Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (50)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Healey, C. S.
Right arrow Articles by Ponder, B. A.J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Healey, C. S.
Right arrow Articles by Ponder, B. A.J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 21, No. 2, 189-193, February 2000
© 2000 Oxford University Press


Molecular Epidemiology and Cancer Prevention

Polymorphisms in the human aromatase cytochrome P450 gene (CYP19) and breast cancer risk

Catherine S. Healey3, Alison M. Dunning, Francine Durocher1, Dawn Teare1, Paul D.P. Pharoah, Robert N. Luben2, Douglas F. Easton1 and Bruce A.J. Ponder

CRC Department of Oncology,
1 CRC Genetic Epidemiology Group and
2 EPIC, University of Cambridge, Strangeways Research Laboratory, Worts Causeway, Cambridge CB1 8RN, UK


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The aromatase enzyme catalyses the conversion of androgens to oestrogens in the oestrogen biosynthesis pathway. Because increased exposure to oestrogens is considered to be a risk factor for breast cancer, the human aromatase gene (CYP19) is a plausible candidate for low penetrance breast cancer susceptibility. Preliminary reports have suggested that specific alleles of a TTTA repeat may be associated with differences in breast cancer risk. We have identified two new polymorphisms in the CYP19 gene: a TCT insertion/deletion in intron 4 and a G->T substitution in intron 6, which have rare allele frequencies of 0.35 and 0.45, respectively, in the British population. Comparison was made between the frequencies of these alleles and those of the TTTA repeat in up to 599 breast cancer cases and 433 normal controls from the East Anglian, British population. We found strong linkage disequilibrium between the alleles of these three loci, but no significant association of any alleles with breast cancer risk. The maximum odds ratios observed were: 1.03 (95% CI 0.68–1.55) for the intron 4 TCT insertion/deletion polymorphism [del/del versus ins/ins]; 1.56 (95% CI 0.63–3.83) for the intron 4 [TTTA]10 allele; 1.29 (95% CI 0.75–2.21) for the intron 6 G->T polymorphism [TT versus GG]. We conclude that the CYP19 gene has no major role in common breast cancer incidence in the British population.

Abbreviations: 95% CI, 95% confidence interval; OR, odds ratio; SSCP, single-strand conformation polymorphism; VNTR, variable nucleotide repeat.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Breast cancer is a common disease that will affect 8% of British women. However, less than 5% of breast cancer incidence can be explained by rare, highly penetrant genes such as BRCA2 and TP53 (1,2). In principle, common, low penetrance genes could explain the majority of breast cancer cases.

It is widely accepted that oestrogens are involved in the development of breast tumours and increased lifetime exposure to endogenous oestrogens is known to increase risk of breast cancer (3,4). Epidemiological studies have identified several factors affecting lifetime exposure that increase the risk of breast cancer. These include: early age at menarche; late age at first pregnancy; late age at menopause; nulliparity; and post-menopausal obesity (oestrogen biosynthesis in post- menopausal women occurs primarily in adipose tissue). In addition to length of exposure to oestrogens, exposure to high levels of oestrogens may also increase breast cancer risk. Toniolo et al. (5) demonstrated that women with high levels of serum oestrogens, particularly oestradiol, the most biologically active oestrogen, have an increased risk of breast cancer. Furthermore, oestrogens in breast adipose tissue may act locally to promote the growth of breast carcinomas (68).

The CYP19 gene, located on chromosome 15, encodes the enzyme P450 aromatase, which catalyses the biosynthesis of oestrogens from androgens in three sequential steps (described in ref. 9). Aromatase P450 is present in the endoplasmic reticulum of cells in which it is expressed, including the granulosa cells and corpus luteum of the ovary, the Leydig cells of the testis, the placenta, various sites in the brain and in adipose tissue. Different forms of oestrogens are synthesized from different androgen substrates in the various tissues. For instance, oestrone is synthesized from androstenedione in adipose tissue, oestradiol from testosterone in granulosa cells and oestriol from 16{alpha}-hydoxylated androgens in the placenta.

The CYP19 gene has 10 exons and transcription begins in exon 2. Tissue specificity is achieved using alternative splicing of exon 1 combined with different tissue-specific promoters (reviewed in ref. 10). Several mutations in the CYP19 gene have been identified which result in an autosomal recessive form of female pseudohermaphroditism and virilization of the mother during pregnancy due to impaired or absent aromatase activity. In addition, at puberty the affected female may show signs of virilization and have pubertal failure, hypergonadotrophic hypogonadism, polycystic ovaries and tall stature. (1114).

Two polymorphic sites have been used in breast cancer studies: (i) a tetranucleotide repeat polymorphism, [TTTA]n, located in intron 4 of the CYP19 gene (15); and (ii) a C826T variation in exon 7 which gives rise to the amino acid substitution Arg264Cys and is observed by sequencing and SSCP analysis (9,1618). There have been numerous reports of different TTTA repeat alleles being associated with variation in breast cancer risk: Kristensen et al. (19) found that carrying the [TTTA]12 allele was associated with an increased risk of breast cancer in their Scandinavian population [odds ratio (OR) 2.42, 95% confidence interval (95% CI) 1.03–5.80]. This was confirmed in a study by Haiman and co-workers (20) where the [TTTA]12 allele was over-represented in breast cancer cases (OR 1.84, 95% CI 1.02–3.32), but refuted by Siegelmann-Danieli and Buetow (21), who found that [TTTA]12 occurred at a greater frequency in their control population. Haiman et al. (20) also found an increase in breast cancer risk associated with the [TTTA]10 allele (OR 4.03, 95% CI 1.52–10.67) and Siegelmann-Danieli and Buetow (21) reported a greater frequency of the [TTTA]n allele measuring 171 bp (allele 2) in cases compared with controls (18.5 versus 13.38%, OR 1.47, 95% CI 0.99–2.17).

Sourdaine et al. (17) found one Arg264Cys heterozygote in five breast tumours, but no polymorphism was seen in an equal number of controls, suggesting a low Cys264 allele frequency in the British population. In contrast, Watanabe et al. (18) found the Cys264 allele frequency to be 30% in a Japanese population sample. Seigelmann-Danieli and Buetow (21) also reported the variant in US breast cancer cases. Although creating a non-conservative amino acid substitution, this polymorphism has no apparent effect on aromatase activity or response to aromatase inhibitors (17,18), nor is it associated with breast cancer risk in Japanese women (18). In this present study we set out to investigate possible associations between common CYP19 polymorphisms and breast cancer risk in the British population.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Subjects
All patients and controls in this study are Caucasian females from the East Anglian region of the UK. Two separate series (strata) were used to overcome the need to increase thresholds of statistical significance when carrying out multiple tests. The selection criteria for the two series differed slightly and the sets of results were initially examined individually. They were found to be similar and so are shown combined.

The first series is a prospectively ascertained group of 288 incident patients, attending the Addenbrooke's Hospital (East Anglia) for treatment between 1992 and 1995 and diagnosed below age 71 years (mean age 52.5, standard deviation 12.8, range 28.6–70.8 years). These are compared with a group of 288 randomly selected, anonymous controls taken from the EPIC study (22), a population-based cohort study of diet and health (mean age 58.9, standard deviation 9.2, range 44.7–75.6 years). This cohort contains ~25 000 individuals resident in Norfolk (East Anglia) recruited from 1992 to 1996.

The second series is a group of 384 patients retrospectively ascertained through the East Anglian Cancer Registry, as part of the Anglian Breast Cancer Study, comprising all patients diagnosed below age 55 years since 1991 and still alive in 1996 (mean age 46.6, standard deviation 5.7, range 25.0–54.9 years). These are compared with a second group of 384 random controls also from the EPIC cohort (mean age 55.6, standard deviation 8.1, range 39.9–69.9 years).

Genotyping
Microsatellite analysis of the intron 4 TTTA repeat was performed on 20–100 ng of DNA as follows: 200 nM PolyF (GCAGGTACTTAGT- TAGCTAC) and PolyR (TTACAGTGAGCCAAGGTCGT) (15), 0.4 U red hot polymerase and 10x buffer (Advanced Biotechnologies), 1.5 mM MgCl2, dNTPs (200 µM A, T and G and 10 µM dCTP) and 0.3 µCi [{alpha}-32P]dCTP in a 30 µl volume. Amplification conditions were: 1 cycle of 95°C for 5 min; 40 cycles of 95°C for 1 min, 55°C for 1 min, 72°C for 1 min; 1 cycle of 72°C for 10 min in an MJ Tetrad PCR machine (GRI, UK). The PCR was then electrophoresed through a sequagel-6 matrix (National Diagnostics) at 120 W until the xylene cyanol dye reached the bottom. The gel was exposed to X-ray film at –70°C overnight. [TTTA]8 gives a fragment of 175 bp.

The same fragment was amplified for sequence analysis using the same PCR conditions as above, but excluding [{alpha}-32P]dCTP and using 200 µM dNTPs. The Sequenase PCR product sequencing kit (US Biochemical) was used according to the manufacturer's instructions.

A second set of primers for [TTTA]n microsatellite analysis in intron 4 were designed to exclude the TCT insertion/deletion (Ins/Del) site: I4F, TTGTCTATGAATGTGCCTTTT; I4R, CTGGGTGATAGAGTCAGAGC. These were used in microsatellite analysis as described above. [TTTA]8 in this instance gives a fragment of 105 bp.

Single-strand conformation polymorphism (SSCP) and sequence analysis of intron 6/exon 7 were performed as for intron 4 but using the primers I6F (TCTTAGCTAACTCTGGCACC) and I7R (TTCAGGTCAGTACCTCTGCT) and 1.5 mM MgCl2 in a 50 µl volume and annealing at 60°C, to give a fragment of 350 bp. The SSCP was resolved on a 0.8x MDE (FMC) gel run at 200 V for 17 h at 10°C.

Statistics
Associations between polymorphisms and breast cancer were analysed by logistic regression using the program S-plus. Cases and controls were genotyped in two groups where possible, stratum 1 (up to 288 cases and 288 controls) and stratum 2 (up to 384 cases and 384 controls), and all analyses allowed for strata as a covariate. The effects of the TTTA repeats were assessed by testing for a trend in breast cancer risk with repeat length by fitting a parameter for repeat length (averaged over the two chromosomes) in logistic regression. Linkage disequilibrium between pairs of allelic sites was estimated using the correlation coefficient {Delta} (23). Meta-analysis was performed by log linear regression. Odds ratios were estimated for specific alleles versus all others and each study was treated as a separate stratum.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Polymorphism discovery
Initially all samples were genotyped for the [TTTA]n tract in intron 4 with the PolyF and PolyR primers. TTTA repeats ranging from 7–13 were observed and the frequencies are given in Table IGo. In order to correlate the microsatellite band sizes with TTTA repeat length, homozygotes for the two most common alleles (Figure 1aGo), allele 1 (the smallest) and allele 6, were sequenced. Allele 6 had 11 TTTA repeats, but allele 1 had seven repeats, not six as predicted from its size on the microsatellite gel. However, when the sequence was examined further, a 3 bp TCT deletion was found 50 bp upstream of the [TTTA]n tract in allele 1 but not in allele 6. This deletion explained the apparent discrepancy between band size and repeat number and represents an insertion/deletion polymorphism. The rarer TCT deletion allele has a frequency of 0.35 in the control population. We have subsequently found that this polymorphism has been independently discovered in the Japanese population (24).


View this table:
[in this window]
[in a new window]
 
Table I. CYP19 intron 4 TTTA repeat length alleles in cases and controls
 


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 1. Microsatellite analysis of the CYP19 [TTTA]n repeat. Samples A–H analysed. (a) Including the TCT Ins/Del (using primers PolyF and PolyR) and showing fragment sizes ranging from 168 to 195 bp (alleles 1–8). (b) Excluding the TCT Ins/Del (using primers I4F and I4R) and showing fragment sizes ranging from 101 to 125 bp ([TTTA]n where n = 7–13). All fragments in (b) have been reduced in size by 3 bp relative to those fragments in (a), with the exception of allele 1 in samples E and G.

 
We searched for the reported Arg264Cys (9,1618) polymorphism in exon 7 by sequencing in 17 breast cancer samples (34 alleles), to look for the C->T change. No such polymorphism was found in these samples (i.e. we observed a Cys allele frequency of 0; exact 95% CI 0–8%). However, in the same PCR fragment, a novel G->T change in intron 6 (Figure 2Go), 105 bp upstream from exon 7, was observed with a T allele frequency of 0.45. This change creates a SSCP. From sequence analysis of intron 6, an extra adenine base (cagAtca, Figure 2Go) was also found 89 bp upstream of exon 7 that was missing from the published sequence (GenBank/EMBL accession no. J05105). This was universally present (i.e. not polymorphic) in our population sample.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 2. Sequence showing the G->T polymorphism and the additional adenine base in intron 6 of the CYP19 gene.

 
Linkage disequilibrium
In order to establish linkage disequilibrium between the [TTTA]n tract and the TCT Ins/Del polymorphism, the relative sizes of the bands from the two PCR fragments including and excluding the TCT (PolyF and PolyR versus I4F and I4R, respectively) were compared. Any haplotype with the TCT deletion stayed in the same relative position (Figure 1a and bGo, lanes E and G), while haplotypes without the deletion decreased in relative size by 3 bp (e.g. Figure 1a and bGo, lanes E and F). There is strong linkage disequilibrium between TCT Ins/Del and the [TTTA]n tract ({Delta} = 0.764, 95% CI 0.735–0.790), with allelic association between the TCT deletion allele and [TTTA]7. Similarly, there is also strong linkage disequilibrium between the intron 6 G->T polymorphism and the [TTTA]n tract ({Delta} = 0.964, 95% CI 0.955–0.971), such that three common haplotypes account for 98% of all haplotypes seen (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. Common haplotypes, in normal controls, of the three polymorphic sites: the TCT Ins/Del and [TTTA]n repeat in intron 4 and the intron 6 G->T
 
Association with breast cancer
Each polymorphism has been examined for any association with an increased risk of breast cancer. For the [TTTA]n polymorphism we compared allele frequencies between cases and controls to look for any association with breast cancer risk and no significant differences were observed (Table IGo). Logistic regression was used to compare the trend in [TTTA]n genotype distribution (mean repeat length of an individuals two alleles) between cases and controls: none is apparent for each extra repeat carried (OR 1.02, 95% CI 0.97–1.07). In addition, genotype distributions between cases and controls for the intron 4 TCT Ins/Del and the intron 6 G->T polymorphisms were compared. No significant difference between the cases and controls was observed for any genotype in either polymorphism (Tables III and IVGoGo).


View this table:
[in this window]
[in a new window]
 
Table III. CYP19 intron 4 TCT insertion/deletion genotypes in cases and controls
 

View this table:
[in this window]
[in a new window]
 
Table IV. CYP19 intron 6 G->T polymorphism genotypes in cases and controls
 
We particularly looked at the TTTA repeat alleles reported to have an association with increased risk of breast cancer, namely the [TTTA]12 allele carriers (19), the [TTTA]n allele 2 (21) and the [TTTA]10 allele (20); none of these associations were apparent in our population.

Four studies have now reported on the CYP19 TTTA repeat alleles. We have performed a meta-analysis on the combined results. There is borderline evidence that the [TTTA]12 carriers (19) and [TTTA]n allele 2 (21) have an increased risk of breast cancer associated with them, although neither is significant (OR 1.26, 95% CI 0.91–1.74, and OR 1.23, 95% CI 0.99–1.52, respectively). The [TTTA]10 allele, on the other hand, shows a significantly positive association with breast cancer (OR 2.31, 95% CI 1.35–4.10), although there is some evidence for heterogeneity, i.e. the ORs are different in each study (P = 0.07). However, the observed numbers of this allele are very small, only 18 were seen in 2892 controls (0.6%) in the three studies combined, so some of the variation could be due to small sample size.

As the synthesis of oestrogens in post-menopausal women occurs principally in the adipose tissue, variation in aromatase activity in this subset of women may be of greater importance to breast cancer risk. Hence, we examined the effects of CYP19 genotype on breast cancer risk in post-menopausal cases (defined as women >55 years old) and controls, but still no association was observed.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Given that oestrogens affect breast cancer risk and breast tissue growth, an attractive hypothesis is that variants in the CYP19 gene which alter the ability of the enzyme to convert androgens to oestrogens might affect breast cancer risk.

There has been only one polymorphism in the CYP19 gene found to date which results in an amino acid change, the exon 7 Arg264Cys substitution (9,1618,21). This has been shown to have no effect on breast cancer risk in the Japanese population (18). We cannot find the Cys allele of the Arg264Cys polymorphism and, in agreement with Sourdaine et al. (17), can conclude that it does not have a frequency of >8% in the British population. Our population sample size did not give us the power to look at low frequency alleles with low penetrance, hence no further studies were carried out on this polymorphism. None of the other reported polymorphisms alter the coding region of the gene: a silent G276A (Val80) in exon 3 (17); a C1558T in the non-coding region of exon 10 (17); a TTTA repeat in intron 4 (15); and numerous other intronic changes (21). Hence, these polymorphisms are unlikely to have a direct effect on the activity of aromatase, although Kristensen et al. (19) have postulated a role for the intron 4 [TTTA]n polymorphism in differential RNA splicing. Thus far, no common variant of the CYP19 gene has been reported which demonstrably affects its activity.

We have demonstrated linkage disequilibrium between two polymorphisms in intron 4 and one in intron 6 of the gene: the three polymorphisms generate only three common haplotypes. We can see no association of breast cancer risk with any markers in these haplotypes. However, in a very recent paper, Siegelmann-Danieli and Buetow (21) report two polymorphisms 5' of exon I.1. It is not certain if these are in functional domains, but from the limited data presented, they do not appear to be in strong linkage disequilibrium with the [TTTA]n repeat. This indicates that linkage disequilibrium does not extend across the entire gene and so from our present study we cannot exclude variations at the 5'-end of the gene from altering breast cancer risk. So far, there have been no polymorphisms identified in the various forms of exon I or their promoters; if there were, these would be worth further study, particularly if they affect the exons or promoters used in mammary adipose tissue or ovaries (25,26).

We were unable to replicate the results of Kristensen et al. (19) for the [TTTA]12 allele in our sample or those of Siegelmann-Daneili and Buetow (21) for [TTTA] allele 2 or Haiman for the [TTTA]10 allele (20). Furthermore, there was no difference in the allele distribution or genotype distribution between cases and controls for any of the polymorphisms studied.

Only the [TTTA]10 allele showed a significant association in the meta-analysis, but it is very rare, with a carrier frequency of 1.2% (allele frequency 0.6%) and the functional significance is not apparent. In terms of public health, this allele would have no great effect; the population attributable risk of breast cancer due to this allele is calculated to be 1.57% (95% CI 0.43–3.65%). However, this result may point to the TTTA repeat having a function in itself, as Kristensen et al. (19) has suggested.

Although we were unable to find an association of these CYP19 gene polymorphisms with breast cancer risk in this unselected British population of breast cancer cases under the age of 65, it remains plausible that common variants in the CYP19 gene may exist which have an effect on the expression or activity of Cyp19 in certain tissues. These could, in turn, alter levels of oestrogen metabolites and affect breast cancer risk in particular subsets of females. More detailed epidemiological studies are required to test these possibilities.


    Acknowledgments
 
We would like to thank Victoria Basham, Joanna Dearden, Nicola Foster, Jane Gregory, Patricia Harrington, Carol Houghton, Julian Lipscombe, Simon McBride, Carole Pye, Karen Redmond, Paul Russell and the EPIC management team (Sheila Bingham, Nick Day, Kay-Tee Khaw and Suzy Oakes) for access to and preparation of the patient and control DNA samples. We would also like to thank Susan Ramus for valuable discussions. This work was funded by the Cancer Research Campaign (CRC). B.A.J.P. is a CRC Gibb Fellow. F.D. is a Hitchings-Elion Fellow of the Burroughs-Wellcome Fund.


    Notes
 
3 To whom correspondence should be addressed Email: katie.healey{at}srl.cam.ac.uk

Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Claus,E.B., Risch,N. and Thompson,W.D. (1991) Genetic analysis of breast cancer in the Cancer and Steroid Hormone Study. Am. J. Hum. Genet., 48, 232–242.[Web of Science][Medline]
  2. Ford,D. and Easton,D.F. (1995) The genetics of breast and ovarian cancer. Br. J. Cancer, 72, 805–812.[Web of Science][Medline]
  3. Pike,M.C., Spicer,D.V., Dahmoush,L. and Press,M.F. (1993) Estrogens, progestogens, normal breast cell proliferation and breast cancer risk. Epidemiol. Rev., 15, 17–35.[Free Full Text]
  4. Henderson,B.E. and Bernstein,L. (1996) Endogenous and exogenous hormone factors. In Harris,J.R. (ed), Diseases and the Breast. Lippincott-Raven, Philidelphia, PA, pp. 185–200.
  5. Toniolo,P.G., Levitz,M., Zeleniuch-Jacquotte,A., Banerjee,S., Koenig,K.L., Shore,R.E., Strax,P. and Pastenack,B.A. (1995) A prospective study of endogenous estrogens and breast cancer in postmenopausal women. J. Natl Cancer Inst., 87, 190–197.[Abstract/Free Full Text]
  6. O'Neill,J.S., Elton,R.A. and Miller,W.R. (1988) Aromatase activity in adipose tissue from breast quadrants: a link with tumour site. Br. Med. J., 296, 741–743.
  7. Bulun,S.E., Price,T.M., Mahendroo,M.S., Aitken,J. and Simpson,E.R. (1993) A link between breast cancer and local estrogen biosynthesis suggested by quantification of breast adipose tissue aromatase cytochrome P450 transcripts using competitive polymerase chain reaction after reverse transcription. J. Clin. Endocrinol. Metab., 77, 1622–1628.[Abstract]
  8. Bulun,S.E. and Simpson,E.R. (1994) Regulation of the CYP19 (P450arom) gene expression in breast adipose tissue and breast cancer. Trends Endocrinol. Metab., 5, 113–120.
  9. Corbin,C.J., Graham-Lorence,S., McPhaul,M., Manson,J.I., Mendelson, C.R. and Simpson,E.R. (1988) Isolation of a full-length cDNA insert encoding human aromatase system cytochrome P-450 and its expression in nonsteroidogenic cells. Proc. Natl Acad. Sci. USA, 85, 8948–8952.[Abstract/Free Full Text]
  10. Bershtein,L.M. (1997) Molecular-genetic aspects of estrogen production. Aromatase gene. Mol. Biol., 31, 655–659.
  11. Harada,N., Ogawa,H., Shozu,M. and Yamada,K. (1992) Genetic studies to characterize the origin of the mutation in placental aromatase deficiency. Am. J. Hum. Genet., 51, 666–672.[Web of Science][Medline]
  12. Ito,Y., Fisher,C.R., Conte,F.A., Grumbach,M.M. and Simpson,E.R. (1993) Molecular basis of aromatase deficiency in an adult female with sexual infantilism and polycystic ovaries. Proc. Natl Acad. Sci. USA, 90, 11673–11677.[Abstract/Free Full Text]
  13. Morishima,A., Grumbach,M.M., Simpson,E.R., Fisher,C. and Qin,K. (1995) Aromatase deficiency in male and female siblings caused by a novel mutation and the physiological role of estrogens. J. Clin. Endocrinol. Metab., 80, 3689–3698.[Abstract]
  14. Mullis,P.E., Yoshimura,N., Kuhlmann,B., Lippuner,K., Jaeger,P. and Harada,H. (1997) Aromatase deficiency in a female who is compound heterozygote for two new point mutations in the P450 arom gene: impact of estrogens on hypergonadotrophic hypogonadism, multicystic ovaries, and bone densitometry in childhood. J. Clin. Endocrinol. Metab., 82, 1739–1745.[Abstract/Free Full Text]
  15. Polymeropoulos,M.H., Xiao,H., Rath,D.S. and Merril,C.R. (1991) Tetranucleotide repeat polymorphism at the human aromatase cytochrome P-450 gene (CYP19). Nucleic Acids Res., 19, 195.[Free Full Text]
  16. Means,G.D., Mahendroo,M.S., Corbin,C.J., Mathis,J.M., Powell,F.E., Mendelson,C.R. and Simpson,E.R. (1989) Structural analysis of the gene encoding human aromatase cytochrome P-450, the enzyme responsible for estrogen biosynthesis. J. Biol. Chem., 264, 19385–19391.[Abstract/Free Full Text]
  17. Sourdaine,P., Parker,M.G., Telford,J. and Miller,W.R. (1994) Analysis of the aromatase cytochrome P450 gene in human breast cancers. J. Mol. Endocrinol., 13, 331–337.[Abstract/Free Full Text]
  18. Watanabe,J., Harada,N., Suemasu,K., Higashi,Y., Gotoh,O. and Kawajiri,K. (1997) Arginine-cysteine polymorphism at codon 264 of the human CYP19 gene does not affect aromatase activity. Pharmacogenetics, 7, 419–424.[Web of Science][Medline]
  19. Kristensen,V.N., Andersen,T.I., Lindblom,A., Erikstein,B., Magnus,P. and Borresen-Dale,A.-L. (1998) A rare CYP19 (aromatase) variant may increase the risk of breast cancer. Pharmacogenetics, 8, 43–48.[Web of Science][Medline]
  20. Haiman,C.A., Hankinson,S.E., Speizer,F.E. and Hunter,D.J. (1999) A tetranucleotide repeat polymorphism in CYP19 and breast cancer risk. Proc. Am. Assoc. Cancer Res., 40, A.1290.
  21. Siegelmann-Danieli,N. and Buetow,K.H. (1999) Constitutional genetic variation at the human aromatase gene (CYP19) and breast cancer. Br. J. Cancer, 79, 456–463.[Web of Science][Medline]
  22. Day,N., Oakes,S., Luben,R., Khaw,K.-T., Bingham,S., Welch,A. and Wareham,N. (1999) EPIC in Norfolk: study design and characteristics of the cohort. Br. J. Cancer, 80, 95–103.
  23. Chakravarti,A., Buetow,K.H., Antonarakis,S.E., Waber,P.G., Boehm,C.D. and Kazazian,H.H. (1984) Nonuniform recombination within the human ß-globin gene cluster. Am. J. Hum. Genet., 36, 1239–1258.[Web of Science][Medline]
  24. Kurosaki,K., Saitoh,H., Oota,H., Watanabe,Y., Kiuchi,M. and Ueda,S. (1997) Combined polymorphism associated with a 3-bp deletion in the 5'-flanking region of a tetrameric short tandem repeat at the CYP19 locus. Jpn. J. Legal Med., 51, 191–195.
  25. Mahendroo,M.S., Mendelson,C.R. and Simpsom,E.R. (1993) Tissue-specific and hormonally-controlled alternative promoters regulate aromatase cytochrome P450 gene expression in human adipose tissue. J. Biol. Chem., 268, 19463–19470.[Abstract/Free Full Text]
  26. Agarwal,V.R., Bulun,S.E., Leitch,M., Rohrich,R. and Simpson,E.R. (1996) Use of alternative promoters to express the aromatase cytochrome P450 (CYP19) gene in breast adipose tissues of cancer-free and breast cancer patients. J. Clin. Endocrinol. Metab., 81, 3843–3849.[Abstract/Free Full Text]
Received July 1, 1999; accepted September 23, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
L. Raskin, F. Lejbkowicz, O. Barnett-Griness, S. Dishon, R. Almog, and G. Rennert
BRCA1 Breast Cancer Risk Is Modified by CYP19 Polymorphisms in Ashkenazi Jews
Cancer Epidemiol. Biomarkers Prev., May 1, 2009; 18(5): 1617 - 1623.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. L. Cote, W. Yoo, A. S. Wenzlaff, G. M. Prysak, S. K. Santer, G. B. Claeys, A. L. Van Dyke, S. J. Land, and A. G. Schwartz
Tobacco and estrogen metabolic polymorphisms and risk of non-small cell lung cancer in women
Carcinogenesis, April 1, 2009; 30(4): 626 - 635.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Chen, L. C. Sakoda, J. A. Doherty, M. M. Loomis, S. Fish, R. M. Ray, M. G. Lin, W. Fan, L. P. Zhao, D. L. Gao, et al.
Genetic Variation in CYP19A1 and Risk of Breast Cancer and Fibrocystic Breast Conditions among Women in Shanghai, China
Cancer Epidemiol. Biomarkers Prev., December 1, 2008; 17(12): 3457 - 3466.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
Q. Cai, N. Kataoka, C. Li, W. Wen, J. R. Smith, Y.-T. Gao, X. O. Shu, and W. Zheng
Haplotype Analyses of CYP19A1 Gene Variants and Breast Cancer Risk: Results from the Shanghai Breast Cancer Study
Cancer Epidemiol. Biomarkers Prev., January 1, 2008; 17(1): 27 - 32.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. A. Haiman, L. Dossus, V. W. Setiawan, D. O. Stram, A. M. Dunning, G. Thomas, M. J. Thun, D. Albanes, D. Altshuler, E. Ardanaz, et al.
Genetic Variation at the CYP19A1 Locus Predicts Circulating Estrogen Levels but not Breast Cancer Risk in Postmenopausal Women
Cancer Res., March 1, 2007; 67(5): 1893 - 1897.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
S. H. Olson, E. V. Bandera, and I. Orlow
Variants in Estrogen Biosynthesis Genes, Sex Steroid Hormone Levels, and Endometrial Cancer: A HuGE Review
Am. J. Epidemiol., February 1, 2007; 165(3): 235 - 245.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
I. M. Dick, A. Devine, and R. L. Prince
Association of an aromatase TTTA repeat polymorphism with circulating estrogen, bone structure, and biochemistry in older women
Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E989 - E995.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
B. K. Dunn, D. L. Wickerham, and L. G. Ford
Prevention of Hormone-Related Cancers: Breast Cancer
J. Clin. Oncol., January 10, 2005; 23(2): 357 - 367.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Gennari, R. Nuti, and J. P. Bilezikian
Aromatase Activity and Bone Homeostasis in Men
J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 5898 - 5907.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
K. Hirose, K. Matsuo, T. Toyama, H. Iwata, N. Hamajima, and K. Tajima
The CYP19 Gene Codon 39 Trp/Arg Polymorphism Increases Breast Cancer Risk in Subsets of Premenopausal Japanese
Cancer Epidemiol. Biomarkers Prev., August 1, 2004; 13(8): 1407 - 1411.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
A. M. Dunning, M. Dowsett, C. S. Healey, L. Tee, R. N. Luben, E. Folkerd, K. L. Novik, L. Kelemen, S. Ogata, P. D. P. Pharoah, et al.
Polymorphisms Associated With Circulating Sex Hormone Levels in Postmenopausal Women
J Natl Cancer Inst, June 16, 2004; 96(12): 936 - 945.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. A. Haiman, D. O. Stram, M. C. Pike, L. N. Kolonel, N. P. Burtt, D. Altshuler, J. Hirschhorn, and B. E. Henderson
A comprehensive haplotype analysis of CYP19 and breast cancer risk: the Multiethnic Cohort
Hum. Mol. Genet., October 16, 2003; 12(20): 2679 - 2692.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. L. Goode, A. M. Dunning, B. Kuschel, C. S. Healey, N. E. Day, B. A. J. Ponder, D. F. Easton, and P. P. D. Pharoah
Effect of Germ-Line Genetic Variation on Breast Cancer Survival in a Population-based Study
Cancer Res., June 1, 2002; 62(11): 3052 - 3057.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
N. Kado, J. Kitawaki, H. Obayashi, H. Ishihara, H. Koshiba, I. Kusuki, K. Tsukamoto, G. Hasegawa, N. Nakamura, T. Yoshikawa, et al.
Association of the CYP17 gene and CYP19 gene polymorphisms with risk of endometriosis in Japanese women
Hum. Reprod., April 1, 2002; 17(4): 897 - 902.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M M de Jong, I M Nolte, G J te Meerman, W T A van der Graaf, J C Oosterwijk, J H Kleibeuker, M Schaapveld, and E G E de Vries
Genes other than BRCA1 and BRCA2 involved in breast cancer susceptibility
J. Med. Genet., April 1, 2002; 39(4): 225 - 242.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Shen, E. M. Sturgis, S. G. Khan, Y. Qiao, T. Shahlavi, S. A. Eicher, Y. Xu, X. Wang, S. S. Strom, M. R. Spitz, et al.
An Intronic Poly (AT) Polymorphism of the DNA Repair Gene XPC and Risk of Squamous Cell Carcinoma of the Head and Neck: A Case-Control Study
Cancer Res., April 1, 2001; 61(8): 3321 - 3325.
[Abstract] [Full Text]


Home page
CarcinogenesisHome page
S.W. Baxter, D.Y.H. Choong, D.M. Eccles, and I.G. Campbell
Polymorphic variation in CYP19 and the risk of breast cancer
Carcinogenesis, February 1, 2001; 22(2): 347 - 349.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (50)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Healey, C. S.
Right arrow Articles by Ponder, B. A.J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Healey, C. S.
Right arrow Articles by Ponder, B. A.J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?