Carcinogenesis, Vol. 21, No. 2, 281-287,
February 2000
© 2000 Oxford University Press
Carcinogenesis |
Transition mutation in codon 248 of the p53 tumor suppressor gene induced by reactive oxygen species and a nitric oxide-releasing compound
Institute of Pharmacology and Toxicology, Rue du Bugnon 27, 1005 Lausanne, Switzerland,
1 Swiss Institute for Experimental Cancer Research, 1066 Epalinges, Switzerland and
2 Chemistry Section, Laboratory of Comparative Carcinogenesis, National Cancer Institute, Frederick Cancer Research and Development Center, Frederick, MD 21702, USA
| Abstract |
|---|
|
|
|---|
Exposing the human bronchial epithelial cell line BEAS-2B to the nitric oxide (NO) donor sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate (DEA/NO) at an initial concentration of 0.6 mM while generating superoxide ion at the rate of 1 µM/min with the hypoxanthine/xanthine oxidase (HX/XO) system induced C:G
T:A transition mutations in codon 248 of the p53 gene. This pattern of mutagenicity was not seen by `fish-restriction fragment length polymorphism/polymerase chain reaction' (fish-RFLP/PCR) on exposure to DEA/NO alone, however, exposure to HX/XO led to various mutations, suggesting that co-generation of NO and superoxide was responsible for inducing the observed point mutation. DEA/NO potentiated the ability of HX/XO to induce lipid peroxidation as well as DNA single- and double-strand breaks under these conditions, while 0.6 mM DEA/NO in the absence of HX/XO had no significant effect on these parameters. The results show that a point mutation seen at high frequency in certain common human tumors can be induced by simultaneous exposure to reactive oxygen species and a NO source.
Abbreviations: DEA/NO, sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate; DHR 123, dihydrorhodamine 123; ENU, ethylnitrosourea; fish-RFLP/PCR, `fish-restriction fragment length polymorphism/polymerase chain reaction'; HPO, hydroperoxides; HX, hypoxanthine; iNOS, inducible nitric oxide synthase; MDA, malondialdehyde; NO, nitric oxide; NOS, nitric oxide synthases; RH 123, rhodamine 123; ROS, reactive oxygen species; SOD, superoxide dismutase; XO, xanthine oxidase.
| Introduction |
|---|
|
|
|---|
Nitric oxide (NO) is produced by nitric oxide synthases (NOS), which catalyze the conversion of arginine to citrulline (1). The physiological effects of NO are characterized by their apparent dichotomy: in some cases it is a regulatory molecule, whereas in others it has toxic effects (2,3). During inflammation, simultaneous production of reactive oxygen species (ROS) and NO has been proposed to play a part in cytotoxicity, given that NO and superoxide (O2) can rapidly interact to form the strong oxidant peroxynitrite (ONOO) (k = 6.7x109/M/s) (4,5). Such species seem to be implicated in bactericidal and tumoricidal properties of activated macrophages (69).
In addition, clinical studies have shown that inducible nitric oxide synthase (iNOS) activity is increased in certain human diseases, such as colon cancer (10), ulcerative colitis and Crohn's disease (11). However, it is not yet known which role NO plays in the development of these pathologies. Nevertheless, chronic inflammation, such as due to Helicobacter pylori infection, liver fluke infection and ulcerative colitis, has been implicated in carcinogenesis (1214).
In chronic inflammation, epithelial cells are potential targets of the reactive species produced by the inflammatory cells. Therefore, we studied the effects of ROS and NO on human epithelial cells, using the NO donor sodium 1-(N,N-diethylamino)diazen-1-ium-1,2-diolate (DEA/NO) and the superoxide/hydrogen peroxide-producing system hypoxanthine (HX)/xanthine oxidase (XO) (15). The interaction between ROS and NO was characterized by determination of super- oxide and urate production, soluble guanylyl cyclase stimulation and dihydrorhodamine oxidation. The biological effects of our system were described by measuring lipid peroxidation, DNA fragmentation and mutagenesis, which are ROS-induced cellular effects (1620).
Here we provide evidence that, in contrast to our observations with DEA/NO alone (21), co-generation of NO and superoxide can induce mutations (specifically C:G
T:A transitions at position 1 of codon 248) in the p53 gene of human cells in culture.
| Materials and methods |
|---|
|
|
|---|
Cell line
The biological experiments were performed using BEAS-2B cells, a human bronchial epithelial cell line transformed by SV40 large T antigen (22). They were cultured in LHC-8 serum-free medium (23) (Biofluids, Rockville, MD) in an atmosphere containing 3.5% CO2 at 37°C in dishes coated with 10 µg/ml human plasma fibronectin (Upstate Biotechnology, Lake Placid, NY), 20 µg/ml bovine serum albumin (Sigma, St Louis, MO) and 20 µg/ml collagen (Vitrogen 100; Celtrix, Santa Clara, CA).
Cell treatment
The effects of ROS were studied using the HX/XO system at the following concentrations: 300 µM HX (Sigma) and 0.006 U/ml bovine XO (Roche Molecular Biochemicals, Rotkreuz, Switzerland). The reversion of HX/XO-induced cytotoxicity by addition of 78 U/ml bovine catalase (Roche Molecular Biochemicals) and 30 U/ml human superoxide dismutase (SOD) proved that the observed effects were due to ROS.
The effects of NO were investigated using the NO donor DEA/NO (Chemical Abstracts Registry no. 92382-74-6), which releases 1.5 molecules of NO per DEA/NO anion when dissolved in aqueous medium. It is a member of the diazeniumdiolate (or NONOate) family, stable compounds in alkaline solution which have the property to release NO at pH 7.4 without any additional activation (24).
DEA/NO decomposition measurement
The decomposition of the NO donor DEA/NO in LHC-8 medium was followed spectrophotometrically at 250 nm (
250 nm = 6.5/mM/cm) (25), using a Beckman DU-64 spectrophotometer.
Xanthine oxidase activity estimation
The XO activity, and thus the efficiency of the ROS-producing system, was estimated using two products of the HX/XO system, superoxide and urate (26). Standard conditions in all of the experiments reported here employed initial concentrations of 300 µM HX and 6 mU/ml XO. Superoxide production was followed spectrophotometrically measuring horse ferricytochrome c (Sigma) reduction to ferrocytochrome c at 550 nm (
550 nm = 21/mM/cm) (27,28) in the absence or presence of bovine SOD (Roche Molecular Biochemicals, Mannheim, Germany) in order to determine the superoxide-specific reduction of cytochrome c. This assay was carried out in the presence of 20 mM ferricytochrome c. Urate formation was monitored by UV absorbance at 305 nm, in the absence or presence of porcine uricase (Roche Molecular Biochemicals) to determine the uric acid-specific absorbance. These assays were performed in cell-free culture medium at 37°C, using a Beckman DU-64 spectrophotometer.
Soluble guanylyl cyclase stimulation assessment
In order to determine the fate of NO in the presence of oxygen radicals, we studied the stimulation of soluble guanylyl cyclase. cGMP accumulation was measured after cells were exposed to DEA/NO, in the absence or presence of HX/XO, using a radioimmunoassay (29). BEAS-2B cells were plated in 12-well dishes (100 000 cells/well) and exposed for 10 min to 5 µM DEA/NO ± HX/XO, in the presence of 0.5 mM isobutylmethylxanthine (Calbiochem, La Jolla, CA). The treatment was stopped by addition of cold ethanol (20°C, final concentration 66%). The cells were then collected, frozen in liquid nitrogen and evaporated to dryness under vacuum. The pellet was resuspended in 250 µl of 50 mM sodium acetate buffer (pH 4), acetylated for 10 min with acetic anhydride/triethylamine (2:1, 5 µl per 100 µl buffer) and tested for cGMP using anti-cGMP antibodies (Meloy Laboratories, Springfield, VA).
Dihydrorhodamine 123 oxidation
The oxidation of dihydrorhodamine 123 (DHR 123) to rhodamine 123 (RH 123) was followed spectrophotometrically at 501 nm (
501 nm = 78.78/mM/cm) (30,31). DEA/NO and HX/XO ± DEA/NO were assayed in 1 ml of LHC-8 medium containing 50 µM DHR 123 and 100 µM diethylenetriaminepentaacetic acid at 37°C using a Beckman DU-64 spectrophotometer.
Mutation detection
The mutagenicity of our system was investigated using the previously described `fish-restriction fragment length polymorphism/polymerase chain reaction' (fish-RFLP/PCR) method (21) to detect mutations within codon 248 (CGG) of the p53 tumor suppressor gene, which has been described as a preferential target in many human tumors (32). BEAS-2B cells were grown to 60% confluence and treated with HX/XO ± DEA/NO for 24 h; as a positive control, they were exposed for 20 min to 4 mM ethylnitrosourea (ENU), which has been shown to induce G
A transitions within codon 248 of the p53 gene (21). The cells were harvested 72 h later. The genomic DNA was extracted, purified and submitted to the fish-RFLP/PCR method as previously described (21). Briefly, a DNA aliquot of 200 µg was denatured in 0.2 M NaOH (5 min at 65°C), then the solution was neutralized by simultaneous addition of 0.2 M HCl and 100 mM HEPES (pH 7.4). Then SP6-biotinylated exon VII antisense RNA was added at a final concentration of 0.08 mg/ml. SP6 exon VII antisense RNA was synthesized from plasmid pSP72-X7, in which the entire exon VII of p53 (110 bp) has been inserted into pSP72 (Promega, Madison, WI). Hybridizations were carried out for 16 h (65°C) then 5 ml of streptavidinagarose (Sigma) was added. The mixture was incubated for 45 min at room temperature. Agarose beads were spun in a microfuge and washed with 10 mM HEPES (pH 7.4) containing 1 mM EDTA. Purified genomic DNA was eluted in 0.2 M NaOH to hydrolyze the RNA. After neutralization with 100 mM Tris (pH 7.4) plus 0.2 M HCl and addition of yeast tRNA (0.5 mg/ml), the samples were phenol extracted and precipitated in silanized tubes with 3 vol ethanol. The purified DNA was resuspended in 10 mM Tris (pH 9), 3 mM MgCl2 and 0.3 mM deoxynucleotide triphosphate (dNTP) containing CTTGCCACAGGTCTCCCCAA and ACGTGGATCCAGGGGTCAGCGGCAAGCAGA (0.4 mM) as 5' and 3' primers, respectively, and amplified for five cycles (94°C for 30 s, 60°C for 1 min and 78°C for 30 s) using 0.5 U of Pfu polymerase (Stratagene, La Jolla, CA). The samples were then digested with MspI (30 min at 37°C). This PCR/restriction step was repeated once again and the samples were amplified for 20 cycles under the same conditions as described above. Following a third digestion with MspI the samples were amplified for 25 cycles using ACGTGAATTCGTTGGCTCTGACTGTACCAC and TGTGCAGGGTGGCAAGTGGC as 5' and 3' primers, respectively. The 146 bp fragment obtained was purified after electrophoresis on agarose gel and sequenced using exo Pfu (Stratagene) following the manufacturer's instructions.
Cell survival after HX/XO + DEA/NO exposure was 60%. Since incubation of the cells with spent HX/XO + DEA/NO resulted in no cytotoxic effect, mutagenesis was not investigated under this condition.
DNA fragmentation analysis
Cells treated at 60% confluence for 24 h were tested for DNA single-strand fragmentation using the alkaline unwinding method (33,34), which is based on the partial denaturation of DNA containing single-strand breaks.
DNA double-strand breakage was studied using a Cellular DNA Fragmentation ELISA kit (Roche Molecular Biochemicals) according to the manufacturer's instructions.
Lipid peroxidation evaluation
The level of lipid peroxidation was determined using a colorimetric assay (Lipid Peroxidation Assay Kit; Calbiochem) to detect malondialdehyde (MDA) and hydroperoxides (HPO), which are degradation products of lipid peroxides. Cells were treated for 24 h when 60% confluent. Under such conditions, <10% cytotoxicity was found. After treatment, the cells were pelleted by centrifugation, washed with phosphate-buffered saline and resuspended in 20 mM TrisHCl (pH 7.5). Following lysis by freezing/thawing, cellular extracts were tested for lipid peroxidation and protein content (BCA Protein Assay; Pierce, Rockford, IL). The peroxidation assay was performed following the manufacturer's instructions, in the presence of 1% Lubrol (ICN, Costa Mesa, CA).
| Results |
|---|
|
|
|---|
NO/ROS interaction
In order to verify the efficiency of the ROS-producing system, XO activity was estimated using two products of the HX/XO system, superoxide and urate (26). As expected, an increased reduction of cytochrome c was observed in the presence of HX/XO (Figure 1A
|
|
Mutagenesis
The fish-RFLP/PCR technique developed to detect mutations in codon 248 of the p53 gene is based on two-step enrichment of a mutant target. In the first step the target gene is extracted from total genomic DNA and in the second the mutated sequence is amplified by coupled RFLP/PCR. This allows the detection of mutants from a large amount of DNA that would not fit in a standard PCR assay. The sensitivity of the assay is 1 base in 106 (21). The short period of cell growth before collection (72 h) does not allow clonal expansion of cells expressing mutated p53 since one cell division occurs.
To test whether ROS and NO were able to induce mutations in codon 248 of the p53 gene, we applied the fish-RFLP/PCR protocol to DNA samples obtained from BEAS-2B cells exposed to HX/XO + DEA/NO. In these samples, a C
T transition was detected (Figure 2
).
|
Various mutations in codon 248 of the p53 gene, including C
T, G
A and, to a lesser extent, G
C were observed in BEAS-2B cells treated with HX/XO. On the other hand, DEA/NO itself was shown (21) to be non-mutagenic for these cells, even at an initial concentration of 4 mM.
Induced G:C
A:T mutations of the non-coding strand could be observed in cells treated with 4 mM ENU (Figure 2
), suggesting that mutations result from ethylation of the guanine followed by replication as previously described (21).
DNA fragmentation
To further investigate the interaction between ROS and NO, we measured DNA fragmentation. The HX/XO treatment resulted in an ~17% increase in DNA single-strand breaks versus control cells (Figure 3A
). The addition of DEA/NO significantly enhanced (P < 0.05, n = 412) HX/XO-induced breakage, although DEA/NO did not induce DNA single-strand breaks by itself (Figure 3A
).
|
Consistent with the single-strand breakage results, HX/XO treatment led to an ~1.5-fold increase in DNA double-strand breaks versus control cells, which could be significantly (P < 0.01, n = 1216) enhanced ~2.5-fold by addition of DEA/NO (Figure 3B
Lipid peroxidation
Lipid peroxidation is a well-known effect of ROS. Accordingly, the level of lipid peroxide metabolites (MDA and HPO) was increased ~1.25-fold when the cells were treated with HX/XO (Figure 4
). The addition of DEA/NO resulted in a dose-dependent increase in the HX/XO effect, while DEA/NO alone had no effect per se (Figure 4
). The basal level of MDA + HPO found in our cells was 0.99 ± 0.67 nmol/mg protein (mean ± SD, n = 30), which is consistent with values obtained in other studies (3537).
|
| Discussion |
|---|
|
|
|---|
Nitric oxide is a key regulatory molecule which mediates many physiological processes, such as vasodilation, bronchodilation, neurotransmission and platelet aggregation (2). It is also a well-known toxic agent as well as a constituent of air pollution and cigarette smoke. Endogenous NO seems to be implicated in some human diseases, such as atherosclerosis (38), neurodegenerative diseases and cancer (39). In particular, NO takes part in chronic inflammation. Indeed, NO is produced by the immune system to kill microorganisms (7) and tumor cells (40), but it is not the only macrophage-derived effector molecule. In fact, both NO and ROS are produced during inflammatory processes (41,42). We tried to characterize the effects of these reactive species when simultaneously present. To that end we used the established ROS-producing system HX/XO (16,26,43) together with the NO donor DEA/NO (24,25). Inhibition of HX/XO-induced cytochrome c reduction by addition of DEA/NO and abrogation by HX/XO of DEA/NO-induced guanylyl cyclase stimulation show that, under our conditions, NO and superoxide interacted, resulting in decreased availability of each radical. The increased DHR oxidation obtained in the presence of HX/XO + DEA/NO suggests that a reactive nitrogen species, possibly peroxynitrite, a derivative of nitric oxide and superoxide, was formed.
It has been previously shown that DEA/NO is able to protect Chinese hamster V79 cells against HX/XO- and H2O2-induced cytotoxicity (26), whereas it potentiates this ROS-mediated toxicity in Escherichia coli cells (44). Under our conditions, we found that NO, although not toxic per se, could dramatically increase ROS-induced lipid peroxidation and DNA fragmentation and that simultaneous exposure to HX/XO and DEA/NO leads to a C:G
T:A transition in the first base of codon 248 of the p53 gene. This mutation induces an amino acid change (Arg
Trp) abolishing the wild-type function of p53 (45). C:G
T:A is consistent with 5-methylcytosine deamination (46,47), since we have already demonstrated that the cytosine in codon 248 is methylated (21). C
T mutations can also result from etheno-cytosine adduct formation (48) and a recent study showed that this is the major etheno-adduct formed in mice stimulated to overproduce NO (49). Etheno-adducts derive from lipid peroxidation products and we found C
T mutations under experimental conditions where increased lipid peroxidation was detected. Interestingly, two-thirds of all mutations found when plasmid pSP189 DNA was exposed to peroxynitrite and then allowed to replicate were G
T transversions, but of the C
T transitions observed in that experiment more than half were at cytosines preceded by another cytosine or followed by a guanine (50). The mutagenic effect of simultaneous exposure to HX/XO and NO observed in the p53 tumor suppressor gene of BEAS-2B cells supports the view that NO may be a component of inflammation-induced carcinogenesis. Indeed, cells containing a non-functional tumor suppressor gene escape p53-mediated growth arrest and apoptosis which constitute the defense against DNA damage due to inflammation-induced oxidative stress. In addition, in human colorectal cancer, a positive correlation between the frequency of G:C
A:T transitions at CpG dinucleotide sites in the p53 gene and inducible nitric oxide synthase activity has been recently described (51).
C
T mutation was also observed, to a lower extent, in BEAS-2B cells treated with HX/XO alone but that was not the only mutation seen in codon 248 of the p53 gene under these conditions. G
A and G
C base substitutions were also observed. C
T and G
A may both arise from oxidative attack on 5-methylcytosine, which could produce thymine glycol residues (52). This residue is chemically stable and acts primarily as a block to replication. However, when by-passed by polymerase, it pairs with adenine inducing C:G
T:A transition mutations. In addition, G:C
A:T transitions are the most frequent mutations found after hydrogen peroxide (53) and Cu+ exposure (54). In vitro oxidation of DNA with hydrogen peroxide, Cu+ and ascorbate leads to a 430-fold increase in 5-hydroxy-2'-deoxycytidine (55), which has also been shown to induce C
T transition mutations (56). The G
C transversion observed in the second position of codon 248 has already been described in human fibroblasts exposed to hydrogen peroxide and FeCl3 (57). The addition of DEA/NO to HX/XO leads preferentially to C
T mutation and it is possible that NO increases the damage induced by oxidative attack on 5-methylcytosine (52), for example by limiting its repair.
To test the hypothesis that NO might serve as an endogenous mutagen, we developed a human cell system where NO was either endogenously produced or generated by DEA/NO (21). Using two different approaches, the fish-RFLP/PCR genotypic assay and a phenotypic mutation assay, we have shown that NO per se is not detectably a mutagen in cultured human bronchial cells (21). Similar results have been observed in another study where human iNOS cDNA was constitutively expressed in V79 Chinese hamster cells. Cells expressing iNOS had no increase in the frequency of hprt mutations compared with parental cells (58). In the present study, we have evidence that the interaction of NO and superoxide is able to induce mostly G:C
A:T mutations, while superoxide induces three different mutations. The mutant fraction can only be estimated based on the sensitivity of the system, whose detection limit is 1 base in 106 (21). We concluded that NO significantly increases C
T transitions in the first base of codon 248 of the p53 gene.
Several studies have attempted to define the `in vivo' role of NO in the mutagenesis process resulting from inflammation. To mimic inflammation conditions under which tissues are exposed to different reactive oxygen species released by inflammatory cells, stimulated macrophages have been co-cultured with cells expressing a ß-galactosidase reporter plasmid. These experiments demonstrated that inhibition of NOS decreases DNA damage (59). In addition, in a lacZ transgenic mouse model, developed to assess the mutagenic effect of inflammation, the lacZ gene mutation frequency due to inflammation was twice the mutation frequency observed in controls and such an increase was abolished by administration of the NOS inhibitor N-methyl-L-arginine (60), suggesting a role for NO in the mutagenesis process. In another recent study, an increased hprt mutation frequency dependent on iNOS activation was detected in macrophages stimulated to produce NO (61). Furthermore, NO exposure is mutagenic to Salmonella typhimurium TA1535 (46,62,63), where the major mutations found are C:G
T:A transitions.
On exposure of the cells to HX/XO and DEA/NO, C:G
T:A mutations could form by decreasing the endogenous defense provided by endogenous sulfhydryls, which are scavengers of nitrosating species. Indeed, NO alone has been shown to be mutagenic in TK6 cells (64); this may be due to the fact that TK6 cells have a low glutathione level (65) compared, for example, with NO-resistant V79 cells (66). On the other hand, in the presence of NO and O2 there may be formation of new reactive species. In stimulated macrophages, O2 precedes (67) or accompanies (68) NO formation and induced DNA damage can be totally suppressed by a NOS inhibitor, suggesting that only a NO metabolite is involved in genotoxicity. It had already been demonstrated that phagocytes from control patients, but not from granulomatous disease patients deficient in superoxide production, are mutagenic in Salmonella (69), indicating a role for superoxide. NO and O2 can rapidly interact to form the strong oxidant peroxynitrite (4,5). The latter was previously shown to induce lipid peroxidation (70), DNA damage (49,7177) and cell death (7,77,78). Nitric oxide, or rather its derivatives such as ONOO, has been implicated in many forms of DNA damage, such as base modifications and DNA strand breakage (79). Peroxynitrite or simultaneous production of superoxide and NO, either by SIN-1 or by activated macrophages, have been shown to induce DNA single-strand breaks (71,80). In our system, DEA/NO potentiated HX/XO-induced single-strand breakage. Different mechanisms may be responsible for this effect, including direct modification of DNA or inhibition of DNA repair enzymes (59,81). In addition to single-strand breaks, we observed DNA double-strand breakage in BEAS-2B cells treated with HX/XO + DEA/NO. This double-stranded fragmentation could result from single-strand breaks (59) or from activation of endonucleases during apoptosis. The latter phenomenon was observed in cells surrounding activated macrophages (82). It was reported that acute/intense exposure to ONOO induced cell necrosis, whereas mild/less severe exposure to this species induced apoptosis (77). Under our conditions, DNA fragments were found in both the cellular fraction and the supernatant (data not shown), suggesting that a necrotic phenomenon occurred, perhaps as a consequence of absence of phagocytosis of apoptotic cells, as proposed by others (78).
Finally, in our system, NO potentiated ROS-induced lipid peroxidation. We do not yet know the mechanism involved in this pro-oxidant activity of NO, although DEA/NO alone did not induce lipid peroxidation, suggesting that reaction with O2 was necessary. A possible explanation is the formation of H2O2 from ONOO resulting from the presence of HEPES in LHC-8 medium. Indeed, LHC-8 contains ~23 mM HEPES and this tertiary amine has been shown to interact with peroxynitrite, leading to formation of H2O2 (83). However, in the presence of 20 mM HEPES only 513% of the total peroxynitrite is converted into H2O2 (83,84), the other part remaining as reactive nitrogen/oxygen species. On the other hand, ONOO has been demonstrated to cause lipid peroxidation (70). DEA/NO-induced potentiation of lipid peroxidation could enhance DNA strand breakage since lipid peroxide derivatives were found to cause DNA single-strand breaks (85,86). In addition, peroxidation could lead to etheno-adducts which may lead to mutations (48) such as C:G
T:A, as observed in this study.
Altogether, our results suggest that NO may be a component of inflammation-induced carcinogenesis.
| Acknowledgments |
|---|
We are indebted to Prof. Steven Tannenbaum for helpful discussion and suggestions. This work was supported by the Swiss National Science Foundation (grant 31-49662.96), by Swiss Cancer Research (grant AKT 614) and by the Sandoz Foundation.
| Notes |
|---|
3 To whom correspondence should be addressed. Email: emanuela.felley-bosco{at}ipharm.unil.ch
| References |
|---|
|
|
|---|
- Knowles,R.G. and Moncada,S. (1994) Nitric oxide synthases in mammals. Biochem. J., 298, 249258.
- Moncada,S., Palmer,R.M.J. and Higgs,E.A. (1991) Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev., 43, 109142.[Web of Science][Medline]
- Wink,D.A., Hanbauer,I., Grisham,M.B., Laval,F., Nims,R.W., Laval,J., Cook,J., Pacelli,R., Liebmann,J., Krishna,M., Ford,P.C. and Mitchell,J.B. (1996) Chemical biology of nitric oxide: regulation and protective and toxic mechanisms. Curr. Top. Cell. Regul., 34, 159187.[Web of Science][Medline]
- Huie,R.E. and Padmaja,S. (1993) The reaction of NO with superoxide. Free Radic. Res. Commun., 18, 195199.[Web of Science][Medline]
-
Beckman,J.S. and Koppenol,W.H. (1996) Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and the ugly. Am. J. Physiol., 271, C1424C1437.
[Abstract/Free Full Text] - Hibbs,J.B.Jr, Taintor,R.R., Vavrin,Z. and Rachlin,E.M. (1988) Nitric oxide: a cytotoxic activated macrophage effector molecule. Biochem. Biophys. Res. Commun., 157, 8794.[Web of Science][Medline]
- Denicola,A., Rubbo,H., Rodriguez,D. and Radi,R. (1993) Peroxynitrite-mediated cytotoxicity to Trypanosoma cruzi. Arch. Biochem. Biophys., 304, 279286.[Web of Science][Medline]
- Ischiropoulos,H., Zhu,L. and Beckman,J.S. (1992) Peroxynitrite formation from macrophage-derived nitric oxide. Arch. Biochem. Biophys., 298, 446451.[Web of Science][Medline]
- Marletta,M.A., Yoon,P.S., Iyengar,R., Leaf,C.D. and Wishnok,J.S. (1988) Macrophage oxidation of L-arginine to nitrite and nitrate: nitric oxide is an intermediate. Biochemistry, 27, 87068711.[Medline]
-
Ambs,S., Merriam,W.G., Bennett,W.P., Felley-Bosco,E., Ogunfusika,M.O., Oser,S.M., Klein,S., Shields,P.G., Billiar,T.R. and Harris,C.C. (1998) Frequent nitric oxide synthase-2 expression in human colon adenomas: implication for tumor angiogenesis and colon cancer progression. Cancer Res., 58, 334341.
[Abstract/Free Full Text] - Kimura,H., Miura,S., Shigematsu,T., Ohkubo,N., Tsuzuki,Y., Kurose,I., Higuchi,H., Akiba,Y., Hokari,R., Hirokawa,M., Serizawa,H. and Ishii,H. (1997) Increased nitric oxide production and inducible nitric oxide synthase activity in colonic mucosa of patients with active ulcerative colitis and Crohn's disease. Dig. Dis. Sci., 42, 10471054.[Web of Science][Medline]
- Ohshima,H. and Bartsch,H. (1994) Chronic infections and inflammatory processes as cancer risk factors: possible role of nitric oxide in carcinogenesis. Mutat. Res., 305, 253264.[Web of Science][Medline]
- Tamir,S. and Tannenbaum,S.R. (1996) The role of nitric oxide (NO·) in the carcinogenic process. Biochim. Biophys. Acta, 1288, F31F36.[Medline]
- Liu,R.H. and Hotchkiss,J.H. (1995) Potential genotoxicity of chronically elevated nitric oxide: a review. Mutat. Res., 339, 7389.[Web of Science][Medline]
- Uppu,R.M., Squadrito,G.L., Cueto,R. and Pryor,W.A. (1996) Selecting the most appropriate synthesis of peroxynitrite. Methods Enzymol., 269, 285295.[Web of Science][Medline]
-
Kellogg,E.W. and Fridovich,I. (1975) Superoxide, hydrogen peroxide, and singlet oxygen in lipid peroxidation by a xanthine oxidase system. J. Biol. Chem., 250, 88128817.
[Abstract/Free Full Text] - Halliwell,B. and Aruoma,O.I. (1991) DNA damage by oxygen-derived species. FEBS Lett., 281, 919.[Web of Science][Medline]
- Schraufstätter,I., Hyslop,P.A., Jackson,J.H. and Cochrane,C.G. (1988) Oxidant-induced DNA damage of target cells. J. Clin. Invest., 82, 10401050.
- Spencer,J.P.E., Jenner,A., Chimel,K., Aruoma,O.I., Cross,C.E., Wu,R. and Halliwell,B. (1995) DNA strand breakage and base modification induced by hydrogen peroxide treatment of human respiratory tract epithelial cells. FEBS Lett., 374, 233236.[Web of Science][Medline]
-
Keyer,K. and Imlay,J.A. (1996) Superoxide accelerates DNA damage by elevating free-iron levels. Proc. Natl Acad. Sci. USA, 93, 1363513640.
[Abstract/Free Full Text] -
Felley-Bosco,E., Mirkovitch,J., Ambs,S., Macé,K., Pfeifer,A., Keefer,L.K. and Harris,C.C. (1995) Nitric oxide and ethylnitrosourea: relative mutagenicity in the p53 tumor suppressor and hypoxanthine-phosphoribosyltransferase genes. Carcinogenesis, 16, 20692074.
[Abstract/Free Full Text] -
Reddel,R.R., Ke,Y., Gerwin,B.I., McMenamin,M.G., Lechner,J.F., Su,R.T., Brash,D.E., Park,J.-B., Rhim,J.S. and Harris,C.C. (1988) Transformation of human bronchial epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes. Cancer Res., 48, 19041909.
[Abstract/Free Full Text] - Lechner,J.F. and LaVeck,M.A. (1985) A serum-free method for culturing normal human bronchial epithelial cells at clonal density. J. Tissue Cult. Methods, 9, 4348.
- Keefer,L.K., Nims,R.W., Davies,K.M. and Wink,D.A. (1996) `NONOates' (1-substituted diazen-1-ium-1,2-diolates) as nitric oxide donors: convenient nitric oxide dosage forms. Methods Enzymol., 268, 281293.[Web of Science][Medline]
- Maragos,C.M., Morley,D.,Wink,D.A., Dunams,T.M., Saavedra,J.E., Hoffman,A., Bove,A.A., Isaac,L., Hrabie,J.A. and Keefer,L.K. (1991) Complexes of ·NO with nucleophiles as agents for the controlled biological release of nitric oxide. Vasorelaxant effects. J. Med. Chem., 34, 32423247.[Web of Science][Medline]
-
Wink,D.A., Hanbauer,I., Krishna,M.C., DeGraff,W., Gamson,J. and Mitchell,J.B. (1993) Nitric oxide protects against cellular damage and cytotoxicity from reactive oxygen species. Proc. Natl Acad. Sci. USA, 90, 98139817.
[Abstract/Free Full Text] -
Emerit,I., Garban,F., Vassy,J., Levy,A., Filipe,P. and Freitas,J. (1996) Superoxide-mediated clastogenesis and anticlastogenic effects of exogenous superoxide dismutase. Proc. Natl Acad. Sci. USA, 93, 1279912804.
[Abstract/Free Full Text] -
Rubbo,H., Radi,R., Trujillo,M., Telleri,R., Kalyanaraman,B., Barnes,S., Kirk,M. and Freeman,B.A. (1994) Nitric oxide regulation of superoxide and peroxynitrite-dependent lipid peroxidation. Formation of novel nitrogen-containing oxidized lipid derivatives. J. Biol. Chem., 269, 2606626075.
[Abstract/Free Full Text] -
Vecchini,F., Pringault,E., Billiar,T.R., Geller,D.A., Hausel,P. and Felley-Bosco,E. (1997) Decreased activity of inducible nitric oxide synthase type 2 and modulation of the expression of glutathione S-transferase
, bcl-2, and metallothioneins during the differentiation of CaCo-2 cells. Cell Growth Differ., 8, 261268.[Abstract]
-
Pfeiffer,S. and Mayer,B. (1998) Lack of tyrosine nitration by peroxynitrite generated at physiological pH. J. Biol. Chem., 273, 2728027285.
[Abstract/Free Full Text] - Ischiropoulos,H., Gow,A., Thom,S.R., Kooy,N.W., Royall,J.A. and Crow,J.P. (1999) Detection of reactive nitrogen species using 2,7-dichlorodihydrofluorescein and dihydrorhodamine 123. Methods Enzymol., 301, 367373.[Web of Science][Medline]
-
Hollstein,M., Sidransky,D., Vogelstein,B. and Harris,C.C. (1991) p53 mutations in human cancers. Science, 253, 4953.
[Abstract/Free Full Text] - Zingarelli,B., O'Connor,M., Wong,H., Salzman,A.L. and Szabó,C. (1996) Peroxynitrite-mediated DNA strand breakage activates poly-adenosine diphosphate ribosyl synthetase and causes cellular energy depletion in macrophages stimulated with bacterial lipopolysaccharide. J. Immunol., 156, 350358.[Abstract]
- Spencer,J.P.E., Wong,J., Jenner,A., Aruoma,O.I., Cross,C.E. and Halliwell,B. (1996) Base modification and strand breakage in isolated calf thymus DNA and in DNA from human skin epidermal keratinocytes exposed to peroxynitrite or 3-morpholinosydnonimine. Chem. Res. Toxicol., 9, 11521158.[Web of Science][Medline]
- Caldwell,M., O'Neill,M., Earley,B., Kelly,J.P. and Leonard,B.E. (1995) NG-Nitro-L-arginine methyl ester protects against lipid peroxidation in the gerbil following cerebral ischaemia. Eur. J. Pharmacol., 285, 203206.[Web of Science][Medline]
- Sewerynek,E., Melchiorri,D., Chen,L. and Reiter,R.J. (1995) Melatonin reduces both basal and bacterial lipopolysaccharide-induced lipid peroxidation in vitro. Free Radic. Biol. Med., 19, 903909.[Web of Science][Medline]
- Öllinger,K. and Brunmark,A. (1994) Effect of different oxygen pressures and N,N-diphenyl-p-phenylenediamine on Adriamycin® toxicity to cultured neonatal rat heart myocytes. Biochem. Pharmacol., 48, 17071715.[Web of Science][Medline]
-
White,C.R., Brock,T.A., Chang,L.-Y., Crapo,J., Briscoe,P., Ku,D., Bradley,W.A., Gianturco,S.H., Gore,J., Freeman,B.A. and Tarpey,M.M. (1994) Superoxide and peroxynitrite in atherosclerosis. Proc. Natl Acad. Sci. USA, 91, 10441048.
[Abstract/Free Full Text] - Felley-Bosco,E., Buzard,G.S., Billiar,T.R. and Keefer,L.K. (1998) Nitric oxide, altered DNA, and mammalian disease. In Aruoma,O.I. and Halliwell,B. (eds.) Molecular Biology of Free Radicals in Human Diseases. OICA International, Micaud, Saint Lucia, pp. 287325.
-
Farias-Eisner,R., Chaudhuri,G., Aeberhard,E. and Fukuto,J.M. (1996) The chemistry and tumoricidal activity of nitric oxide/hydrogen peroxide and the implications to cell resistance/susceptibility. J. Biol. Chem., 271, 61446151.
[Abstract/Free Full Text] - Fukuto,J.M. and Ignarro,L.J. (1997) In vivo aspects of nitric oxide (NO) chemistry: does peroxynitrite (OONO) play a major role in cytotoxicity? Acc. Chem. Res., 30, 149152.
-
Nathan,C.F., Silverstein,S.C., Brukner,L.H. and Cohn,Z.A. (1979) Extracellular cytolysis by activated macrophages and granulocytes. II. Hydrogen peroxide as a mediator of cytotoxicity. J. Exp. Med., 149, 100113.
[Abstract/Free Full Text] - Zou,M.-H. and Ullrich,V. (1996) Peroxynitrite formed by simultaneous generation of nitric oxide and superoxide selectively inhibits bovine aortic prostacyclin synthase. FEBS Lett., 382, 101104.[Web of Science][Medline]
-
Pacelli,R., Wink,D.A., Cook,J.A., Krishna,M.C., DeGraff,W., Friedman,N., Tsokos,M., Samuni,A. and Mitchell,J.B. (1995) Nitric oxide potentiates hydrogen peroxide-induced killing of Escherichia coli. J. Exp. Med., 182, 14691479.
[Abstract/Free Full Text] - Zambetti,G.P. and Levine,A.J. (1993) A comparison of the biological activities of wild-type and mutant p53. FASEB J., 7, 855865.[Abstract]
-
Wink,D.A., Kasprzak,K.S., Maragos,C.M., Elespuru,R.K., Misra,M., Dunams,T.M., Cebula,T.A., Koch,W.H., Andrews,A.W., Allen, J.S. and Keefer,L.K. (1991) DNA deaminating ability and genotoxicity of nitric oxide and its progenitors. Science, 254, 10011003.
[Abstract/Free Full Text] - Merchant,K., Chen,H., Gonzales,T.C., Keefer,L.K. and Shaw,B.R. (1996) Deamination of single-stranded DNA cytosine residues in aerobic nitric oxide solution at micromolar total NO exposures. Chem. Res. Toxicol., 9, 891896.[Web of Science][Medline]
- Bartsch,H., Barbin,A., Marion,M.-J., Nair,J. and Guichard,Y. (1994) Formation, detection, and role in carcinogenesis of ethenobases in DNA. Drug Metab. Rev., 26, 349371.[Web of Science][Medline]
-
Nair,J., Gal,A., Tamir,S., Tannenbaum,S.R., Wogan,G.N. and Bartsch,H. (1998) Etheno adducts in spleen DNA of SJL mice stimulated to overproduce nitric oxide. Carcinogenesis, 19, 20812084.
[Abstract/Free Full Text] - Juedes,M.J. and Wogan,G.N. (1996) Peroxynitrite-induced mutation spectra of pSP189 following replication in bacteria and in human cells. Mutat. Res., 349, 5161.[Web of Science][Medline]
-
Ambs,S., Bennett,W.P., Merriam,W.G., Ogunfusika,M.O., Oser,S.M., Harrington,A.M., Shields,P.G., Felley-Bosco,E., Hussain,S.P. and Harris,C.C. (1999) Relationship between p53 mutations and inducible nitric oxide synthase expression in human colorectal cancer. J. Natl Cancer Inst., 91, 8688.
[Free Full Text] -
Zuo,S., Boorstein,R.J. and Teebor,G.W. (1995) Oxidative damage to 5-methylcytosine in DNA. Nucleic Acids Res., 23, 32393243.
[Abstract/Free Full Text] -
Moraes,E.C., Keyse,S.M. and Tyrrell,R.M. (1990) Mutagenesis by hydrogen peroxide treatment of mammalian cells: a molecular analysis. Carcinogenesis, 11, 283293.
[Abstract/Free Full Text] -
Tkeshelashvili,L.K., McBride,T., Spence,K. and Loeb,L.A. (1991) Mutation spectrum of copper-induced DNA damage. J. Biol. Chem., 266, 64016406.
[Abstract/Free Full Text] -
Wagner,J.R., Hu,C.-C. and Ames,B.N. (1992) Endogenous oxidative damage of deoxycytidine in DNA. Proc. Natl Acad. Sci. USA, 89, 33803384.
[Abstract/Free Full Text] -
Feig,D.I., Sowers,L.C. and Loeb,L.A. (1994) Reverse chemical mutagenesis: identification of the mutagenic lesions resulting from reactive oxygen species-mediated damage to DNA. Proc. Natl Acad. Sci. USA, 91, 66096613.
[Abstract/Free Full Text] - Hussain,S.P., Aguilar,F., Amstad,P. and Cerutti,P. (1994) Oxy-radical induced mutagenesis of hotspot codons 248 and 249 of the human p53 gene. Oncogene, 9, 22772281.[Web of Science][Medline]
- Schmalix,W.A., Singh,J.J., Kapfhammer,P., Stadler,J., Nüssler,A.K., Geller,D.A., Billiar,T.R., Simmons,R.L., Greim,H. and Doehmer,J. (1996) Stable expression of human inducible nitric oxide synthase in V79 Chinese hamster cells. Biochem. Pharmacol., 52, 13651374.[Web of Science][Medline]
- Tamir,S., Burney,S. and Tannenbaum,S.R. (1996) DNA damage by nitric oxide. Chem. Res. Toxicol., 9, 821827.[Web of Science][Medline]
-
Gal,A. and Wogan,G.N. (1996) Mutagenesis associated with nitric oxide production in transgenic SJL mice. Proc. Natl Acad. Sci. USA, 93, 1510215107.
[Abstract/Free Full Text] -
Zhuang,J.C., Lin,C., Lin,D. and Wogan,G.N. (1998) Mutagenesis associated with nitric oxide production in macrophages. Proc. Natl Acad. Sci. USA, 95, 82868291.
[Abstract/Free Full Text] - Arroyo,P.L., Hatch-Pigott,V., Mower,H.F. and Cooney,R.V. (1992) Mutagenicity of nitric oxide and its inhibition by antioxidants. Mutat. Res., 281, 193202.[Web of Science][Medline]
- Isomura,K., Chikahira,M., Teranishi,K. and Hamada,K. (1984) Induction of mutations and chromosome aberrations in lung cells following in vivo exposure of rats to nitrogen oxides. Mutat. Res., 136, 119125.[Web of Science][Medline]
-
Nguyen,T., Brunson,D., Crespi,C.L., Penman,B.W., Wishnok,J.S. and Tannenbaum,S.R. (1992) DNA damage and mutation in human cells exposed to nitric oxide in vitro. Proc. Natl Acad. Sci. USA, 89, 30303034.
[Abstract/Free Full Text] - Luperchio,S., Tamir,S. and Tannenbaum,S.R. (1996) NO-induced oxidative stress and glutathione metabolism in rodent and human cells. Free Radic. Biol. Med., 21, 513519.[Web of Science][Medline]
- Wink,D.A., Nims,R.W., Darbyshire,J.F., Christodoulou,D., Hanbauer,I., Cox,G.W., Laval,F., Laval,J., Cook,J.A., Krishna,M.C., DeGraff,W.G. and Mitchell,J.B. (1994) Reaction kinetics for nitrosation of cysteine and glutathione in aerobic nitric oxide solutions at neutral pH. Insights into the fate and physiological effects of intermediates generated in the NO/O2 reaction. Chem. Res. Toxicol., 7, 519525.[Web of Science][Medline]
- deRojas-Walker,T., Tamir,S., Ji,H., Wishnok,J.S. and Tannenbaum,S.R. (1995) Nitric oxide induces oxidative damage in addition to deamination in macrophage DNA. Chem. Res. Toxicol., 8, 473477.[Web of Science][Medline]
-
Lewis,R.S., Tamir,S., Tannenbaum,S.R. and Deen,W.M. (1995) Kinetic analysis of the fate of nitric oxide synthesized by macrophages in vitro. J. Biol. Chem., 270, 2935029355.
[Abstract/Free Full Text] -
Weitzman,S.A. and Stossel,T.P. (1981) Mutation caused by human phagocytes. Science, 212, 546547.
[Abstract/Free Full Text] - Radi,R., Beckman,J.S., Bush,K.M. and Freeman,B.A. (1991) Peroxynitrite-induced membrane lipid peroxidation: the cytotoxic potential of superoxide and nitric oxide. Arch. Biochem. Biophys., 288, 481487.[Web of Science][Medline]
-
Szabó,C., Zingarelli,B., O'Connor,M. and Salzman,A.L. (1996) DNA strand breakage, activation of poly(ADP-ribose) synthetase, and cellular energy depletion are involved in the cytotoxicity in macrophages and smooth muscle cells exposed to peroxynitrite. Proc. Natl Acad. Sci. USA, 93, 17531758.
[Abstract/Free Full Text] -
Epe,B., Ballmaier,D., Roussyn,I., Briviba,K. and Sies,H. (1996) DNA damage by peroxynitrite characterized with DNA repair enzymes. Nucleic Acids Res., 24, 41054110.
[Abstract/Free Full Text] -
Yermilov,V., Rubio,J., Becchi,M., Friesen,M.D., Pignatelli,B. and Ohshima,H. (1995) Formation of 8-nitroguanine by the reaction of guanine with peroxynitrite in vitro. Carcinogenesis, 16, 20452050.
[Abstract/Free Full Text] - Douki,T. and Cadet,J. (1996) Peroxynitrite mediated oxidation of purine bases of nucleosides and isolated DNA. Free Radic. Res., 24, 369380.[Web of Science][Medline]
- Yermilov,V., Rubio,J. and Ohshima,H. (1995) Formation of 8-nitroguanine in DNA treated with peroxynitrite in vitro and its rapid removal from DNA by depurination. FEBS Lett., 376, 207210.[Web of Science][Medline]
- Salgo,M.G., Bermúdez,E., Squadrito,G.L. and Pryor,W.A. (1995) DNA damage and oxidation of thiols peroxynitrite causes in rat thymocytes. Arch. Biochem. Biophys., 322, 500505.[Web of Science][Medline]
-
Bonfoco,E., Krainc,D., Ankarcrona,M., Nicotera,P. and Lipton,S.A. (1995) Apoptosis and necrosis: two distinct events induced, respectively, by mild and intense insults with N-methyl-D-aspartate or nitric oxide/superoxide in cortical cell cultures. Proc. Natl Acad. Sci. USA, 92, 71627166.
[Abstract/Free Full Text] -
Lin,K.-T., Xue,J.-Y., Nomen,M., Spur,B. and Wong,P.Y.-K. (1995) Peroxynitrite-induced apoptosis in HL-60 cells. J. Biol. Chem., 270, 1648716490.
[Abstract/Free Full Text] - Felley-Bosco,E. (1998) Role of nitric oxide in genotoxicity: implication for carcinogenesis. Cancer Metastasis Rev., 17, 2537.[Web of Science][Medline]
- Delaney,C.A., Green,I.C., Lowe,J.E., Cunningham,J.M., Butler,A.R., Renton,L., D'Costa,I. and Green,M.H.L. (1997) Use of the comet assay to investigate possible interactions of nitric oxide and reactive oxygen species in the induction of DNA damage and inhibition of function in an insulin-secreting cell line. Mutat. Res., 375, 137146.[Web of Science][Medline]
-
Graziewicz,M., Wink,D.A. and Laval,F. (1996) Nitric oxide inhibits DNA ligase activity: potential mechanisms for NO-mediated DNA damage. Carcinogenesis, 17, 25012505.
[Abstract/Free Full Text] -
Gal,A., Tamir,S., Kennedy,L.J., Tannenbaum,S.R. and Wogan,G.N. (1997) Nitrotyrosine formation, apoptosis, and oxidative damage: relationships to nitric oxide production in SJL mice bearing the RcsX tumor. Cancer Res., 57, 18231828.
[Abstract/Free Full Text] -
Kirsch,M., Lomonosova,E.E., Korth,H.-G., Sustmann,R. and de Groot,H. (1998) Hydrogen peroxide formation by reaction of peroxynitrite with HEPES and related tertiary amines. J. Biol. Chem., 273, 1271612724.
[Abstract/Free Full Text] - Lomonosova,E.E., Kirsch,M., Rauen,U. and de Groot,H. (1998) The critical role of HEPES in SIN-1 cytotoxicity, peroxynitrite versus hydrogen peroxide. Free Radic. Biol. Med., 24, 522528.[Web of Science][Medline]
- Guidarelli,A., Sestili,P. and Cantoni,O. (1998) Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide. Br. J. Pharmacol., 123, 13111316.[Web of Science][Medline]
- Guidarelli,A., Clementi,E., Sciorati,C. and Cantoni,O. (1998) The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage. Br. J. Pharmacol., 125, 10741080.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
T. Ueki, A. W. Hsing, Y.-T. Gao, B.-S. Wang, M.-C. Shen, J. Cheng, J. Deng, J. F. Fraumeni Jr., and A. Rashid Alterations of p16 and Prognosis in Biliary Tract Cancers from a Population-Based Study in China Clin. Cancer Res., March 1, 2004; 10(5): 1717 - 1725. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-H. Lee, T. R. O'Connor, and G. P. Pfeifer Oxidative DNA damage induced by copper and hydrogen peroxide promotes CG->TT tandem mutations at methylated CpG dinucleotides in nucleotide excision repair-deficient cells Nucleic Acids Res., August 15, 2002; 30(16): 3566 - 3573. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shibata, J. Parsonnet, T. A. Longacre, M. I. Garcia, B. Puligandla, R.E. Davis, J. H. Vogelman, N. Orentreich, and L. A. Habel CagA status of Helicobacter pylori infection and p53 gene mutations in gastric adenocarcinoma Carcinogenesis, March 1, 2002; 23(3): 419 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Biramijamal, A. Allameh, P. Mirbod, H.-J. Groene, R. Koomagi, and M. Hollstein Unusual Profile and High Prevalence of p53 Mutations in Esophageal Squamous Cell Carcinomas from Northern Iran Cancer Res., April 1, 2001; 61(7): 3119 - 3123. [Abstract] [Full Text] |
||||
![]() |
E. Felley-Bosco, F. C. Bender, F. Courjault-Gautier, C. Bron, and A. F. G. Quest Caveolin-1 down-regulates inducible nitric oxide synthase via the proteasome pathway in human colon carcinoma cells PNAS, December 8, 2000; (2000) 250406797. [Abstract] [Full Text] |
||||
![]() |
E. Felley-Bosco, F. C. Bender, F. Courjault-Gautier, C. Bron, and A. F. G. Quest Caveolin-1 down-regulates inducible nitric oxide synthase via the proteasome pathway in human colon carcinoma cells PNAS, December 19, 2000; 97(26): 14334 - 14339. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

) or HX/XO + 600 µM DEA/NO (). Representative of three independent experiments. (B) Nitric oxide-induced stimulation of soluble guanylyl cyclase in the absence or presence of HX/XO. cGMP production (fmol/mg protein) was measured in BEAS-2B cells exposed for 10 min to 5 µM DEA/NO ± HX/XO in LHC-8 medium. Results are expressed as means ± SEM (n = 46). Statistical analysis was performed using Student's t-test to compare treated cells with control (**P < 0.01). (C) Kinetic measurements of HX/XO-induced oxidation of DHR 123 in the absence or presence of DEA/NO. These cell-free experiments were performed for 30 min at 37°C in the presence of HX/XO (







