Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (25)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kawate, H.
Right arrow Articles by Sekiguchi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kawate, H.
Right arrow Articles by Sekiguchi, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 21, No. 2, 301-305, February 2000
© 2000 Oxford University Press


Carcinogenesis

A defect in a single allele of the Mlh1 gene causes dissociation of the killing and tumorigenic actions of an alkylating carcinogen in methyltransferase-deficient mice

Hisaya Kawate1,2, Riyoko Itoh1,6, Kunihiko Sakumi1, Yusaku Nakabeppu1, Teruhisa Tsuzuki3, Fumio Ide4, Takatoshi Ishikawa4, Tetsuo Noda5, Hajime Nawata2 and Mutsuo Sekiguchi6,7

1 Department of Biochemistry, Medical Institute of Bioregulation, Kyushu University,
2 Department of Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University and
3 Department of Medical Biophysics and Radiation Biology, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582,
4 Department of Pathology, Faculty of Medicine, The University of Tokyo, Tokyo 113-0033,
5 Department of Cell Biology, Cancer Institute, Tokyo 170-0012 and
6 Department of Biology and Frontier Research Center, Fukuoka Dental College, 2-15-1 Tamura, Sawara-ku, Fukuoka 814-0193, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mice with mutations in both alleles of the Mgmt and the Mlh1 gene, the former encoding a DNA repair methyltransferase and the latter a protein functioning at an early step of mismatch repair, are as resistant to the killing action of alkylating agents as are wild-type mice. These mice yielded a large number of tumors when exposed to alkylating carcinogens, but this characteristic was subdued since they also showed a relatively high level of spontaneous tumorigenicity, as a consequence of the defect in mismatch repair. This complexity is now resolved by introducing the Mlh1+/– mutation, instead of Mlh1–/–, in these methyltransferase-deficient mice. Mgmt–/– Mlh1+/– mice, with about half the amount of MLH1 protein as Mgmt–/– Mlh1+/+ mice, were resistant to the killing action of N-methyl-N-nitrosourea (MNU), up to the level of 30 mg/kg body wt. Eight weeks after exposure to this dose of MNU, 40% of MNU-treated Mgmt–/– Mlh1+/– mice had thymic lymphomas and there were no tumors in those mice not given the treatment. It seems that the cellular content of MLH1 protein is a critical factor for determining if damaged cells enter into either one of the two pathways leading to mutation induction or to apototic cell death. Loss of Mlh1 expression was frequently observed in tumors of Mgmt–/– Mlh1+/– mice and this might be related to progression of the tumors.

Abbreviations: HNPCC, hereditary nonpolyposis colorectal cancer; MNU, N-methyl-N-nitrosourea; PBS, phosphate-buffered saline.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Alkylating agents are potent mutagens and carcinogens and also cause cell death. These effects of alkylating agents are related to formation of various alkylated bases in DNA. Among them, O6-methylguanine appears to play a major role in both the mutagenic and cytotoxic events caused by the agents (1,2). During DNA replication, O6-methylguanine can pair with thymine as well as cytosine, leading to G:C->A:T transition mutations (3,4). To prevent such an outcome, organisms possess a specific DNA repair protein, O6-methylguanine-DNA methyltransferase. The enzyme transfers a methyl group from O6-methylguanine in DNA to the enzyme molecule, thereby repairing the DNA lesion in a single step reaction (57). Because the reaction irreversibly inactivates the enzyme, repair capacity for the methylated base depends on the number of methyltransferase molecules in the cell (8,9). Some cancer cell lines and tissues have no detectable methyltransferase activity and this depletion of the protein correlates with transcription silencing associated with hypermethylation of CpG islands in the promoter region of the gene (1012).

The genes for methyltransferase have been isolated from human and mouse and their structures elucidated (1315). Based on this information, gene targeting experiments were done to establish mouse lines defective in the Mgmt gene, encoding O6-methylguanine-DNA methyltransferase (16). A large number of tumors occurred in Mgmt–/– mice exposed to low doses of N-methyl-N-nitrosourea (MNU) and dimethylnitrosamine, whereas no or few tumors occurred in normal mice treated in the same manner (17,18). Another notable feature of the gene targeted mice was their extraordinarily high sensitivity to the killing effects of MNU; the LD50 for Mgmt–/– mice was less than one-tenth of the values for Mgmt+/+ and Mgmt+/– mice (16,17). Bone marrow of the treated Mgmt–/– mice become hypocellular and there was a drastic decrease in the number of peripheral leukocytes and platelets, thereby indicating an impaired reproductive capacity of hematopoietic stem cells. Thus, O6-methylguanine is apparently responsible not only for the induction of mutations but also for the death of rapidly growing cells.

Although Mgmt–/– mice exhibit a high susceptibility to the tumorigenic action of alkylating agents, application has been limited because of the high lethality of the agents. To solve this problem, we have introduced an additional mutation into the mice. It has been shown that cells defective in mismatch repair capacity have an increased resistance to alkylating agents even though cellular methyltransferase activity is suppressed by an alteration in gene expression or by application of an inhibitor (1921). Thus, we constructed mice defective in both the Mgmt and Mlh1 genes, the latter encoding a protein functioning at an early step of mismatch repair (22). Mgmt–/– Mlh1–/– mice proved to be resistant to alkylating agents in terms of survival, but did have numerous tumors after exposure to MNU. Thus, the killing and tumorigenic effects of alkylating agents could be dissociated. However, these doubly deficient mice had a small but significant number of tumors even without exposure to MNU. This phenomenon is common to mice defective in mismatch repair (2224) and such a high incidence of tumors is characteristic of human hereditary nonpolyposis colorectal cancer (HNPCC) patients defective in one of the mismatch repair genes (2531).

To circumvent this difficulty, we explored the possibility that a heterozygous Mlh1 mutation might have differential effects on survival and tumor induction in MNU-administered mice. This attempt has been executed successfully and we describe here the results of these experiments.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Gene targeted mice
Mgmt and Mlh1 knockout mice were developed as described (16,22). In brief, targeted disruption of the Mgmt gene was accomplished by inserting a polIIneo–poly(A) cassette in exon 2, containing the start codon. Also, a region of the Mlh1 sequence carrying an exon corresponding to exon 16 of the human gene was replaced by a PGKneo–poly(A) cassette. This Mlh1 mutation is an in-frame deletion of 165 nucleotides which is found in some Finnish HNPCC kindreds (27). The two types of gene targeted mice were mated to produce Mgmt–/– Mlh1–/– and Mgmt–/– Mlh1+/– mice. Genotypes of these mice were determined by PCR analyses and Southern blot hybridization, using appropriate primers and probes, as described (22).

Immunodetection of MLH1 protein
Anti-mouse MLH1 polyclonal antibodies were prepared as described (7,32). Briefly, using mMLH5'-P (ATCCTGCAGGGAAGGAAATGACAGCTGCTTGC) and mMLH3'-X (CCGTCTAGATTTCTTTCCTGAGACTTTCAAAACACTC) primers, a 582 bp mouse Mlh1 cDNA fragment was obtained from Balbc/3T3 cell RNA by RT–PCR. This region corresponds to exon 16 of the human Mlh1 gene and our Mlh1-deficient mice lack part of this region. The fragment was placed at the 3'-terminus of the trpE gene and the resulting fusion gene was introduced into Escherichia coli strain BL21 (DE3), then the fusion protein was overproduced and examined using SDS–PAGE. The region of gel carrying the band was excised, cut into small pieces and injected into rabbits with Hunter's adjuvant (Titer Max). Sera were subjected to a fusion protein–Sepharose 4B column (Pharmacia) and the bound fraction was collected. These affinity-purified antibodies were used for immunoblotting, as described (7,32). Mouse tissues were lysed in SDS sample buffer (62.5 mM Tris–HCl, pH 6.8, 2% SDS, 5% glycerol, 2% 2-mercaptoethanol), followed by boiling and sonication. The samples were subjected to SDS–PAGE and electrotransferred onto nitrocellulose membrane (Schleicher & Schuell, Dasse, Germany). The membrane was reacted with anti-mouse MLH1 antibodies at 4°C for 15 h. To detect the bound antibodies we used 125I-labeled protein A (Amersham) or alkaline phosphatase-conjugated goat anti-rabbit IgG (Promega).

Administration of MNU to mice
Six-week-old mice with different genotypes were i.p. administered MNU (Nacalai Tesque, Kyoto, Japan). As a control, phosphate-buffered saline (PBS) was injected into these mice. Mice were kept for defined periods and survivors were scored. To determine the MNU-induced tumorigenesis, the mice were killed 8 weeks after treatment and their organs examined.

Direct sequencing of the K-ras gene
Genomic DNA was extracted from tail and thymus of each mouse. To amplify the K-ras exon 1 region, containing codons 12 and 13, genomic PCR was performed in 100 µl of reaction mixture containing 200 ng of template DNA, 100 nM KRO11 and KRO12 primers, 200 µM dNTP and 1.5 U rTaq DNA polymerase (Takara, Tokyo, Japan). After removal of primers with Microcon 100 microconcentrators (Amicon Inc., Beverly, MA), nucleotide sequences of the PCR products were determined using Dye Terminator Cycle Sequencing FS Ready Reaction Kits and a model 373A automated DNA sequencer (Applied Biosystems Inc.), with KRI11 or KRI12 as primer. KRO11 (GAGTCTTACACACAAAGGTG), KRO12 (GCAGCGTTACCTCTATCGTA), KRI11 (GTAAGGCCTGCTGAAAATGA) and KRI12 (GGGTCGTACTCATCCACAAA) used for these sequencings were purchased from Nisshinbo (Japan) (33).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation of mice defective in two of the DNA repair genes
Mouse lines defective in either one of the Mgmt or the Mlh1 gene, the former coding for O6-methylguanine-DNA methyltransferase and the latter for a protein required for mismatch repair, were generated by means of gene targeting (16,22). To investigate the effect of Mlh1 gene dosage on killing and tumorigenesis by alkylating agents, Mgmt knockout mice with three different Mlh1 genotypes were generated by crossing these gene targeted mice. These mice are totally deficient in methyltransferase activity, which repairs the major premutagenic DNA lesion, O6-methylguanine, produced by alkylating agents. To determine the amounts of MLH1 protein in tissues of these mice, we prepared anti-mouse MLH1 polyclonal antibodies, recognizing the C-terminal region of the protein. On western blot analysis, a band corresponding to the authentic 87 kDa mouse MLH1 protein was detected in extracts of thymus from Mgmt–/– Mlh1+/+ and Mgmt–/– Mlh1+/– mice (Figure 1Go). Quantitative estimation of MLH1 protein was made by scanning the image; the value for the Mlh1+/– relative to the Mlh1+/+ mice was 0.46, reflecting the number of active genes in these mice. No signal for MLH1 protein was detected in thymus extracts prepared from Mgmt–/– Mlh1–/– mice. On the gels there was an intense signal for a cross-reacting substance at a position corresponding to a 50 kDa protein. Since the intensity of the band is essentially the same for the three samples, this finding provides further support for the notion that cells of Mlh1+/– mice carry almost half the amount of MLH1 protein, as compared with those of Mlh1+/+ mice.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 1. Immunodetection of mouse MLH1 protein. Whole cell extracts of 2.5x106 thymic cells, derived from 6-week-old mice, were subjected to SDS–PAGE and proteins were electrotransferred onto nitrocellulose membrane. The membrane was reacted with anti-mouse MLH1 antibodies, followed by detection with [125I]protein A. Lane 1, Mgmt–/– Mlh1+/+ mouse; lane 2, Mgmt–/– Mlh1+/– mouse; lane 3, Mgmt–/– Mlh1–/– mouse. An arrow indicates the signal for mouse MLH1 protein.

 
Effects of Mlh1 mutation on survival of MNU-administered Mgmt–/– mice
Mice defective in the Mgmt gene are hypersensitive to alkylating carcinogens, such as MNU, in terms of both killing and tumorigenic effects (1618). These dual effects of alkylating agents can be dissociated by introduction of an additional defect in mismatch repair (22). Mgmt–/– Mlh1–/– mice are as resistant to MNU as are wild-type mice, in terms of survival, but do have numerous tumors after exposure to MNU. However, there is a problem that the Mlh1 deficiency itself causes a certain degree of spontaneous tumorigenicity. We thus explored the possibility that introduction of an Mlh1+/– state might abolish tumor formation but still retain the high degree of resistance to the killing action of alkylating agents.

We applied various doses of MNU (at least eight mice for each dose) to Mgmt–/– mice with three Mlh1 genotypes 6 weeks after birth and recorded their survivals on day 30 after MNU administration (Figure 2Go). Mgmt–/– Mlh1+/– mice exhibited an intermediate type of survival curve between those for Mgmt–/– Mlh1+/+ and Mgmt–/– Mlh1–/– mice. From the curves, LD50 values were estimated as 20, 120 and 280 mg/kg body wt for Mgmt–/– Mlh1+/+, Mgmt–/– Mlh1+/– and Mgmt–/– Mlh1–/– mice, respectively. Up to 30 mg MNU/kg body wt, Mgmt–/– Mlh1+/– mice were as resistant as wild-type mice to MNU.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Survival of mice given different doses of MNU. Groups of 6-week-old mice with different genotypes (at least eight for each dose) were given different amounts of MNU i.p. Survival rates on day 30 after injection were plotted. {circ}, Mgmt–/– Mlh1+/+ mice; {triangleup}, Mgmt–/– Mlh1+/– mice; •, Mgmt–/– Mlh1–/– mice.

 
We then determined survival times of mice given a fixed dose of MNU. Three groups of Mgmt–/– mice with different degrees of Mlh1 deficiency, each consisting of ~40 animals (6 weeks old), were given a single i.p. injection of MNU (30 mg/kg body wt). As a control, PBS was injected into the three types of mice, all of which survived during the period of observation (for 30 days). As shown in Figure 3, Go95% of Mgmt–/– Mlh1+/+ mice died within 20 days of MNU administration, whereas Mgmt–/– Mlh1–/– mice survived throughout this period. Of interest is the observation that almost all of the Mgmt–/– Mlh1+/– mice survived after MNU treatment, despite carrying half the amount of MLH1 protein. Thus, conditions for examining tumorigenicity have been established.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Survival curves of mice after MNU administration. In post-natal week 6, 37 Mgmt–/– Mlh1+/+, 40 Mgmt–/– Mlh1+/– and 38 Mgmt–/– Mlh1–/– mice were given MNU (30 mg/kg body wt) i.p. {circ}, Mgmt–/– Mlh1+/+; {triangleup}, Mgmt–/– Mlh1+/–; •, Mgmt–/– Mlh1–/– mice.

 
Damage to internal organs in MNU-administered mice
Death of these mice was closely related to bone marrow damage and dysplastic mucosae of the intestine together with crypt abscesses, reflecting the fact that actively growing cells are highly vulnerable to alkylating agents. A reduction in the size of the spleen and thymus was evident even before death of the animals (16). After administration of 30 mg MNU/kg there was a significant degree of reduction in size of the thymus of the Mgmt–/– Mlh1+/+ mice, while the thymus of the Mgmt–/– Mlh1–/– mice was the same size as that of PBS-treated control mice. The size of the thymus of MNU-administered Mgmt–/– Mlh1+/– mice was intermediate between the other two types of mice treated in the same manner. This would mean that on administration of 30 mg MNU/kg the internal organs of Mgmt–/– Mlh1+/– mice were damaged to certain extents but all of these mice survived during the period of observation.

Tumor formation in Mlh1-defective mice
When these mice were not given drug treatment, Mgmt–/– Mlh1+/– mice survived for at least 1 year without any apparent abnormality, whereas almost all of the Mgmt–/– Mlh1–/– mice died within a year, mostly with lymphoma and intestinal tumors. This provided the basis for use of Mgmt–/– Mlh1+/– mice in the following tumorigenesis experiment.

Mgmt–/– mice with two different Mlh1 genotypes (~40 each) were given a single i.p. injection of MNU (30 mg/kg body wt) 6 weeks post-natally. The animals were killed 8 weeks after MNU injection and their organs examined. As controls, PBS was injected into the two types of mice, followed by a similar examination. The results obtained are summarized in Table IGo.


View this table:
[in this window]
[in a new window]
 
Table I. Tumor induction by MNU in mice with different Mlh1 alleles
 
Without MNU exposure Mgmt–/– Mlh1+/– mice had no tumors, at least during the period of observation. Mice with this genotype yielded a number of tumors on administration of MNU and thymic lymphomas were present in 17 of 42 animals (40%). In Mgmt–/– Mlh1–/– mice treated with MNU an even higher rate of tumor formation (77%) was obtained, but mice with this genotype had a significant number of tumors (19%) even without MNU administration.

Genomic alterations in tumors
O6-Methylguanine, produced by alkylating agents, can cause G:C->A:T transition mutations. In fact, K-ras point mutations at codon 12 have often been found in thymic lymphomas produced after exposure to MNU (34,35). To determine if such a mutation was present in our tumor samples, direct sequencing of a region of the K-ras gene, covering codons 12 and 13, was carried out for thymic lymphomas of Mgmt–/– Mlh1+/– mice. Among the 13 lymphomas examined, one sample carried a G:C->A:T transition at codon 12. No such mutation was evident in a DNA sample from the tail of the same animal.

Expression of the Mlh1 gene in tumors
Tumor cells sometimes undergo alterations in gene expression and this might be related to progression of the tumor. In this regard, it was of worth to see if Mlh1 gene expression was altered in the tumor samples.

Immunoblotting analysis was done using lymphomas derived from Mgmt–/– Mlh1+/– mice. Figure 4Go shows some of the results of such analyses, which indicate that in certain tumors expression of the Mlh1 gene was totally deficient. Among the 13 lymphomas examined four showed a complete absence of MLH1 protein and one had a reduced amount of MLH1 protein; the remaining samples carried half the amount of protein.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 4. MLH1 expression in MNU-induced thymic lymphomas in Mgmt–/– Mlh1+/– mice. Analyses were as described in the legend to Figure 1Go. Lanes 1–8, MNU-induced thymic lymphomas of Mgmt–/– Mlh1+/– mice; lane 9, normal thymus of Mgmt–/– Mlh1+/– mouse; lane 10, normal thymus of Mgmt–/– Mlh1–/– mouse. An arrow indicates the signal for mouse MLH1 protein

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mouse lines deficient in the Mgmt gene are hypersensitive to the killing and tumorigenic effects of alkylating agents (16). This may be related to the finding that Mgmt–/– cells treated with alkylating agents undergo apototic cell death, which occurs after G2/M arrest in the second cycle of cell proliferation (36). We have shown that these dual effects of alkylating carcinogens can be dissociated by introduction of an additional defect in mismatch repair. Mice with substituted deletions in both alleles of the Mgmt and the Mlh1 gene are as resistant to MNU as are wild-type mice, in terms of survival, but do have numerous tumors after exposure to MNU (22). This system thus provides a unique opportunity to estimate tumorigenic potentials of alkylating substances, yet bypassing the killing activity. However, there remains a problem that the mismatch repair deficiency itself causes a certain degree of tumorigenicity. Even without MNU administration, a small but significant number of tumors were found in the Mgmt–/– Mlh1–/– mice.

In a search for conditions which would reduce the frequency of spontaneous tumorigenicity, we found that Mgmt–/– Mlh1+/– mice had practically no tumors during the period which is usually needed to detect induction of tumors (at least 8 weeks after treatment). Such mice responded well in terms of tumor induction to an alkylating agent, yet maintained the high levels of resistance to the killing effect of the agent. At appropriate MNU doses (e.g. 30 mg/kg body wt), Mgmt–/– Mlh1+/– mice had numerous tumors yet exhibited no decrease in survival rate. Thus, this approach provides an ideal condition for examining the tumorigenic activity of alkylating agents.

Immunostaining analyses revealed that thymic tissues of Mlh1+/– mice contain approximately half the amount of MLH1 protein found in wild-type mice. With this amount of MLH1 protein, recognition and repair of mismatched base pairs, which arise rarely in normal DNA replication, may be handled properly and, thus, there is no apparent difference between Mlh1+/+ and Mlh+/– mice with respect to their phenotypes under normal conditions. On the other hand, on exposure to exogenous alkylating agents relatively large numbers of O6-methylguanine:thymine or O6-methylguanine:cytosine pairs are formed and, in such cases, the amount of MLH1 protein could be critical. Indeed, Mgmt–/– Mlh1+/– mice showed an intermediate nature between Mgmt–/– Mlh1+/+ and Mgmt–/– Mlh1–/– mice in terms of survival after alkylation treatment. Thus, the present finding that survival of mice after treatment with MNU depends on the copy number of an active Mlh1 gene implies that the amount of MLH1 protein is retained at a certain critical level, even in normal cells.

At an early step in mismatch repair the products of at least five gene, Msh2, Msh3, Msh6, Mlh1 and Pms2, form complexes and play an important role in recognition of mismatched pairs and initiation of repair reactions (2931). It is generally assumed that a defect in any one of these genes would lead to a defect in mismatch repair. In fact, mutations in these genes have been found in human HNPCC patients, though the frequencies of mutations in each of the genes were significantly different (2528). Thus, there is a possibility that mutations in genes other than Mlh1 might lead to a similar phenotype, with regard to the phenomena that we observed in the present study. However, it was reported that after treatment with O6-benzylguanine, an inhibitor of O6-methylguanine-DNA methyltransferase, Msh2+/– cells were as sensitive as Msh2+/+ cells to alkylating agents (21). This apparent difference may be due to different levels of expression of the genes or to different modes of action of these proteins. To pursue this further, one needs to investigate lethal and tumorigenic actions of alkylating agents on Mgmt–/– Msh2+/– mice. This work is in progress in our laboratory.

We found that Mlh1 expression in tumor tissues of Mgmt–/– Mlh1+/– mice exposed to MNU is heterogeneous. Four of 13 lymphoma samples analyzed showed complete absence of MLH1 protein, whereas the remaining lymphoma cells contained half of the normal (eight samples) or a slightly reduced (one sample) amount of MLH1 protein. PCR analyses of the DNA from these MLH1-deficient lymphomas revealed no deletion or any large alteration in the wild-type Mlh1 allele. It may be that a base substitution was induced by MNU or that some modification occurred in a certain region of the gene, such as methylation in the promoter region. Whatever the cause, this loss of Mlh1 expression might be related to transformation of the cell. A complete deficiency of MLH1 function would lead to an increased frequency of errors during DNA replication. It has been shown that some gene expression is altered during tumor development and such alterations in the genome would further accelerate progression of the tumor.

Most HNPCC patients have mutations in only one allele of certain mismatch repair genes, but frequently produce tumors (2528). Some of these tumors are devoid of mismatch repair protein, a phenomenon similar to that observed in Mlh1+/– mice in the present study. In Msh2 hemizygous mice there was an elevated tumor incidence after a 100 week observation period, but this rarely correlated with loss of the wild-type Msh2 allele (23). On the other hand, heterozygous Mlh1 mutant mice had not only an increased incidence of tumors but also reduced longevity, as compared with wild-type littermates (37). Recent work with yeast has shown that either overproduction of wild-type MLH1 protein or introduction of a heterozygous mutation in the Mlh1 gene leads to a mutator phenotype (38). These observations suggest that the level of Mlh1 expression may be an important factor in determining genetic stability as well as susceptibility to carcinogens.


    Acknowledgments
 
We thank Drs T.Iwakuma, H.Igarashi and S.Oda for discussions and M.Ohara for pertinent advice. This paper was written when one of the authors (M.S.) was the Rothschild-Mayen Fellow at the Institut Curie. This work was supported by grants from the Ministry of Education, Science, Sports and Culture of Japan (M.S.) and CREST, Japan Science and Technology (Y.N.). H.K. is a Research Fellow of the Japan Society for the Promotion of Science.


    Notes
 
7 To whom correspondence should be addressedEmail: sekim1{at}college.fdcnet.ac.jp

Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Loveless,A. (1969) Possible relevance of O-6 alkylation of deoxyguanosine to the mutagenicity and carcinogenicity of nitrosamines and nitrosamides. Nature, 223, 206–207.[Medline]
  2. Goth,R. and Rajewsky,M.F. (1974) Persistence of O6-ethylguanine in rat-brain DNA: correlation with nervous system-specific carcinogenesis by ethylnitrosourea. Proc. Natl Acad. Sci. USA, 71, 639–643.[Abstract/Free Full Text]
  3. Coulonidre,C. and Miller,J.H. (1977) Genetic studies of the lac repressor. IV. Mutagenic specificity in the lacI gene of Escherichia coli. J. Mol. Biol., 117, 577–606.[ISI][Medline]
  4. Ito,T., Nakamura,T., Maki,H. and Sekiguchi,M. (1994) Roles of transcription and repair in alkylation mutagenesis. Mutat. Res., 314, 273–285.[ISI][Medline]
  5. Demple,B., Jacobsson,A., Olsson,M., Robins,P. and Lindahl,T. (1982) Repair of alkylated DNA in Escherichia coli: physical properties of O6-methylguanine-DNA methyltransferase. J. Biol. Chem., 257, 13776–13780.[Abstract/Free Full Text]
  6. Sekiguchi,M., Nakabeppu,Y., Sakumi,K. and Tsuzuki,T. (1996) DNA-repair methyltransferase as a molecular device for preventing mutation and cancer. J. Cancer Res. Clin. Oncol., 122, 199–206.[ISI][Medline]
  7. Kawate,H., Ihara,K., Kohda,K., Sakumi,K. and Sekiguchi,M. (1995) Mouse methyltransferase for repair of O6-methylguanine and O4-methylthymine in DNA. Carcinogenesis, 16, 1595–1602.[Abstract/Free Full Text]
  8. Gerson,S.L., Trey,J.E., Miller,K. and Berger,N.A. (1986) Comparison of O6-alkylguanine-DNA alkyltransferase activity based on cellular DNA content in human, rat and mouse tissues. Carcinogenesis, 7, 745–749.[Abstract/Free Full Text]
  9. Ishibashi,T., Nakabeppu,Y., Kawate,H., Sakumi,K., Hayakawa,H. and Sekiguchi,M. (1994) Intracellular localization and function of DNA repair methyltransferase in human cells. Mutat. Res., 315, 199–212.[ISI][Medline]
  10. Day,R.S., Ziolkowski,C.H., Scudiero,D.A., Meyer,S.A., Lubiniecki,A.S., Girardi,A.J., Galloway,S.M. and Bynum,G.D. (1980) Defective repair of alkylated DNA by human tumour and SV40-transformed human cell strains. Nature, 288, 724–727.[Medline]
  11. Costello,J.F., Futscher,B.W., Tano,K., Graunke,D.M. and Pieper,R.O. (1994) Graded methylation in the promoter and body of the O6-methylguanine DNA methyltransferase (MGMT) gene correlates with MGMT expression in human glioma cells. J. Biol. Chem., 269, 17228–17237.[Abstract/Free Full Text]
  12. Esteller,M., Hamilton,S.R., Burger,P.C., Baylin,S.B. and Herman,J.G. (1999) Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res., 59, 793–797.[Abstract/Free Full Text]
  13. Nakatsu,Y., Hattori,K., Hayakawa,H., Shimizu,K. and Sekiguchi,M. (1993) Organization and expression of the human gene for O6-methylguanine-DNA methyltransferase. Mutat. Res., 293, 119–132.[ISI][Medline]
  14. Shiraishi,A., Sakumi,K., Nakatsu,Y., Hayakawa,H. and Sekiguchi,M. (1992) Isolation and characterization of cDNA and genomic sequences for mouse O6-methylguanine-DNA methyltransferase. Carcinogenesis, 13, 289–296.[Abstract/Free Full Text]
  15. Iwakuma,T., Shiraishi,A., Fukuhara,M., Kawate,H. and Sekiguchi,M. (1996) Organization and expression of the mouse gene for DNA repair methyltransferase. DNA Cell Biol., 15, 863–872.[ISI][Medline]
  16. Tsuzuki,T., Sakumi,K., Shiraishi,A., Kawate,H., Igarashi,H., Iwakuma,T., Tominaga,Y., Zhang,S., Shimizu,S., Ishikawa,T., Nakamura,K., Nakao,K., Katsuki,M. and Sekiguchi,M. (1996) Targeted disruption of the DNA repair methyltransferase gene renders mice hypersensitive to alkylating agent. Carcinogenesis, 17, 1215–1220.[Abstract/Free Full Text]
  17. Sakumi,K., Shiraishi,A., Shimizu,S., Tsuzuki,T., Ishikawa,T. and Sekiguchi,M. (1997) Methylnitrosourea-induced tumorigenesis in MGMT gene knockout mice. Cancer Res., 57, 2415–2418.[Abstract/Free Full Text]
  18. Iwakuma,T., Sakumi,K., Nakatsuru,Y., Kawate,H., Igarashi,H., Shiraishi,A., Tsuzuki,T., Ishikawa,T. and Sekiguchi,M. (1993) High incidence of nitrosamine-induced tumorigenesis in mice lacking DNA repair methyltransferase. Carcinogenesis, 18, 1631–1635.[Abstract/Free Full Text]
  19. Branch,P., Aquilina,G., Bignami,M. and Karran,P. (1993) Defective mismatch binding and a mutator phenotype in cells tolerant to DNA damage. Nature, 362, 652–654.[Medline]
  20. Kat,A., Thilly,W.G., Fang,W.H., Longley,M.J., Li,G.M. and Modrich,P. (1993) An alkylation-tolerant, mutator human cell line is deficient in strand-specific mismatch repair. Proc. Natl Acad. Sci. USA, 90, 6424–6428.[Abstract/Free Full Text]
  21. de Wind,N., Dekker,M., Berns,A., Radman,M. and te Riele,H. (1995) Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination and predisposition to cancer. Cell, 82, 321–330.[ISI][Medline]
  22. Kawate,H., Sakumi,K., Tsuzuki,T., Nakatsuru,Y., Ishikawa,T., Takahashi,S., Takano,H., Noda,T. and Sekiguchi,M. (1998) Separation of killing and tumorigenic effects of an alkylating agent in mice defective in two of the DNA repair genes. Proc. Natl Acad. Sci. USA, 95, 5116–5120.[Abstract/Free Full Text]
  23. de Wind,N., Dekker,M., van Rossum,A., van der Valk,M. and te Riele,H. (1998) Mouse models for hereditary nonpolyposis colorectal cancer. Cancer Res., 58, 248–255.[Abstract/Free Full Text]
  24. Prolla,T.A., Baker,S.M., Harris,A.C., Tsao,J.L., Yao,X., Bronner,C.E., Zheng,B., Gordon,M., Reneker,J., Arnheim,N., Shibata,D., Bradley,A. and Liskay,R.M. (1998) Tumour susceptibility and spontaneous mutation in mice deficient in Mlh1, Pms1 and Pms2 DNA mismatch repair. Nature Genet., 18, 276–279.[ISI][Medline]
  25. Leach,F.S., Nicolaides,N.C., Papadopoulos,N., Liu,B., Jen,J., Parsons,R., Peltomäki,P., Sistonen,P., Aaltonen,L.A., Nystrom-Lahti,M., Guan,X.-Y., Zhang,J., Meltzer,P.S., Yu,J.-W., Kao,F.-T., Chen,D.J., Cerosaletti,K.M., Fournier,R.E.K., Todd,S., Lewis,T., Leach,R.J., Naylor,S.L., Weissenbach,J., Mecklin,J.-P., Jarvinen,H., Petersen,G.M., Hamilton,S.R., Green,J., Jass,J., Watson,P., Lynch,H.T., Trent,J.M., de la Chapelle,A., Kinzler,K.W. and Vogelstein,B. (1993) Mutations of a mutS homolog in hereditary nonpolyposis colorectal cancer. Cell, 75, 1215–1225.[ISI][Medline]
  26. Bronner,C.E., Baker,S.M., Morrison,P.T., Warren,G., Smith,L.G., Lescoe,M.K., Kane,M., Earabino,C., Lipford,J., Lindblom,A., Tannergard,P., Bollag,R.J., Godwin,A.R., Ward,D.C., Nordenskjold,M., Fishel,R., Kolodner,R. and Liskay,R.M. (1994) Mutation in the DNA mismatch repair gene homologue hMLH1 is associated with hereditary non-polyposis colon cancer. Nature, 368, 258–261.[Medline]
  27. Papadopoulos,N., Nicolaides,N.C., Wei,Y.F., Ruben,S.M., Carter,K.C., Rosen,C.A., Haseltine,W.A., Fleischmann,R.D., Fraser,C.M., Adams,M.D., Venter,J.C., Hamilton,S.R., Petersen,G.M., Watson,P., Lynch,H.T., Peltomäki,P. Mecklin,J.-P., de la Chapelle,A., Kinzler,K.W. and Vogelstein,B. (1994) Mutation of a mutL homolog in hereditary colon cancer. Science, 263, 1625–1629.[Abstract/Free Full Text]
  28. Kolodner,R.D., Hall,N.R., Lipford,J., Kane,M.F., Morrison,P.T., Finan,P.J., Burn,J., Chapman,P., Earabino,C., Merchant,E. and Bishop,T. (1995) Structure of the human MLH1 locus and analysis of a large hereditary nonpolyposis colorectal carcinoma kindred for mlh1 mutations. Cancer Res., 55, 242–248.[Abstract/Free Full Text]
  29. Modrich,P. and Lahue,R. (1996) Mismatch repair in replication fidelity, genetic recombination and cancer biology. Annu. Rev. Biochem., 65, 101–133.[ISI][Medline]
  30. Papadopoulos,N. and Lindblom,A. (1997) Molecular basis of HNPCC: mutations of MMR genes. Hum. Mutat., 10, 89–99.[ISI][Medline]
  31. Jiricny,J. (1998) Eukaryotic mismatch repair: an update. Mutat. Res., 409, 107–121.[ISI][Medline]
  32. Ihara,K., Kawate,H., Chueh,L.L., Hayakawa,H. and Sekiguchi,M. (1994) Requirement of the Pro-Cys-His-Arg sequence for O6-methylguanine-DNA methyltransferase activity revealed by saturation mutagenesis with negative and positive screening. Mol. Gen. Genet., 243, 379–389.[ISI][Medline]
  33. Koera,K., Nakamura,K., Nakao,K., Miyoshi,J., Toyoshima,K., Hatta,T., Otani,H., Aiba,A. and Katsuki,M. (1997) K-ras is essential for the development of the mouse embryo. Oncogene, 15, 1151–1158.[ISI][Medline]
  34. Newcomb,E.W., Steinberg,J.J. and Pellicer,A. (1988) ras oncogenes and phenotypic staging in N-methylnitrosourea- and gamma-irradiation-induced thymic lymphomas in C57BL/6J mice. Cancer Res., 48, 5514–5521.[Abstract/Free Full Text]
  35. Romach,E., Moore,J., Rummel,S. and Richie,E. (1994) Influence of sex and carcinogen treatment protocol on tumor latency and frequency of K-ras mutations in N-methyl-N-nitrosourea-induced lymphomas. Carcinogenesis, 15, 2275–2280.[Abstract/Free Full Text]
  36. Tominaga,Y., Tsuzuki,T., Shiraishi,A., Kawate,H. and Sekiguchi,M. (1997) Alkylation-induced apoptosis of embryonic stem cells in which the gene for DNA-repair, methyltransferase, had been disrupted by gene targeting. Carcinogenesis, 18, 889–896.[Abstract/Free Full Text]
  37. Edelmann,W., Yang,K., Kuraguchi,M., Heyer,J., Lia,M., Kneitz,B., Fan,K., Brown,A.M., Lipkin,M. and Kucherlapati,R. (1999) Tumorigenesis in Mlh1 and Mlh1/Apc1638N mutant mice. Cancer Res., 59, 1301–1307.[Abstract/Free Full Text]
  38. Shcherbakova,P.V. and Kunkel,T.A. (1999) Mutator phenotypes conferred by MLH1 overexpression and by heterozygosity for mlh1 mutations. Mol. Cell. Biol., 19, 3177–3183.[Abstract/Free Full Text]
Received September 13, 1999; revised October 22, 1999; accepted October 25, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
M. Sanada, M. Hidaka, Y. Takagi, T. Y. Takano, Y. Nakatsu, T. Tsuzuki, and M. Sekiguchi
Modes of actions of two types of anti-neoplastic drugs, dacarbazine and ACNU, to induce apoptosis
Carcinogenesis, December 1, 2007; 28(12): 2657 - 2663.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
K. Torisu, D. Tsuchimoto, Y. Ohnishi, and Y. Nakabeppu
Hematopoietic Tissue-Specific Expression of Mouse Neil3 for Endonuclease VIII-Like Protein
J. Biochem., December 1, 2005; 138(6): 763 - 772.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
V. A. Barvaux, M. Ranson, R. Brown, R. S. McElhinney, T. B. H. McMurry, and G. P. Margison
Dual repair modulation reverses Temozolomide resistance in vitro
Mol. Cancer Ther., February 1, 2004; 3(2): 123 - 127.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
G. P. Margison, M. F. Santibanez Koref, and A. C. Povey
Mechanisms of carcinogenicity/chemotherapy by O6-methylguanine
Mutagenesis, November 1, 2002; 17(6): 483 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. C. Povey, A. F. Badawi, D. P. Cooper, C. N. Hall, K. L. Harrison, P. E. Jackson, N. P. Lees, P. J. O'Connor, and G. P. Margison
DNA Alkylation and Repair in the Large Bowel: Animal and Human Studies
J. Nutr., November 1, 2002; 132(11): 3518S - 3521.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
C. Colussi, S. Fiumicino, A. Giuliani, S. Rosini, P. Musiani, C. Macri, C. S. Potten, M. Crescenzi, and M. Bignami
1,2-Dimethylhydrazine-Induced Colon Carcinoma and Lymphoma in msh2-/- Mice
J Natl Cancer Inst, October 17, 2001; 93(20): 1534 - 1540.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (25)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kawate, H.
Right arrow Articles by Sekiguchi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kawate, H.
Right arrow Articles by Sekiguchi, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?