Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (55)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rollinson, S.
Right arrow Articles by Morgan, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rollinson, S.
Right arrow Articles by Morgan, G. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 21, No. 1, 43-47, January 2000
© 2000 Oxford University Press


Molecular Epidemiology and Cancer Prevention

Polymorphic variation within the glutathione S-transferase genes and risk of adult acute leukaemia

Sara Rollinson, Philippa Roddam, Eleanor Kane1, Eve Roman1, Ray Cartwright1, Andrew Jack and Gareth J. Morgan2

Department of Haematology, Institute of Pathology, University of Leeds, Leeds LS2 9JT and
1 Leukaemia Research Fund Centre for Clinical Epidemiology, 30 Hyde Terrace, Leeds LS9 2LN, UK


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Polymorphisms within the phase II metabolizer enzymes GST T1, GST M1 and GST P1 affect the body's ability to detoxify a range of potential leukaemogens encountered in the environment. Using PCR, GST T1, GST M1 and GST P1 genotypes were determined in 557 adults with acute leukaemia and 952 age, sex and geographically matched controls. The strongest association with acute leukaemia was observed for the GST T1 null genotype, which occurred among 19% of cases and 14% of controls [odds ratio (OR) 1.45, 95% confidence interval (CI) 1.09–1.93]. A slightly higher proportion of cases (53%) than controls (49%) displayed the GST M1 null genotype, although the difference was not statistically significant (OR 1.22, 95% CI 0.98–1.52). No effect was observed for the GST P1 genotype and no interaction between the GST T1 and GST M1 genotypes was evident. Acute myeloid leukaemia (AML) was weakly associated with both GST T1 null (OR 1.32, 95% CI 0.97–1.79) and GST M1 null (OR 1.24, 95% CI 0.98–1.56), whereas acute lymphoblastic leukaemia (ALL) was associated with GST T1 null (OR 3.28, 95% CI 1.31–8.26). No associations between smoking and disease risk in relation to GST T1 and GST M1 polymorphic status were found.

Abbreviations: ALL, acute lymphoblastic leukaemia; AML, acute myeloid leukaemia; CI, confidence interval; FAB, French-American-British classification; GST, glutathione S-transferase; GST M1, glutathione S-transferase M1; GST P1, glutathione S-transferase P1; GST T1, glutathione S-transferase T1; OR, odds ratio.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Accepted causes of acute leukaemia, such as benzene, ionizing radiation and cytotoxic therapy, only account for a minority of cases. Other environmental and occupational exposures have been implicated, including smoking, but the results have been inconsistent and the associated risks small. DNA damage in the haemopoietic precursor cell is the essential prerequisite for the development of leukaemia and the body has developed a series of mechanisms aimed at preventing such damage. One mechanism resulting in such damage is mediated by reactive species generated either from environmentally encountered carcinogens or endogenously as a result of oxidative metabolism. Humans are polymorphic in their ability to detoxify such intermediates, which in theory may explain differences in leukaemia risk as a result of exogenous exposures.

The gene family of glutathione S-transferases (GSTs), including µ (GST M1), {theta} (GST T1) and {rho} (GST P1), function in the detoxification of electrophilic intermediates and in the excretion of reactive species by the addition of glutathione. Both GST T1 and GST M1 have a null genotype due to an independent gene deletion (1), which results in a lack of active protein. The absence of these proteins has been shown to increase the susceptibility of cultured lymphocytes to exogenously added DNA damaging agents (2). Two alleles of GST P1 have been described (3), an A->G transition causes an Ile->Val substitution giving rise to the GST P1*B allele. This substitution occurs in close proximity to the substrate binding site of the molecule which results in the GST P1*B phenotype displaying an altered specific activity for substrates in comparison with the wild-type GST P1*A allele (4). Individuals with the GST P1*B allelic variant have also been shown to have a significantly higher level of hydrophobic DNA adducts (5). These observations provide a plausible biological role for polymorphisms within the GST enzyme family being potential candidate tumour susceptibility genes.

Polymorphisms within the GST T1, GST M1 and GST P1 families have been associated with several malignancies (3,513). However, few studies have investigated the aetiological role of GST polymorphisms in the development of haemopoietic neoplasms. It has been suggested, albeit inconclusively, that the null genotype of GST T1 is associated with myelodysplasia (14), although reports are conflicting (15,16). In the present study, PCR was used to examine the relationship between polymorphisms in the metabolizer enzymes GST T1, GST M1 and GST P1. The findings for these polymorphisms in 557 patients diagnosed with acute leukaemia and their corresponding controls are reported here.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Study design
Full details of the study are given elsewhere (17). Briefly, cases comprised patients aged 16–69 newly diagnosed with acute leukaemia between 1 April 1991 and 31 December 1996 while resident in the former health authority regions of South West, Wessex and Yorkshire or the counties of Cumbria and Lancashire. All diagnoses were pathologically confirmed. Patients were ineligible if they had been diagnosed with a myelodysplastic syndrome or chronic myeloid leukaemia in the previous 6 months, if they had a malignancy in the previous 2 years or if they had Fanconi's anaemia. Subjects were also ineligible if they had lived abroad for at least 6 months during the year prior to diagnosis. For every case who participated, two controls of the same sex, year of birth and ethnic origin were selected from the general practice of the case. Controls were contacted in the first instance by letter and, if they refused, a replacement was selected. All subjects were interviewed face-to-face by trained personnel using a structured questionnaire (17).

Blood samples were taken from cases as soon as possible after diagnosis. If a pre-treatment sample could not be taken, samples were taken 10 days after transfusion with whole or packed cells, or 2 days after transfusion with platelets. For controls, blood was either taken at the time of interview or shortly after.

Overall, 1066 acute leukaemia patients were identified, of whom 838 (79%) were interviewed. Since the frequency of alleles has been shown to vary with race (18,19), the present analysis is restricted to Caucasian subjects. Of the 807 Caucasian cases interviewed, 592 (73%) had blood samples taken. Of these 592 cases, 557 had at least one matched Caucasian control who also gave blood: 395 cases had two matched Caucasian controls and 162 had only one.

Smoking history was collected at interview, with exposure to tobacco defined as the subject having smoked at least once a day for a minimum period of 6 months. Every change in habit, such as type of tobacco and the number of cigarettes per day, was recorded with corresponding start and stop dates. An area-based deprivation indicator was created by linking to the 1991 census and coding the Townsend score of the address at diagnosis (20).

Classification of acute myeloid leukaemia (AML) cases
Cases were grouped in three ways; the first based on the French-American-British classification (FAB). Cases were also grouped on case history: primary AMLs were defined as cases where AML was the first recorded malignancy (n = 430), while secondary AML were defined as cases having myelodysplasia (MDS) or a prior malignancy (n = 56). Cytogenetic classification was also carried out. Cases with reciprocal translocations clinically associated with good prognosis and a possible de novo origin including t(15;17), t(8;21) and inversion (16) (n = 96) were grouped together. Cases with a partial or complete deletion of chromosomes 5, 7, 12 and 17, cases with a translocation/inversion/deletion of chromosomes 3 and 11, trisomy at chromosomes 8, 11 and 21 were grouped together as cases possibly being associated with secondary AML (n = 75). If more than one abnormality was present, classification was by the primary abnormality or, if not known, by the following order, t(15;17) > Inv (16) > t(8;21) > 11q > 3q > 5q/7q > 12p > 17p > 20q. The remaining cases fell into three categories: 144 cases classified by cytogenetic analysis as normal, 120 cases where cytogenetics failed or were not carried out and 44 cases with other cytogenetic abnormalities which could not be readily classified in the grouping used.

Genotyping
Genomic DNA was extracted from whole frozen blood using a proteinase K treatment, followed by a series of phenol/chloroform extractions and ethanol precipitation (21).

GST T1 and GST M1
Primers specific for the 3' coding region of the GST T1 gene (22), which gave rise to a 480 bp product, were multiplexed with one primer specific for the GST M1 gene and a primer with homology to the GSTM gene family, which gave rise to a 230 bp product (9). The presence of amplification product corresponded to the homozygote/heterozygote form of the enzyme, the absence of the GST T1 or GST M1 amplification product corresponding to the null genotype. Differentiating between homozygotes and heterozygotes was not possible with this assay.

One additional primer specific for the GST M4 gene was included in the reaction. This primer, when paired with the GSTM gene-specific primer within the reaction, amplifies a 157 bp product specific for the GST M4 gene. GST M4 has no known polymorphisms and for all samples yielded an amplification product; as such this amplification product was used as an internal control to monitor each PCR reaction to test the integrity of the DNA. Reaction conditions were as described (9,22), however, this modified protocol used a `hot start' (23) and an annealing temperature of 56°C.

GST P1
The A->G base pair polymorphism in exon 5 of the GST P1 gene was determined using the PCR with restriction fragment length polymorphism method of Harries et al. (3). Due to difficulty amplifying our DNA the primer sequences were redesigned as follows: sense, ACTGGTGTTGATCAGGCGCC; antisense, CCTTCTTGGGTCAGGGTGCAG. The 280 bp product amplified, which spans exon 5, was digested twice for 6 h with BsmA1 to ensure complete digestion and the products sized by electrophoresis on an 8% polyacrylamide gel. GST P1*A (wild-type) samples were undigested (280 bp), GST P1*B (homozygote mutation) samples gave two bands of 147 and 133 bp, while GST P1*AB (heterozygote) samples produced a digestion pattern of all three bands.

Statistical analysis
Odds ratios (OR) and 95% confidence intervals (CI) were calculated using conditional logistic regression, adjusting for deprivation (24). Analysis was conducted using Intercooled Stata 5.0 for Windows 95 (Stata Corp.). Subgroup analyses were performed by cell lineage, age (three groups, 16–39, 40–54 and 55+ years) and FAB type. For the purposes of the present analysis, a 2 year latent interval prior to diagnosis was assumed for tobacco exposure.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Study composition
The study group comprised 71 cases of acute lymphoblastic leukaemia (ALL), 479 cases of AML and seven other cases where it was not possible to definitely assign lineage. Among cases, the average age was 47.2 years and 54% were male. As a consequence of control participation bias, cases were significantly more likely to live in deprived areas than their matched controls ({chi}2 = 17.16, P < 0.01) and so all analyses are adjusted for deprivation using the Townsend score.

Distribution of GST genotypes
Table IGo shows the number of cases and controls by GST T1, GST M1 and GST P1 status. For acute leukaemias combined, the null genotype of GST T1 occurred in 104 (19%) cases and 135 (14%) of their corresponding controls, yielding a significantly elevated OR of 1.45 (95% CI 1.09–1.93). The more common GST M1 null genotype was found in 296 (53%) cases and 466 (49%) controls (OR 1.22, 95% CI 0.98–1.52). Compared with the GST P1*A wild-type, the heterozygote and homozygote loci show no increased risk of acute leukaemia. Both GST T1 null and GST M1 null were weakly associated with AML (GST T1 null, OR 1.32, 95% CI 0.97–1.79; GST M1 null, OR 1.24, 95% CI 0.98–1.56), whereas for ALL, being null at GST T1 conferred a 3-fold increase in risk (OR 3.28, 95% CI 1.31–8.26). The alleles of GST P1 were similar in cases and controls for AML and ALL.


View this table:
[in this window]
[in a new window]
 
Table I. Number of cases and controls, ORs and 95% CIs by lineage for GST T1 and GST M1 using homozygote/heterozygote as reference, for GST P1 comparing heterozygote and homozygote individually with wild-type as reference and for GST P1 comparing homozygote with wild-type and heterozygote combined as reference
 
Interaction between GST genotypes
The combined effects of polymorphic status at the GST T1 and GST M1 loci are given in Table IIGo (GST P1 was not incorporated as none of its genotypes were associated with acute leukaemia). Increased risk estimates were observed when either allele was null. For all acute leukaemias combined, the greatest estimated risk was for GST T1 null and GST M1 heterozygote/homozygote (OR 1.81, 95% CI 1.15–2.85), but the risk when null at both loci was similar (OR 1.57, 95% CI 1.07–2.29). The majority of cases were diagnosed with AML and the risk estimates for this cell type are generally equivalent to those for all leukaemias combined. Among ALL cases, elevated OR were also observed when GST T1 was null.


View this table:
[in this window]
[in a new window]
 
Table II. Number of cases and controls, ORs and 95% CIs by lineage for GST T1 and GST M1 combined using homozygote/heterozygote as reference
 
FAB types
For AML, GST T1 and GST M1 were examined by FAB type (Table IIIGo). Elevated risk estimates were observed among AML M3, M4 and M5 for GST T1 and AML M0, M1, M3 and M6 for GST M1. However, the numbers are small and all the CI overlap. No differences in genotype distribution were observed for GST P1 (data not shown).


View this table:
[in this window]
[in a new window]
 
Table III. Number of cases and controls, ORs and 95% CIs by FAB type for GST T1 and GST M1 using homozygote/heterozygote as reference
 
De novo and secondary types
For AML GST T1, GST M1 and GST P1 genotypes were examined within the cases with a history of prior malignancy (secondary) and de novo (primary) cases. GST M1 null genotypes showed an increased frequency in the de novo cases compared with the secondary cases: GST M1 de novo 55.3%, secondary 44.6%. Due to the small number of samples, however, significance was not reached (GST M1, OR 1.54, 95% CI 0.87–2.69). A comparison of each group versus the AML controls increased the associated risk compared with analysis of the entire group (GST T1 null, OR 1.42, 95% CI 0.92–1.72; GST M1 null, OR 1.28, 95% CI 1.02–1.63) for the de novo AML group. No differences were observed in genotype distribution for GST P1.

Cytogenetic classification
GST T1, GST M1 and GST P1 genotypes were compared between the two cytogenetic groups. A higher frequency of null genotypes was found in the balanced translocation group compared with the other major group (GST T1 null, 22.3 versus 17.56%; GST M1 null, 57.4 versus 51.3%). Due to the small numbers these values failed to reach significance (GST T1, OR 1.35, 95% CI 0.63–2.94; GST M1, OR 1.28, 95% CI 0.69–2.38). Comparing each group against the AML controls only GST T1 null in the balanced translocation group showed an increase in frequency compared with the AML study group as a whole (good prognosis 22.3%, controls 15.1%; OR 1.63, 95% CI 0.96–2.77). No differences were observed in GST P1 genotype distribution.

Age distribution
The age distribution of GST genotypes was investigated in the study group. Data were split into three age groups (16–39, 40–54 and 55–69 years) and the effect of age compared for each polymorphic variant of GST T1, GST M1 and GST P1. No associations between age and genotype were found for AML or ALL (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
A number of mechanisms have evolved to protect the integrity of DNA from both endogenous and exogenous damage. The GSTs play a critical role in the system which protects against reactive oxygen species, the breakdown of peroxidized lipid and oxidized DNA. GST levels can be induced by exposure to foreign substances in vivo suggesting that they form part of an adaptive system to chemical stress. The GSTs are involved in the metabolism of many carcinogens and environmental pollutants and thus the polymorphisms at the GST loci are good candidates as leukaemia predisposition genes.

The GSTs may modulate the level of DNA damage in haemopoietic stem and progenitor cells resulting from reactive metabolites. In vitro GST T1 null status has been linked to an increased frequency of diepoxybutane-induced sister chromatid exchange in cultured lymphocytes, while GST M1 allele status has no effect on the DNA damage observed (25). GST T1 and GST M1 protein and mRNA have been detected within the bone marrow (26), as has mRNA for GST P1. There is therefore a plausible biological mechanism which would link an increased risk of leukaemia to a lack of activity of GST T1 and GST M1.

Our results suggest an association between lack of activity of the GST T1 enzyme and an increased risk of developing acute leukaemia (OR 1.45, 95% CI 1.09–1.93). We went on to examine the association with lymphoid and myeloid subtypes and found that AML was weakly associated with both the GST T1 and GST M1 null genotypes (GST T1, OR 1.32, 95% CI 0.97–1.79; GST M1, OR 1.24, 95% CI 0.98–1.56). Whilst in ALL the GST T1 null genotype conferred a 3-fold increased risk (OR 3.28, 95% CI 1.31–8.26), no effect was observed for GST M1. None of the polymorphic variants of GST P1 examined showed an association with acute leukaemia, either AML or ALL.

The acute leukaemias are associated with the transformation of haemopoietic precursor cells. AML and ALL are different diseases and they are thought to be the result of the transformation of an early myeloid or lymphoid progenitor cell. This may in fact not be true and it is equally possible that both adult AML and ALL are stem cell diseases but with different patterns of maturation. The GST T1 null genotype carries an OR of 3.28 for ALL and 1.32 for AML. While this may support different risks for these two entities the number of samples in the ALL group (n = 71) was too small to support the concept of different aetiologies for these diseases.

A number of environmental exposures, such as pesticides and tobacco smoke, have been suggested as risk factors for acute leukaemia (17). Although the risks associated with these exposures are small, it is possible that they could interact with the genotypes to influence susceptibility. When the GST T1 and GST M1 genotypes were analysed in combination, the risk of acute leukaemia was increased (GST T1 null + GST M1 homozygote/heterozygote, OR 1.81, 95% CI 1.15–2.85), suggesting that the additive effects of these polymorphisms are also important.

Although it is possible that the presented associations could have arisen from an unusual prevalence of null genotypes in our control population, this seems unlikely. Our population-based controls were individually matched to cases by age, sex, race and geographical area of residence. Further, within our control population, the genotype distributions of the polymorphisms examined did not vary with age or sex. More importantly, perhaps, is that no variations with the census-derived Townsend index (used here as an indicator of socio-economic status) were observed. To follow standard practice, the analyses presented here were adjusted to account for the potential confounding effects of socio-economic status, although, within our data, this had no effect on the results. However, it should be noted that among our controls, the proportion with GST T1 null (14%) is at the lower end of the published range (13–24%) for Caucasian populations (11,12,14,18,27), while the percentage with the GST P1*B genotype (14%) is considerably greater than that reported for other studies (6–9%) (3,5,27,28). Only for GST M1 is the percentage of nulls (49%) within the published range of 42–57% (9,11,18,27,29).

Elevated risk estimates were observed for GST T1 null among the M3 and M4 FAB types, while for GST M1 null M0 and M3 showed the strongest association: the same trend was observed in the cases with balanced translocations. Both classifications are associated with good prognosis, showing a good concordance between both classification systems. For de novo primary AMLs the GST M1 null genotype carried an increased risk of AML (OR 1.28, 95% CI 1.02–1.63), while including the secondary AMLs reduced this observed risk. It appears that de novo AML associated with balanced translocations is at increased risk of developing in individuals null for GST T1 and GST M1. These risks are less in secondary AML and other cytogenetic groups. The groups are, however, small, but nonetheless this study suggests that risks associated with specific genotypes should be analysed based on defined cytogenetic groups.

Tobacco smoking represents a defined exposure which can be quantified and we have examined the association of smoking with polymorphic status at the GST T1 and GST M1 loci. Although smoking, and in particular current smoking, has been positively associated with acute leukaemia amongst this study's interviewed subjects (17), no significant interaction was observed between smoking and the null genotype of either the GST T1 or GST M1 loci (data not shown). The GSTs, particularly GST P1, are important in the detoxification of compounds found in cigarette smoke (3). The GST P1*B allele has also been associated with an increased risk of smoking-related diseases such as lung cancer (5). Smoking is also a common source of exposure to benzene, which is also detoxified via GST T1. No increased risk was identified in this study and so it would seem that this mechanism is not significant in the generation of acute leukaemia in vivo.

A major evolutionary role for these enzyme systems is the prevention of oxidative DNA damage and the association described herein suggests that this mechanism should be examined further in haemopoietic stem cells, particularly in the context of environmentally encountered xenobiotics.


    Acknowledgments
 
We would like to thank the Leukaemia Research Fund for funding this work, Jan Parker and Denise Robinson, and all the consultants and staff involved in the Leukaemia Research Fund's Adult Acute Leukaemia study.


    Notes
 
2 To whom correspondence should be addressed Email: patsjr{at}leeds.ac.uk Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Seidegård,J., Vorachek,W.R., Pero,R.W. and Pearson,W.R. (1988) Hereditary differences in the expression of the human glutathione transferase active on trans-stilbene oxide are due to a gene deletion. Proc. Natl Acad. Sci. USA, 85, 7293–7297.[Abstract/Free Full Text]
  2. Hallier,E., Langhof,T., Danappel,D., Leutbecher,M., Schroeder,K., Goergens,H.W., Muller,A. and Bolt,M. (1993) Polymorphism of glutathione conjugation of methyl bromide, ethylene oxide and dichloromethane in human blood: influence on the induction of sister chromatid exchange (SCE) in lymphocytes. Arch. Toxicol, 67, 173–178.[Web of Science][Medline]
  3. Harries,L.W., Stubbins,M.J., Forman,D., Howard,G. and Wolf,C.R. (1997) Identification of genetic polymorphisms at the glutathione S-transferase Pi locus and association with susceptibility to bladder, testicular and prostate cancer. Carcinogenesis, 18, 641–644.[Abstract/Free Full Text]
  4. Johansson,A.-S., Stenberg,G., Widersten,M. and Mannervik,B. (1998). Structure–activity relationships and thermal stability of human glutathione s-transferase P1-1 governed by the H-site residue 105. J. Mol. Biol., 278, 687–698.[Web of Science][Medline]
  5. Ryberg,D., Skaug,V., Hewer,A., Philips,D.H., Harries,L.W., Wolf,R.C., Ogreid,D.H., Ulvik,A., Vu,P. and Haugen,A. (1997) Genotypes of glutathione transferase M1 and P1 and their significance for lung DNA adduct levels and cancer risk. Carcinogenesis, 18, 1285–1289.[Abstract/Free Full Text]
  6. Fryer,A.A., Zhao,L., Alldersea,J., Boggild,M.D., Perrett,C.W., Clayton,R.N., Jones,P.W. and Strange,R.C. (1993) The glutathione S-transferases: polymerase chain reaction studies on the frequency of the GSTM1 0 genotype in patients with pituitary adenomas. Carcinogenesis, 14, 563–566.[Abstract/Free Full Text]
  7. Bell,D.A., Taylor,J.A., Paulson,D.F., Robertson,C.N., Mohler,J.L. and Lucier,G.W. (1993) Genetic risk and carcinogen exposure: a common inherited defect of the carcinogen metabolism gene glutathione S-transferase M1 (GSTM1 that increases susceptibility to bladder cancer. J. Natl Cancer Inst., 85, 1159–1164.[Abstract/Free Full Text]
  8. Abdel-Rahman,S.Z., Anwar,W.A., Abdel-Aal,W.E., Mostafa,H.M. and Au,W.W. (1998) GSTM1 and GSTT1 genes are potential risk modifiers for bladder cancer. Cancer Detect. Prevent., 22, 129–138.
  9. Zhong,S., Wyllie,A.H., Barnes,D., Wolf,C.R. and Spurr,N.K. (1993) Relationship between the GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer. Carcinogenesis, 14, 1821–1824.[Abstract/Free Full Text]
  10. Zhong,S., Howie,A.F., Ketterer,B., Taylor,J., Hayes,J.D., Beckett,G.J., Wathen,G., Wolf,C.R. and Spurr,N.K. (1991) Glutathione S-transferase mu locus: use of genotyping and phenotyping assays to assess association with lung cancer susceptibility. Carcinogenesis, 12, 1533–1537.[Abstract/Free Full Text]
  11. Deakin,M., Elder,J., Hendrickse,C., Peckham,D., Baldwin,D., Pantin,C., Wild,N., Leopard,P., Bell,D.A., Jones,P., Duncan,H., Brannigan,K., Alldersea,J., Fryer,A.A. and Strange,R.C. (1996) Glutathione s-transferase GSTT1 genotypes and susceptibility to cancer: studies of interactions with GSTM1 in lung, oral, gastric and colorectal cancers. Carcinogenesis, 17, 881–884.[Abstract/Free Full Text]
  12. Warwick,A., Sarhanis,P., Redman,C., Pemble,S., Taylor,J.B., Keterer,B., Jones,P., Alldersea,J., Gilford,J., Yengi,L., Fryer,A. and Strange,R.C. (1994) Theta class glutathione s-transferase GSTT1 genotypes and susceptibility to cervical neoplasia: interactions with GSTM1, CYP2D6 and smoking. Carcinogenesis, 15, 2841–2845.[Abstract/Free Full Text]
  13. Matthias,C., Bockmuhl,U., Jahnke,V., Harries,L.W., Wolf,C.R., Jones,P.W., Alldersea,J., Worrall,S.F., Hand,P., Fryer,A.A. and Strange,R.C. (1998) The glutathione S-transferase GSTP1 polymorphism: effects on the susceptibility to oral/pharyngeal and laryngeal carcinomas. Pharmacogenetics, 8, 1–6.[Web of Science][Medline]
  14. Chen,H., Sandler,D.P., Taylor,J.A., Shore,D.L., Liu,E., Bloomfield,C.D. and Bell,D.A. (1996) Increased risk for myelodysplastic syndromes in individuals with glutathione transferase theta 1 (GSTT1) gene defect. Lancet, 347, 295–297.[Web of Science][Medline]
  15. Basu,T., Gale,R.E., Langabeer,S. and Linch,D.C. (1997) Glutathione S-transferase theta 1 (GSTT1) gene defect in myelodysplasia and acute myeloid leukaemia. Lancet, 349, 1450.
  16. Atoyebi,W., Kusec,R., Fidler,C., Peto,T.E.A., Boultwood,J. and Wainscoat,J.S. (1997) Glutathione S-transferase gene deletions in myelodysplasia. Lancet, 349, 1450–1451.
  17. Kane,E.V. and Roman,E. (1999) Tobacco and the risk of acute leukaemia in adults. Br. J. Cancer, in press.
  18. Nelson,H.H., Wiencke,J.K., Christiani,D.C., Cheng,T.J., Zuo,Z.-F., Schwartz,B.S., Lee,B.-K., Spitz,M.R., Wand,M., Xu,X. and Kelsey,K.T. (1995) Ethnic differences in the prevalence of the homozygous deleted genotype of glutathione s-transferase theta. Carcinogenesis, 16, 1243–1245.[Abstract/Free Full Text]
  19. Lin,H.J., Probst-Hensch,N.M., Ingles,S.A., Han,C.-Y., Lin,B.K., Lee,D.B., Frankl,H.D., Lee,E.R., Longnecker,M.P. and de Haile,R.W. (1995) Glutathione transferase (GSTM1) null genotype, smoking and prevalence of colorectal adenomas. Cancer Res., 55, 1224–1226.[Abstract/Free Full Text]
  20. Townsend,P., Philimore,P. and Beattie,A. (1988) Health and Deprivation: Inequality and the North. Croom Helm, London, UK.
  21. Jackson,D.P., Lewis,F., Taylor,G.R., Boylston,A.W. and Quirke,P. (1990) Tissue extraction of DNA and RNA analysis by the polymerase chain reaction. J. Clin. Pathol., 43, 499–504.[Abstract/Free Full Text]
  22. Pemble,S., Schroeder,K.R., Spencer,S.R., Meyer,D.J., Hallier,E., Bolt,H.M., Ketterer,B. and Taylor,J.B. (1994) Human glutathione s-transferase theta (GSTT1): cDNA cloning and the characterisation of a genetic polymorphism. Biochem. J., 300, 271–276.
  23. Hosta,L. and Flick,P. (1991) Editorial comments. In Enhancement of Specificity and Yield in PCR. US Biochemical Corp., Cleveland, OH, Vol. 18, pp. 1–5.
  24. Breslow,N.E. and Day,N.E. (1980) The analysis of case–control studies. In Statistical Methods in Cancer Research. IARC, Lyon, Vol. 1, pp. 247–279.
  25. Norppa,H., Hirvonen,A., Jarventaus,H., Uuskula,M., Tasa,G., Ojajarvi,A. and Sorsa,M. (1995) Role of GSTT1 and GSTM1 genotypes in determining individual sensitivity to sister chromatid exchange induction by diepoxybutane in cultured human lymphocytes. Carcinogenesis, 16, 1261–1264.[Abstract/Free Full Text]
  26. Hall,A.G., McGuckin,A.G., Pearson,A.D.J., Cattan,A.R., Malcolm,A.J. and Reid,M.M. (1994). Glutathione S transferases in bone marrow metastases of disseminated neuroblastoma. J. Clin. Pathol., 47, 468–469.[Abstract/Free Full Text]
  27. Saarikoski,S.T., Voho,A., Reinikainen,M., Anttila,S., Karjalainen,A., Malaveille,C., Vainio,H., Husgafvel-Pursiainen,K. and Hirvonen,A. (1998) Combined effect of polymorphic GST genes on individual susceptibility to lung cancer. Int. J. Cancer, 77, 516–521.[Web of Science][Medline]
  28. Watson,M.A., Stewart,R.K., Smith,G.B.J, Massey,T.E. and Bell,D.A. (1998) Human glutathione S-transferase P1 polymorphisms: relationship to lung tissue enzyme activity and population frequency distribution. Carcinogenesis, 19, 275–280.[Abstract/Free Full Text]
  29. Yengi,L., Inskip,A., Gilford,J., Alldersea,J., Bailey,L., Smith,A., Lear,J.T., Heagerty,A.H., Bowers,B., Hand,P., Hayes,J.D., Jones,P.W., Strange,R.C. and Fryer,A.A. (1996) Polymorphism at the glutathione S-transferase locus GSTM3: interactions with cytochrome P450 and glutathione S-transferase genotypes as risk factors for multiple cutaneous basal cell carcinoma. Cancer Res., 56, 1974–1977.[Abstract/Free Full Text]
Received May 19, 1999; revised September 17, 1999; accepted September 23, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
haematolHome page
P. Bolufer, M. Collado, E. Barragan, J. Cervera, M.-J. Calasanz, D. Colomer, J. Roman-Gomez, and M. A. Sanz
The potential effect of gender in combination with common genetic polymorphisms of drug-metabolizing enzymes on the risk of developing acute leukemia
Haematologica, March 1, 2007; 92(3): 308 - 314.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
T. Kanai, K. Takahashi, and H. Inoue
Three Distinct-Type Glutathione S-Transferases from Escherichia coli Important for Defense against Oxidative Stress
J. Biochem., November 1, 2006; 140(5): 703 - 711.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J.-Q. He, J. E. Connett, N. R. Anthonisen, P. D. Pare, and A. J. Sandford
Glutathione S-Transferase Variants and Their Interaction with Smoking on Lung Function
Am. J. Respir. Crit. Care Med., August 15, 2004; 170(4): 388 - 394.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. Rollinson, J. M. Allan, G. R. Law, P. L. Roddam, M. T. Smith, C. Skibola, A. G. Smith, M. S. Forrest, K. Sibley, R. Higuchi, et al.
High-Throughput Association Testing on DNA Pools to Identify Genetic Variants that Confer Susceptibility to Acute Myeloid Leukemia
Cancer Epidemiol. Biomarkers Prev., May 1, 2004; 13(5): 795 - 800.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Seedhouse, R. Faulkner, N. Ashraf, E. Das-Gupta, and N. Russell
Polymorphisms in Genes Involved in Homologous Recombination Repair Interact to Increase the Risk of Developing Acute Myeloid Leukemia
Clin. Cancer Res., April 15, 2004; 10(8): 2675 - 2680.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. K. Dasgupta, P. J. Adamson, F. E. Davies, S. Rollinson, P. L. Roddam, A. J. Ashcroft, A. M. Dring, J. A. L. Fenton, J. A. Child, J. M. Allan, et al.
Polymorphic variation in GSTP1 modulates outcome following therapy for multiple myeloma
Blood, October 1, 2003; 102(7): 2345 - 2350.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Sibley, S. Rollinson, J. M. Allan, A. G. Smith, G. R. Law, P. L. Roddam, C. F. Skibola, M. T. Smith, and G. J. Morgan
Functional FAS Promoter Polymorphisms Are Associated with Increased Risk of Acute Myeloid Leukemia
Cancer Res., August 1, 2003; 63(15): 4327 - 4330.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Hohaus, G. Massini, F. D'Alo', F. Guidi, R. Putzulu, A. Scardocci, A. Rabi, A. L. Di Febo, M. T. Voso, and G. Leone
Association between Glutathione S-Transferase Genotypes and Hodgkin's Lymphoma Risk and Prognosis
Clin. Cancer Res., August 1, 2003; 9(9): 3435 - 3440.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Rollinson, A. P. Levene, F. K. Mensah, P. L. Roddam, J. M. Allan, T. C. Diss, E. Roman, A. Jack, K. MacLennan, M. F. Dixon, et al.
Gastric marginal zone lymphoma is associated with polymorphisms in genes involved in inflammatory response and antioxidative capacity
Blood, August 1, 2003; 102(3): 1007 - 1011.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. T. Bowen, M. E. Frew, S. Rollinson, P. L. Roddam, A. Dring, M. T. Smith, S. E. Langabeer, and G. J. Morgan
CYP1A1*2B (Val) allele is overrepresented in a subgroup of acute myeloid leukemia patients with poor-risk karyotype associated with NRAS mutation, but not associated with FLT3 internal tandem duplication
Blood, April 1, 2003; 101(7): 2770 - 2774.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. T. Voso, F. D'Alo', R. Putzulu, L. Mele, A. Scardocci, P. Chiusolo, R. Latagliata, F. Lo-Coco, S. Rutella, L. Pagano, et al.
Negative prognostic value of glutathione S-transferase (GSTM1 and GSTT1) deletions in adult acute myeloid leukemia
Blood, September 26, 2002; 100(8): 2703 - 2707.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. M. Davies, S. Bhatia, J. A. Ross, W. R. Kiffmeyer, P. S. Gaynon, G. A. Radloff, L. L. Robison, and J. P. Perentesis
Glutathione S-transferase genotypes, genetic susceptibility, and outcome of therapy in childhood acute lymphoblastic leukemia
Blood, June 17, 2002; 100(1): 67 - 71.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. M. Allan, C. P. Wild, S. Rollinson, E. V. Willett, A. V. Moorman, G. J. Dovey, P. L. Roddam, E. Roman, R. A. Cartwright, and G. J. Morgan
Polymorphism in glutathione S-transferase P1 is associated with susceptibility to chemotherapy-induced leukemia
PNAS, September 5, 2001; (2001) 191211198.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. IZZOTTI, C. CARTIGLIA, J. LEWTAS, and S. DE FLORA
Increased DNA alterations in atherosclerotic lesions of individuals lacking the GSTM1 genotype
FASEB J, March 1, 2001; 15(3): 752 - 757.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. E. Davies, S. J. Rollinson, A. C. Rawstron, E. Roman, S. Richards, M. Drayson, J. A. Child, and G. J. Morgan
High-Producer Haplotypes of Tumor Necrosis Factor Alpha and Lymphotoxin Alpha Are Associated With an Increased Risk of Myeloma and Have an Improved Progression-Free Survival After Treatment
J. Clin. Oncol., August 15, 2000; 18(15): 2843 - 2851.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. M. Davies, L. L. Robison, J. D. Buckley, G. A. Radloff, J. A. Ross, and J. P. Perentesis
Glutathione S-Transferase Polymorphisms in Children with Myeloid Leukemia: A Children's Cancer Group Study
Cancer Epidemiol. Biomarkers Prev., June 1, 2000; 9(6): 563 - 566.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. M. Allan, C. P. Wild, S. Rollinson, E. V. Willett, A. V. Moorman, G. J. Dovey, P. L. Roddam, E. Roman, R. A. Cartwright, and G. J. Morgan
Polymorphism in glutathione S-transferase P1 is associated with susceptibility to chemotherapy-induced leukemia
PNAS, September 25, 2001; 98(20): 11592 - 11597.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (55)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rollinson, S.
Right arrow Articles by Morgan, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rollinson, S.
Right arrow Articles by Morgan, G. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?