Carcinogenesis, Vol. 21, No. 4, 817-821,
April 2000
© 2000 Oxford University Press
Short Communications |
Characterization of the murine p19ARF promoter CpG island and its methylation pattern in primary lymphomas
Laboratorio de Genética Molecular Humana, Departamento de Biología, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain,
1 Centro Nacional de Investigaciones Oncológicas Carlos III, Crta. Majadahonda-Pozuelo, km 2, 28220 Majadahonda, Madrid and Centro Nacional de Biotecnología, CSIC, Campus de Cantoblanco, 28049 Madrid, Spain and
2 Department of Pathology and Kaplan Comprehensive Cancer Center, New York University, 550 First Avenue, New York, NY 10016, USA
| Abstract |
|---|
|
|
|---|
The INK4a/ARF locus encodes two different proteins involved in cell cycle control. Both molecules, p16INK4a and p19ARF, inhibit cell cycle progression and have been shown to act as tumor suppressors in a variety of models. Their expression is controlled by separate promoters responding to different stimuli and they therefore show independent transcriptional regulation. We have cloned and characterized a 2.5 kb region upstream of the murine p19ARF gene to determine the role of DNA methylation in suppressing p19ARF transcription in a wide panel of murine primary T cell lymphomas. This region contains a DNA fragment with the characteristics of a CpG island similar to those described for the murine p16INK4a and p15INK4b genes. Expression of p19ARF is decreased in a significant number (20%) of the murine lymphomas analyzed. Overexpression of the p19ARF transcript is also frequent, suggesting alterations in molecules of the retinoblastoma or p53 pathways that are involved in p19ARF regulation. Although hypermethylation of the INK4a and INK4b promoters is frequently involved in murine lymphomas, the p19ARF CpG island is infrequently methylated in the murine primary lymphomas studied in this work. Since loss of p19ARF expression cannot be explained as the result of homozygous deletions or hypermethylation of the ARF gene, other regulatory mechanisms seem to be altered in these malignancies.
Abbreviations: Rb, retinoblastoma; pRb, retinoblastoma protein.
| Introduction |
|---|
|
|
|---|
Disruption of the pRb or p53 pathways has been shown to be involved in most tumor types, although these genes are not essential for completion of the cell division cycle. Both pathways are regulated by the products of a single genetic locus, INK4a/ARF, which encodes two potent tumor suppressor genes (reviewed in refs 13). The p16INK4a protein (also known as MTS1, p16
) is an inhibitor of specific cyclinCDK complexes (cyclin DCDK4/6) which in turn regulate the phosphorylation of pRb, thus controlling progression from the G1 to S phase of the cell cycle. The p19ARF protein, although sharing exons 2 and 3 of the INK4a/ARF locus, is completely different in its amino acid sequence, with no homology to other known proteins. p19ARF has been shown to participate in regulation of the p53 pathway. By means of binary and/or ternary complexes together with the p53 and/or Mdm2 proteins, p19ARF is involved in the control of levels of p53 (47). Recently, the mechanism by which p19ARF activates p53 has been explained by its ability to bind and sequester Mdm2. p19ARF, which localizes to nucleoli, is able to form binary complexes with Mdm2, sequestering it into the nucleolus, thereby preventing negative feedback regulation of p53 by Mdm2 and leading to activation of p53 in the nucleoplasm (810). The two cell cycle inhibitors, p16INK4a and p19ARF, seem to be regulated through different mechanisms. p16INK4a appears to be regulated by the retinoblastoma protein (pRb), responds to Ras oncogenic stimulus and is induced in replicative senescence (1113). This tumor suppressor gene is frequently inactivated by homozygous deletions (in many cases also involving p15INK4b, which is located very close on the chromosome), point mutations in the coding sequence or hypermethylation of the CpG island in the promoter region in various types of malignancies (1417). The expression of p19ARF, in contrast, has been found to be regulated by several molecules in addition to Ras, including Myc, E2F-1 and E1A, and is down-regulated by p53, although no binding sequences for p53 have been found in its promoter (1822). Recently, the transcription factor DMP1 has been shown to play an important role in p19ARF induction in response to anti-proliferative signals (23). In humans, the p19ARF (also named p14ARF) promoter has been cloned and sequenced (19,21) and it has been shown to be hypermethylated in some cell lines, correlating with suppression of promoter activity (21).
In order to analyze the methylation status of the p19ARF promoter in primary tumors, we have cloned and sequenced the murine p19ARF promoter and studied hypermethylation of this region as a model for the inactivation of p19ARF expression in a set of 64 murine primary T cell lymphomas. A screen survey of a
129/SvJ mouse genomic library with a p16INK4a exon 2 PCR probe (24) identified a genomic clone containing a 14 kb DNA fragment downstream of p15INK4b. The downstream DNA region p15INK4b was characterized by restriction analysis and exon 1ß of p19ARF was localized 12 kb downstream of p15INK4b by hybridization with specific probes (Figure 1
). Sequencing of a 5 kb XbaI fragment was carried out with an ABI DNA Automated Sequencer 377 (Perkin Elmer) and sequencing primers designed with the program Primer3 (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). The exon 1ß sequence is identical to that published by Quelle et al. (25) with the exception of a polymorphism (G
A) in position +21 from the transcriptional start site as defined by Inoue et al. (23). The estimated distance between the p19ARF and p16INK4a promoters is 13 kb (Figure 1
).
|
The murine p19ARF promoter shows many of the characteristics of a housekeeping gene similar to the human promoter (21), including the absence of a consensus TATA box and a sequence with homology to other initiator sequences (AAGGGGCTGGGGGCGGCGCTTCTCACCTCGCTTGTCA;the bold G indicates the transcription initiation site as reported in ref. 23). The presence of a CpG island was analyzed using the parameters described previously (24). Computer analysis detected a 1 kb region with the characteristics of a CpG island immediately upstream of exon 1 of p19ARF (Figure 1
The analysis of potential transcriptional binding sites was carried out using several public computer resources, such as TFSEARCH (http://www.genome.ed.jp/SIT/TFSEARCH.html) and MatsInspector (http://www.gsf.de/cgi-bin/matsearch.pl). Numerous potential transcription factor binding sites are located upstream of the transcription initiation site and within the CpG island, including binding sites for the transcription factors Sp1, DMP1 and members of the E2F family (Figure 1
). The importance of the E2F and DMP1 binding sites in human p19ARF regulation has been previously studied (21,23) and Sp1 binding domains are frequently found in the CpG islands of many genes (28) and, in some cases, are involved in protection against de novo methylation of CpG islands (29). In the murine p19ARF promoter sequence described in this study, potential Sp1 sites are at positions 10 (GGGGCTGGGG), 50 (GGGGCGG), 84 (GGGCGG), 290 (GGGCGG), 485 (GGGCCGG) and 730 (GGGGCGGGGA) relative to the transcriptional start site. E2F consensus sites are located at positions 134 (TTTCCCGC), 205 (GCGCGGGA, minus strand), 360 (GAGCGAAA, minus strand) and 830 (TTTCGCGG). A DMP1/Ets binding site at position 185 (CCCGGATGC) has been functionally characterized previously (23). In general, the organization and the number of transcription factor binding sequences are similar to those of the human ARF promoter (21).
Since p19ARF is frequently inactivated in a variety of tumors, we have carried out RTPCR expression analysis of the p19ARF gene with RNAs extracted from 110 T cell lymphomas induced with
-irradiation in BCF1 (C57BL/6J malesxBALBc/J females), CBF1 (BALBc/J malesxC57BL/6J females) and BRF1 (C57BL76J femalesxRF/J males) hybrids. Thymic lymphomas were induced using whole body
-irradiation as described (29,30). Normal and tumoral tissues were collected for histology and DNA and RNA analyses. Non-irradiated F1 hybrids were used as controls to compare the level of basal expression in the thymus. RTPCR analysis of p19ARF expression was carried out with 10 µg of total RNA reverse transcribed using a random hexanucleotide mix (Roche Molecular Biochemicals) and 3 U of AMV reverse transcriptase (Finnzymes Oy) in the appropriate buffer. One microliter of this reaction was then used for gene-specific PCR amplification. In each sample, analysis of the CDK4 gene was used as a control for the validity of the cDNA mixture and DNA genomic contamination (data not shown). Primers used for CDK4 amplification were CDK4-F (5'-TGG CTG CCA CTC GAT ATG AAC-3') and CDK4-R (5'-CCT CAG GTC CTG GTC TAT ATG-3'). Cycling conditions were: 94°C for 5 min; 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min; a final step of 7 min at 72°C. Under these conditions, a 302 bp band is amplified from the processed RNA and a 400 bp genomic fragment (containing a small intron) is amplified when the samples are contaminated with genomic DNA. RNA preparations with genomic DNA contamination were removed from the study. p19ARF cDNA amplification was carried out using primers p16-1ßF (5'-AGT ACA GCA GCG GGA GCA TG-3') (31) and p16-1R (5'-TAG CTC TGC TCT TGG GAT TG-3') (24) and cycling conditions were: 94°C for 5 min; 35 cycles of 94°C for 30 s, 60°C for 45 s and 72°C for 2 min; a final step of 7 min at 72°C. Detection was carried out by 1.5% agarose gel electrophoresis and transfer to nylon membranes. Filters were hybridized with a PCR probe of exon 1ß of p19ARF (primers described in ref. 31), labeled and detected using the digoxigenin system (Roche Molecular Biochemicals). Scanning and densitometry of the autoradiographs (1D Analysis and Hand Scanner Settings; Biomed Instruments, Zeineh Programs) were performed to quantify the PCR products. ß-Actin amplification (24) was used as a control of RNA integrity and concentration. Results revealed that 15.6% (10/64) of the tumors showed absence of the p19ARF cDNA band while ß-actin analysis revealed normal expression (Figure 2
). Nine percent of the tumors (6/64) presented decreased p19ARF mRNA expression as compared with controls and ~47% of the tumors (30/64) showed augmented mRNA expression. In 28% (18/64) of the cases, p19ARF expression levels were indistinguishable from those obtained in control tissues.
|
In order to study whether the absence of p19ARF expression was due to de novo methylation of the promoter sequences, we carried out methylation analyses of the CpG island. Different methylation-sensitive restriction endonucleases within the most CpG-rich region of the promoter were selected. Thus, we carried out double digestions of tumor DNA with XhoI, SmaI or EagI together with the methylation-insensitive restriction enzyme EcoRI. Twenty micrograms of genomic DNA were double digested with EcoRI and the methylation-sensitive restriction enzymes under the conditions recommended by the manufacturer (Roche Molecular Biochemicals or New England Biolabs). Digested DNA was subjected to 0.8% agarose gel electrophoresis and transferred to nylon membranes (Roche Molecular Biochemicals). Filters were then hybridized with an [
-32P]dCTP random primed-labeled PCR probe for exon 1ß of p19ARF and autoradiographs were developed after 45 days exposure. Southern blots of 34 genomic DNAs from T cell primary lymphomas doubly digested with EcoRI and XhoI were hybridized with a p19ARF exon 1ß probe. No methylation at the XhoI site was detected in any of the tumors studied (Figure 2
DNA methylation of regulatory regions has been accepted as a common mechanism for the inactivation of tumor suppressor genes in cancer (32). CpG islands in the promoter region of housekeeping genes are usually non-methylated in normal tissues but, in the case of some tumor suppressor genes, can suffer de novo methylation leading to transcriptional inactivation (15,16,24,32). This mechanism has been shown to be responsible for the loss of p15INK4b and p16INK4a expression in murine lymphomas induced by different treatments (24,33,34). This is specially relevant in the case of p15INK4b, a tumor suppressor gene specifically altered in hematopoietic malignancies, where hypermethylation in its regulatory sequences occurs independent of p16INK4a alterations. Although the human p19ARF promoter has been found to be methylated in some cell lines (21), we have found only rare cases of partial methylation at the EagI site in a proximal location to exon 1ß in primary tumors. This methylation, however, does not extend to a second EagI site in the 5'-region of the CpG island (Figure 1
). Similarly, methylation of the human p19ARF CpG island does not extend significantly beyond 450 relative to the transcription start site (21). Although DNA hypermethylation in the promoter region of tumor suppressor genes usually correlates with decreased expression, that is not the case for our two positive samples, where the level of methylation present is insufficient to suppress transcription, as these samples express significant amounts of p19ARF RNA.
The specificity of DNA methylation in the different CpG islands of the INK4bINK4a/ARF loci is an intriguing finding. Although these sequences are located in close proximity on the chromosome (Figure 1
) there is an interesting specificity in their methylation patterns in mouse lymphomas. These differences can be explained as a result of the specific role of each protein in different tissues since different transcription factors can be involved in their transcriptional regulation and can interfere in de novo methylation. In fact, binding of Sp1 molecules to its binding sites can protect against methylation in some promoters (29,35,36).
p19ARF expression is lost or reduced in a significant percentage of these tumors with neither deletion of the INK4a/ARF locus (unpublished results) nor methylation in their promoter sequences. Alternative mechanisms must therefore account for the loss of p19ARF expression. These could include small deletions or mutations in the promoter, alterations in the regulatory proteins involved in p19ARF expression or stability of its transcript. Some sequences in the human ARF promoter that are important for p19ARF expression show no obvious consensus sites for known transcription factors (21). Thus, further explanations for the loss of p19ARF expression in tumors could arise once the regulatory mechanisms for p19ARF expression are clarified.
Overexpression of the ARF transcript in almost 50% of the tumors analyzed should be more easily explained as a function of its transcriptional regulation. For instance, ARF levels are increased in some p53-deficient cell lines (25,37) and this effect could depend on a lack of repression by p53 of the ARF promoter (21). We have therefore studied the status of p53 in our lymphomas by western analysis and sequencing. As described previously (38), p53 is infrequently inactivated in induced murine lymphomas and, in our hands, only two out of 30 tumors presented a p53 mutation (data not shown). Alternatively, the inactivation of p53 could be due to overexpression of mdm2 and we are currently analyzing the expression of this p53 regulator in our panel of tumors. In addition to deregulation of the p53 pathway, overexpression of p19ARF could occur in response to deregulation of the retinoblastoma (Rb) pathway. The ARF promoter is highly responsive to overexpression of the transcription factors of the E2F family (21) and any increase in pRb phosphorylation by activation of CDK2, 4 or 6 or deletions and mutations in pRb would result in E2F activation. We have analyzed the expression of pRb, cyclin D1 and the p15INK4b and p16INK4a inhibitors in a wide panel of mouse primary lymphomas induced by irradiation (24,33,39). Deregulation of the Rb pathway is found in more than 75% of the tumors analyzed and most tumors with increased p19ARF expression show an alteration in at least one of the Rb regulators. Any of these alterations, loss of pRb, overexpression of cyclin D1 or p15INK4b and p16INK4a inactivation, would produce increased levels of active cellular E2F proteins, giving rise to p19ARF overexpression. Therefore, the increased levels of p19ARF in some tumors is likely to be due to additional alterations in other members of the p53 and/or Rb pathways.
In summary, we have described here the genomic sequence upstream of the mouse p19ARF gene, showing the presence of a CpG island susceptible to de novo methylation and corresponding transcriptional down-regulation. A recent report on human tumors has shown that the human p19ARF gene is infrequently methylated in human B and T cell lymphomas (40). In our hands, p19ARF expression is frequently lost or decreased in
-irradiation-induced mouse primary thymic lymphomas (up to 20% of the tumors), although this alteration cannot be explained as a result of CpG hypermethylation at the promoter sequences.
| Acknowledgments |
|---|
I.P.C. received a fellowship from the Ministerio de Educación y Cultura (Madrid, Spain). This work was supported by grants PM 96/001 (Ministerio de Educación y Cultura, Spain) and 08/0009/1997 (Comunidad Autónoma de Madrid) and the Fundación Ramón Areces (Spain) to J.F.-P., grant BIOMED2 (BMH4-98-3426) to J.S. and grant CA 36327 (NIH, USA) to A.P.
| Notes |
|---|
3 To whom correspondence should be addressed Email; jf.piqueras{at}uam.es
* The first two authors contributed equally to this work. ![]()
| References |
|---|
|
|
|---|
-
Sherr,C.J. (1998) Tumor surveillance via the ARF-p53 pathway. Genes Dev., 12, 29842991.
[Free Full Text] - Chin,L., Pomerantz,J. and DePinho,R.A. (1998) The INK4a/ARF tumor suppresor: one genetwo productstwo pathways. Trends Biochem. Sci., 23, 291296.[Web of Science][Medline]
- Sharpless,N.E. and DePinho,R.A. (1999) The INK4A/ARF locus and its two gene products. Curr. Opin. Genet. Dev., 9, 2230.[Web of Science][Medline]
-
Kamijo,T., Weber,J.D., Zambetti,G., Zyndy,F., Roussel,M.F. and Sherr,C.J. (1998) Functional and physical interactions of the ARF tumor suppressor with p53 and Mdm2. Proc. Natl Acad. Sci. USA, 95, 82928297.
[Abstract/Free Full Text] - Pomerantz,J., Schreiber-Agus,N., Liegeois,N.J., Silverman,A., Alland,L., Chin,L., Potes,J., Chen,K., Orlow,I., Lee,H.-W., Cordon-Cardo,C. and DePinho,R.A. (1998) The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53. Cell, 92, 713723.[Web of Science][Medline]
- Stott,F.J., Bates,S., James,M.C., McConnell,B.B., Starborg,M., Brookes,S., Palmero,I., Ryan,K., Hara,E., Vousden,K.H. and Peters,G. (1998) The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. EMBO J., 17, 50015014.[Web of Science][Medline]
- Zhang,Y., Xiong,Y. and Yarbrough,W.G. (1998) ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell, 92, 725734.[Web of Science][Medline]
- Weber,J.D., Taylor,L.J., Roussel,M.F., Sherr,C.J. and Bar-Sagi,D. (1999) Nucleolar Arf sequesters Mdm2 and activates p53. Nature Cell Biol., 1, 2026.[Web of Science][Medline]
-
Tao,W. and Levine,A.J. (1999) P19(ARF) stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2. Proc. Natl Acad. Sci. USA, 96, 69376941.
[Abstract/Free Full Text] - Zhang,Y. and Xiong,Y. (1999) Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53. Mol. Cell, 3, 579591.[Web of Science][Medline]
- Hara,E., Smith,R., Parry,D., Tahara,H., Stone,S. and Peters,G. (1996) Regulation of p16CDKN2 expression and its implications for cell immortalization and senescence. Mol. Cell. Biol., 16, 859867.[Abstract]
- Serrano,M., Lin,A.W., McCurrach,M.E., Beach,D. and Lowe,S.W. (1997) Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell, 88, 593602.[Web of Science][Medline]
-
Huschtscha,L.I. and Reddel,R.R. (1999) p16(INK4a) and the control of cellular proliferative life span. Carcinogenesis, 20, 921926.
[Abstract/Free Full Text] -
Gonzalez-Zulueta,M., Bender,C.M., Yang,A.S., Nguyen,T.-D., Beart,R.W., VanTornout,J.M. and Jones,P.A. (1995) Methylation of the CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res., 55, 45314535.
[Abstract/Free Full Text] -
Herman,J.G., Merlo,A., Mao,L., Lapidus,R.G., Issa,J.P., Davidson,N.E., Sidransky,D. and Baylin,S.B. (1995) Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res., 55, 45254530.
[Abstract/Free Full Text] - Merlo,A., Herman,J.G., Mao,L., Lee,D.J., Gabrielson,E., Burger,P.C., Baylin,S.B. and Sidransky,D. (1995) 5' CpG island methylation is associated with transcriptional silencing of the tumor suppressor p16/CDKN2/MTS1 in human cancers. Nature Med., 1, 686692.[Web of Science][Medline]
- Ruas,M. and Peters,G. (1998) The p16INK4a/CDKN2A tumor suppressor and its relatives. Biochim. Biophys. Acta, 1378, F115F177.[Medline]
-
Zindy,F., Eischen,C.M., Randle,D.H., Kamijo,T., Cleveland,J.L., Sherr,C.J. and Roussel,M.F. (1998) Myc signaling via the ARF tumor suppressor regulates p53-dependent apoptosis and immortalization. Genes Dev., 12, 24242433.
[Abstract/Free Full Text] - Bates,S., Phillips,A.C., Clark,P.A., Stott,F., Peters,G., Ludwig,R.L. and Vousden,K.H. (1998) p14ARF links the tumour suppressors RB and p53. Nature, 395, 124125.[Medline]
-
Stanchina,E., McCurrach,M.E., Zindy,F., Shieh,S.-Y., Ferbeyre,G., Samuelson,A.V., Prives,C., Roussel,M.F., Sherr,C.J. and Lowe,S.W. (1998) E1A signaling to p53 involves the p19ARF tumor suppressor. Genes Dev., 12, 24342442.
[Abstract/Free Full Text] -
Robertson,K.D. and Jones,P.A. (1998) The human ARF cell cycle regulatory gene promoter is a CpG island which can be silenced by DNA methylation and down-regulated by wild-type p53. Mol. Cell. Biol., 18, 64576473.
[Abstract/Free Full Text] - Palmero,I., Pantoja,C. and Serrano,M. (1998) p19ARF links the tumour suppressor p53 to Ras. Nature, 395, 125126.[Medline]
-
Inoue,K., Roussel,M.F. and Sherr,C.J. (1999) Induction of ARF tumor suppressor gene expression and cell cycle arrest by transcription factor DMP1. Proc. Natl Acad. Sci. USA, 96, 39933998.
[Abstract/Free Full Text] - Malumbres,M., Perez de Castro,I., Santos,J., Melendez,B., Mangues,R., Serrano,M., Pellicer,A. and Fernandez-Piqueras,J. (1997) Inactivation of the cyclin-dependent kinase inhibitor p15INK4b by deletion and de novo methylation with independence of p16INK4a alterations in murine primary T-cell lymphomas. Oncogene, 14, 13611370.[Web of Science][Medline]
- Quelle,D.E., Zindy,F., Ashmun,R.A. and Sherr,C.J. (1995) Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83, 9931000.[Web of Science][Medline]
- Gardiner-Garden,M. and Frommer,M. (1987) CpG islands in vertebrate genomes. J. Mol. Biol., 196, 261282.[Web of Science][Medline]
- Antequera,F. and Bird,A. (1993) In Jost,J.P. and Saluz,H.P. (eds) DNA Methylation: Molecular Biology and Biological Significance. Birkhäuser Verlag, Basel, Switzerland, pp. 169185.
-
Macleod,D., Charlton,J., Mullins,J. and Bird,A.P. (1994) Sp1 sites in the mouse Aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev., 8, 22822292.
[Abstract/Free Full Text] - Guerrero,I. and Pellicer,A. (1987) Mutational activation of oncogenes in animal model systems of carcinogenesis. Mutat. Res., 18, 293308.
-
Santos,J., Pérez de Castro,I., Herranz,M., Pellicer,A. and Fernández-Piqueras,J. (1996) Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in
-radiation-induced mouse primary thymic lymphomas. Oncogene, 12, 669676.[Web of Science][Medline]
-
Herzog,C.R., Soloff,E.V., McDoniels,A.L., Tyson,F.L., Malkinson,A.M., Haugen-Strano,A., Wiseman,R.W., Anderson,M.W. and You,M. (1996) Homozygous codeletion and differential decreased expression of p15INK4b, p16INK4a-
and p16INK4a-ß in mouse lung tumor cells. Oncogene, 13, 18851891.[Web of Science][Medline]
- Baylin,S.B., Herman,J.G., Graff,J.R., Vertino,P.M. and Issa,J.P. (1998) Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72, 141196.[Web of Science][Medline]
- Malumbres,M., Pérez de Castro,I., Santos,J., Fernández-Piqueras,J. and Pellicer,A. (1999) Hypermethylation of the cell cycle inhibitor p15INK4b 3'-untranslated region interferes with its transcriptional regulation in primary lymphomas. Oncogene, 18, 385396.[Web of Science][Medline]
-
Zhuang,S.M., Schippert,A., Haugen-Strano,A., Wiseman,R.W and Söderkvist,P. (1998) Inactivations of p16INK4a-
, p16INK4a-ß and p15INK4b genes in 2',3'-dideoxycytidine- and 1,3-butadiene-induced murine lymphomas. Oncogene, 16, 803808.[Web of Science][Medline]
-
Mummaneni,P., Yates,P., Simpson,J., Rose,J. and Turker,M.S. (1998) The primary function of a redundant Sp1 binding site in the mouse aprt gene promoter is to block epigenetic gene inactivation. Nucleic Acids Res., 26, 51635169.
[Abstract/Free Full Text] - Siegfried,Z., Eden,S., Mendelsohn,M., Feng,X., Tsuberi,B.Z. and Cedar,H. (1999) DNA methylation represses transcription in vivo. Nature Genet., 22, 203206.[Web of Science][Medline]
- Kamijo,T., Zindy,F., Roussel,M.F., Quelle,D.E., Downing,J.R., Ashmun,R.A., Grosveld,G. and Sherr,C.J. (1997) Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell, 91, 649659.[Web of Science][Medline]
-
Brathwaite,O., Bayona,W. and Newcomb,E.W. (1992) p53 mutations in C57BL/6J murine thymic lymphomas induced by gamma-irradiation and N-methylnitrosourea. Cancer Res., 52, 37913795.
[Abstract/Free Full Text] -
Pérez de Castro,I., Malumbres,M., Santos,J., Pellicer,A. and Fernández-Piqueras,J. (1999) Cooperative alterations of Rb pathway regulators in mouse primary T cell lymphomas. Carcinogenesis, 20, 16751682.
[Abstract/Free Full Text] -
Baur,A.S., Shaw,P., Burri,N., Delacretaz,F., Bosman,F.T. and Chaubert,P. (1999) Frequent methylation silencing of p15/INK4b (MTS2) and p16/INK4a (MTS1) in B-cell and T-cell lymphomas. Blood, 94, 17731781.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M.M. de Yzaguirre, J.S. Hernandez, P.F. Navarro, P.L. Nieva, M. Herranz, M.F. Fraga, M. Esteller, A. Juarranz, and J. Fernandez-Piqueras Epigenetic silencing of E- and N-cadherins in the stroma of mouse thymic lymphomas Carcinogenesis, May 1, 2006; 27(5): 1081 - 1089. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lopez-Nieva, J. Santos, and J. Fernandez-Piqueras Defective expression of Notch1 and Notch2 in connection to alterations of c-Myc and Ikaros in {gamma}-radiation-induced mouse thymic lymphomas Carcinogenesis, July 1, 2004; 25(7): 1299 - 1304. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Tam, T. R. Devereux, A. C. Patel, J. F. Foley, R. R. Maronpot, and T. E. Massey Perturbations of the Ink4a/Arf gene locus in aflatoxin B1-induced mouse lung tumors Carcinogenesis, January 1, 2003; 24(1): 121 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sotillo, J. F. Garcia, S. Ortega, J. Martin, P. Dubus, M. Barbacid, and M. Malumbres Invasive melanoma in Cdk4-targeted mice PNAS, October 16, 2001; (2001) 241338598. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakamura, T. Sakaki, H. Hashimoto, H. Nakase, E. Ishida, K. Shimada, and N. Konishi Frequent Alterations of the p14ARF and p16INK4a Genes in Primary Central Nervous System Lymphomas Cancer Res., September 1, 2001; 61(17): 6335 - 6339. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Serrano The INK4a/ARF locus in murine tumorigenesis Carcinogenesis, May 1, 2000; 21(5): 865 - 869. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sotillo, J. F. Garcia, S. Ortega, J. Martin, P. Dubus, M. Barbacid, and M. Malumbres Invasive melanoma in Cdk4-targeted mice PNAS, November 6, 2001; 98(23): 13312 - 13317. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




