-ras allele then this event would likely be highly selected for by T tumor promotion. However, all D/T/D/T papillomas and SCCs were found to contain at least one normal Ha-ras allele, indicating that if the remaining normal Ha-ras allele was hit then it was a non-propagating event in the presence of other non-Ha-ras D-induced events. Therefore, these changes induced by a second hit of D do not appear to involve an increase in mutant Ha-ras gene dosage. These results support our previous findings in v-Ha-ras transgenic mouse skin (37).

Our data indicate that a second D hit occurring in a cell with a pre-existing D-induced Ha-ras mutation increases the population of initiated keratinocytes sensitive to T promotion and able to undergo malignant conversion and that tumor promotion can affect the later stages of carcinogenesis and that the mouse skin carcinogenesis model can be extended to a multihit/promotion model. These results may have important implications for human cancer risk assessment in demonstrating how tumor promoters not only promote out initiated cells but also increase the target cell population for re-occurring initiation exposures and promote the growth of this multihit population, thereby accelerating the rate of malignant conversion. Our results also indicate that non-Ha-ras D initiation target genes exist that can cooperate with mutant Ha-ras to increase the sensitivity of keratinocytes to promotion and malignant conversion.


    Acknowledgments
 
We kindly thank Dr Claudio J.Conti at the University of Texas–M.D. Anderson Cancer Center who provided the keratin 13 antibody, Dr Anton M. Jetten at the National Institute of Environmental Health Sciences who provided the cornifin-{alpha}/SPRR1 antibody and Dr Helene Baribault at the La Jolla Cancer Research Foundation who provided the keratin 8 antibody. This research was supported by grant CA46637 from the National Cancer Institute and grant ES08127 from the National Institute of Environmental Health Sciences.


    Notes
 
2 Present address: Imperial Cancer Research Fund, Keratinocyte Laboratory, London WC2A 3PX, UK Back

3 To whom correspondence should be addressed Email: rcsmart{at}unity.ncsu.edu Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Knudson,A.G. (1975) Genetics of human cancer. Genetics, 79 (suppl.), 305–316.[Abstract/Free Full Text]
  2. Nowell,P.C. (1976) The clonal evolution of tumor cell populations. Science, 194, 23–28.[Abstract/Free Full Text]
  3. Peto,R., Roe,F.J.C., Lee,P.N., Levy,L. and Clack,J. (1975) Cancer and ageing in mice and men. Br. J. Cancer, 32, 411–426.[Web of Science][Medline]
  4. Fearon,E.R. and Vogelstein,B. (1990) A genetic model for colorectal tumorigenesis. Cell, 16, 759–767.
  5. Loeb,L.A. (1991) Mutator phenotype may be required for multistage carcinogenesis. Cancer Res., 51, 3075–3079.[Free Full Text]
  6. Quintanilla,M., Brown,K., Ramsden,M. and Balmain,A. (1986) Carcinogen-specific mutation and amplification of Ha-ras during mouse skin carcinogenesis. Nature, 322, 78–80.[Medline]
  7. Tennenbaum,T., Weiner,A.K., Belanger,A.J., Glick,A.B., Hennings,H. and Yuspa,S.H. (1993) The suprabasal expression of {alpha}6ß4 integrin is associated with a high risk for malignant progression in mouse skin carcinogenesis. Cancer Res., 53, 4803–4810.[Abstract/Free Full Text]
  8. Sawey,M.J., Goldschmidt,M.H., Risek,B., Gilula,N.B. and Lo,C.W. (1996) Perturbation in connexin43 and connexin26 gap-junction expression in mouse skin hyperplasia and neoplasia. Mol. Carcinog., 17, 49–61.[Web of Science][Medline]
  9. Nischt,R., Roop,D.R., Mehrel,T. Yuspa,S.H., Rentrop,M., Winter,H. and Schweizer,J. (1988) Aberrant expression during two-stage mouse skin carcinogenesis of a type 1 47-kDa keratin, K13, normally associated with terminal differentiation of internal stratified epithelia. Mol. Carcinog., 1, 96–108.[Web of Science][Medline]
  10. Gimenez-Conti,I., Aldaz,C.M., Bianchi,A.B., Roop,D.R., Slaga,T.J. and Conti,C.J. (1990) Early expression of type I K13 keratin in the progression of mouse skin papillomas. Carcinogenesis, 11, 1995–1999.[Abstract/Free Full Text]
  11. Larcher,F., Bauluz,C., Diaz-Guerra,M., Quintanilla,M., Conti,C.J., Ballestin,C. and Jorcano,J.L. (1992) Aberrant expression of the simple epithelial type II keratin 8 by mouse skin carcinomas but not papillomas. Mol. Carcinog., 6, 112–121.[Web of Science][Medline]
  12. Roop,D.R., Mehrel,T., Kreig,T.M., Nakazawa,H., Cheng,C.C. and Yuspa,S.H. (1989) Keratin expression in mouse epidermal tumors. In Conti,C.J., Slaga,T.J. and Klein-Szanto,A.J.P. (eds) Skin Tumors: Experimental and Clinical Aspects. Raven Press, New York, NY, pp. 257–271.
  13. Imamoto,A., Beltran,L.M. and DiGiovanni,J. (1991) Evidence for autocrine/paracrine growth stimulation by transforming growth factor-{alpha} during the process of skin tumor promotion. Mol. Carcinog., 4, 52–60.[Web of Science][Medline]
  14. Fowlis,D.J., Flanders,K.C., Duffie,E., Balmain,A. and Akhurst,R. (1992) Discordant transforming growth factor ß1 RNA and protein localization during chemical carcinogenesis of the skin. Cell Growth Differ., 3, 81–91.[Abstract]
  15. Glick,A.B., Kulkarni,A.B., Tennenbaum,T., Hennings,H., Flanders,K.C., O'Reilly,M., Sporn,M.B., Karlsson,S. and Yuspa,S.H. (1993) Loss of TGF-ß expression in mouse epidermis and epidermal tumors is associated with hyperproliferation and a high risk for malignant conversion. Proc. Natl Acad. Sci. USA, 90, 6076–6080.[Abstract/Free Full Text]
  16. Bianchi,A.B., Fischer,S.M., Robles,A.L., Rinchik,E.M. and Conti,C.J. (1993) Overexpression of cyclin D1 in mouse skin carcinogenesis. Oncogene, 8, 1127–1133.[Web of Science][Medline]
  17. Zhang,S.-Y., Liu,S.-C., Goodrow,T., Morris,R. and Klein-Szanto,A.J.P. (1997) Increased expression of G1 cyclins and cyclin-dependent kinases during tumor progression of chemically induced mouse skin neoplasms. Mol. Carcinog., 18, 142–152.[Web of Science][Medline]
  18. Aldaz,C.M., Trono,D., Larcher,F., Slaga,T.J. and Conti,C.J. (1989) Sequential trisomization of chromosomes 6 and 7 in mouse skin premalignant lesions. Mol. Carcinog., 2, 22–26.[Web of Science][Medline]
  19. Bremner,R. and Balmain,A. (1990) Genetic changes in skin tumor progression: correlation between presence of a mutant ras gene and loss of heterozygosity on mouse chromosome 7. Cell, 61, 407–417.[Web of Science][Medline]
  20. Bianchi,A.B., Aldaz,C.M. and Conti,C.J. (1990) Nonrandom duplication of the chromosome bearing a mutated Ha-ras-1 allele in mouse skin tumors. Proc. Natl Acad. Sci. USA, 87, 6902–6906.[Abstract/Free Full Text]
  21. Burns,P.A., Kemp,C.J., Gannon,J.V., Lane,D.P., Bremner,R. and Balmain,A. (1991) Loss of heterozygosity and mutational alterations of the p53 gene in skin tumors of interspecific hybrid mice. Oncogene, 6, 2363–2369.[Web of Science][Medline]
  22. Ruggeri,B., Caamano,J., Goodrow,T., DiRado,M., Bianchi,A., Trono,D., Conti,C.J. and Klein-Szanto,A.J.P. (1991) Alterations of the p53 tumor suppressor gene during mouse skin tumor progression. Cancer Res., 51, 6615–6621.[Abstract/Free Full Text]
  23. Iversen,O.H. (1991) The skin tumorigenic and carcinogenic effects of different doses, numbers of dose fractions and concentrations of 7,12-dimethylbenz[a]anthracene in acetone applied on hairless mouse epidermis. Possible implications for human carcinogenesis. Carcinogenesis, 12, 493–502.[Abstract/Free Full Text]
  24. Hennings,H., Shores,R., Wenk,M.L., Spangler,E.F., Tarone,R. and Yuspa,S.H. (1983) Malignant conversion of mouse skin tumours is increased by tumour initiators and unaffected by tumour promoters. Nature, 304, 67–69.[Medline]
  25. Potter,V.R. (1981) A new protocol and its rationale for the study of initiation and promotion of carcinogenesis in the rat liver. Carcinogenesis, 2, 1375–1379.[Abstract/Free Full Text]
  26. Moolgavkar,S.H. and Knudson,A.G. (1981) Mutation and cancer: a model for human carcinogenesis. J. Natl Cancer Inst., 66, 1037–1052.
  27. Dragan,Y.P., Sargent,L., Xu,Y.-D., Xu,Y.-H. and Pitot,H.C. (1993) The initiation–promotion–progression model of rat hepatocarcinogenesis. Proc. Soc. Exp. Biol. Med., 202, 16–24.[Medline]
  28. Bogovski,P. (1994) Tumors of the skin. In Turusov,V. and Mohr,U. (eds) Pathology of Tumours in Laboratory Animals. IARC, Lyon, Vol. 2, pp. 1–45.
  29. Owens,D.M., Zainal,T.A., Jetten,A.M. and Smart,R.C. (1996) Localization and expression of cornifin-{alpha}/SPRR1 in mouse epidermis, anagen hair follicles and skin neoplasms. J. Invest. Dermatol., 106, 647–654.[Web of Science][Medline]
  30. Bosch,F.X., Leube,R.E., Achtstatter,T., Moll,R. and Franke,W.W. (1988) Expression of simple epithelial type cytokeratins in stratified epithelia as detected by immunolocalization and hybridization in situ. J. Cell Biol., 106, 1635–1648.[Abstract/Free Full Text]
  31. Shibata,D., Hawes,D., Li,Z.-H., Hernandez,A.M., Spruck,C.H. and Nichols,P.W. (1992) Specific genetic analysis of microscopic tissue after selective ultraviolet radiation fractionation and the polymerase chain reaction. Am. J. Pathol., 141, 539–543.[Abstract]
  32. Choczynski,P. and Sacchi,N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem., 162, 156–159.[Web of Science][Medline]
  33. Balmain,A., Ramsden,M., Bowden,G.T. and Smith,J. (1984) Activation of the mouse cellular Harvey-ras gene in chemically induced benign skin papillomas. Nature, 307, 658–660.[Medline]
  34. Ruggeri,B., DiRado,M., Zhang,S.Y., Bauer,B., Goodrow,T. and Klein-Szanto,A.J. (1993) Benzo[a]pyrene-induced murine skin tumors exhibit frequent and characteristic G to T mutations in the p53 gene. Proc. Natl Acad. Sci. USA, 90, 1013–1017.[Abstract/Free Full Text]
  35. Chakravarti,D., Mailander,P., Franzen,J., Higginbotham,S., Cavalieri,E.L., Rogan,E.G. (1998) Detection of dibenzo[a,l]pyrene-induced H-ras codon 61 mutant genes in preneoplastic SENCAR mouse skin using a new PCR–RFLP method. Oncogene, 16, 3203–3210.[Web of Science][Medline]
  36. Kopp-Schneider,A. and Portier,C.J. (1992) Birth and death/differentiation rates of papillomas in mouse skin. Carcinogenesis, 13, 973–978.[Abstract/Free Full Text]
  37. Owens,D.M., Spalding,J.W. Spalding,R.W. Tennant and Smart,R.C. (1995) Genetic alterations cooperate with v-Ha-ras to accelerate multistage carcinogenesis in TG. AC transgenic mouse skin. Cancer Res., 55, 3171–3178.[Abstract/Free Full Text]
  38. Hennings,H., Glick,A.B., Lowry,D.T., Krsmanovic,L.S., Sly,L.M and Yuspa,S.H. (1993) FVB/N mice: an inbred strain sensitive to the chemical induction of squamous cell carcinomas in the skin. Carcinogenesis, 14, 2353–2358.[Abstract/Free Full Text]
  39. Mills,K.J., Reynolds,S.H. and Smart,R.C. (1993) Diacylglycerol is an effector of the clonal expansion of cells containing activated Ha-ras genes. Carcinogenesis, 14, 2645–2648.[Abstract/Free Full Text]
  40. Moser,G.J., Robinette,C.L. and Smart,R.C. (1993) Characterization of skin tumor promotion by mirex: structure–activity relationships, sexual dimorphism and presence of Ha-ras mutation. Carcinogenesis, 14, 1155–1160.[Abstract/Free Full Text]
  41. Colapietro,A.-M., Goodell,A.L. and Smart,R.C. (1993) Characterization of benzo[a]pyrene-initiated mouse skin papillomas for Ha-ras mutations and protein kinase C levels. Carcinogenesis, 14, 2289–2295.[Abstract/Free Full Text]
  42. Buchmann,A., Ruggeri,B., Klein-Szanto,A.J.P. and Balmain,A. (1991) Progression of squamous carcinoma cells to spindle carcinomas of mouse skin is associated with an imbalance of H-ras alleles on chromosome 7. Cancer Res., 51, 4097–4101.[Abstract/Free Full Text]
Received February 3, 1999; revised May 4, 1999; accepted May 12, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
H. Fung, P. Liu, and B. Demple
ATF4-Dependent Oxidative Induction of the DNA Repair Enzyme Ape1 Counteracts Arsenite Cytotoxicity and Suppresses Arsenite-Mediated Mutagenesis
Mol. Cell. Biol., December 15, 2007; 27(24): 8834 - 8847.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. E. Sadun, S. M. Sachsman, X. Chen, K. W. Christenson, W. Z. Morris, P. Hu, and A. L. Epstein
Immune Signatures of Murine and Human Cancers Reveal Unique Mechanisms of Tumor Escape and New Targets for Cancer Immunotherapy
Clin. Cancer Res., July 1, 2007; 13(13): 4016 - 4025.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. J. Roberts, B. Y. Ng, R. B. Filler, J. Lewis, E. J. Glusac, A. C. Hayday, R. E. Tigelaar, and M. Girardi
Characterizing tumor-promoting T cells in chemically induced cutaneous carcinogenesis
PNAS, April 17, 2007; 104(16): 6770 - 6775.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R.A. Crallan, N.T. Georgopoulos, and J. Southgate
Experimental models of human bladder carcinogenesis
Carcinogenesis, March 1, 2006; 27(3): 374 - 381.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
C. Niemann, D. M. Owens, J. Hulsken, W. Birchmeier, and F. M. Watt
Expression of {Delta}NLef1 in mouse epidermis results in differentiation of hair follicles into squamous epidermal cysts and formation of skin tumours
Development, January 1, 2002; 129(1): 95 - 109.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. M. Owens and F. M. Watt
Influence of {beta}1 Integrins on Epidermal Squamous Cell Carcinoma Formation in a Transgenic Mouse Model: {{alpha}}3{beta}1, but not {{alpha}}2{beta}1, Suppresses Malignant Conversion
Cancer Res., July 1, 2001; 61(13): 5248 - 5254.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
M. Girardi, D. E. Oppenheim, C. R. Steele, J. M. Lewis, E. Glusac, R. Filler, P. Hobby, B. Sutton, R. E. Tigelaar, and A. C. Hayday
Regulation of Cutaneous Malignancy by gamma delta T Cells
Science, October 19, 2001; 294(5542): 605 - 609.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Owens, D. M.
Right arrow Articles by Smart, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Owens, D. M.
Right arrow Articles by Smart, R. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?