Carcinogenesis, Vol. 21, No. 5, 893-900,
May 2000
© 2000 Oxford University Press
Cancer Biology |
Cell activation via CD44 occurs in advanced stages of squamous cell carcinogenesis
Section of Human Anatomy and
1 Section of Biochemistry, Department of Experimental Medicine, University of Genoa, Via De Toni 14, 16132 Genoa and
2 Monoclonal Antibody Unit,
3 Immunopharmacology Unit and
4 Clinical Pathology Unit, National Institute for Cancer Research, Viale R.Benzi, 16132 Genoa, Italy
| Abstract |
|---|
|
|
|---|
Squamous cell carcinoma (SCC) derives from dysplastic or metaplastic stratified epithelia. The process of squamous cell carcinogenesis has been investigated for the potential role of the adhesion molecule CD44, whose standard form (CD44s) and isoforms generated by alternative splicing of variant exons are known to display altered expression during tumorigenesis in other systems. We have utilized an in vitro correlate of squamous cell carcinogenesis, in which progression stages from normal squamous epithelium to dysplastic lesions and to SCC are represented by primary cultures of normal keratinocytes, by human papilloma virus-immortalized keratinocytes (UP) and by HPVimmortalized/v-Ha-ras transfected tumorigenic keratinocytes (UPR). We investigated expression of CD44 and of variant isoforms, from mRNA to intracellular and surface protein levels, and found no relationship between expression of CD44 and stages of squamous cell carcinogenesis. However, when the function of CD44 was analyzed as Ca2+ mobilization ability upon monoclonal antibody binding and crosslinking, signal transduction via CD44 was found only for the neoplastic stage (UPR cells). Ca2+ mobilization was completely independent of density of surface CD44. We have performed similar analyses in an in vitro model of SCC in which four squamous tumor cell lines and UPR cells were sorted according to increasing resistance to external cytotoxic stimuli, i.e. starving conditions, treatment with the retinoid N-(4-hydroxyphenyl)retinamide and cytolytic activity of effector lymphokine-activated killer cells. No relationship between expression of CD44 and level of cell resistance against external cell death-inducing stimuli was found, while CD44-mediated Ca2+ mobilization ability was restricted to the highly resistant tumor cell lines. Our results indicate that the role(s) of CD44 in squamous cell proliferative disorders can be evinced from the functional features of the molecule, rather than from its phenotypic repertoire.
Abbreviations: CD44s, standard form of CD44; CD44V, variant isoform of CD44; ECM, extracellular matrix; EGF, epidermal growth factor; FCS, fetal calf serum; HA, hyaluronic acid; 4-HPR, N-(4-hydroxyphenyl)retinamide; HPV, human papilloma virus; LAK cells, lymphokine-activated killer cells; mAb, monoclonal antibody; PBL, peripheral blood lymphocytes; PBS, phosphate-buffered saline; PI, propidium iodide; SCC, squamous cell carcinoma.
| Introduction |
|---|
|
|
|---|
CD44 is a ubiquitous surface glycoprotein involved in cellcell and cellextracellular matrix (ECM) interactions. Its primary ligand is hyaluronic acid (HA). CD44 is formed by a distal extracellular domain, a membrane-proximal region, a transmembrane spanning domain and a cytoplasmic tail. Twenty exons are involved in assembly of the molecule. The first five exons are constant and encode for the extracellular domain, whereas the next 10 exons (from exon 6 to 15, called variant exons V1V10) are subjected to alternative splicing and generate mRNA isoforms encoding for CD44 molecular forms bearing variable membrane-proximal extracellular domains (1). The last five exons encode for a membrane-proximal extracellular portion and for the transmembrane/cytoplasmic tail domains. In addition to post-transcriptional variations, CD44 isoforms undergo post-translational modifications such as N- and O-glycosylation and glycosaminoglycanation, which further enrich the CD44 repertoire and may increase the optional functions of this molecule (2,3).
The most abundant isoform of CD44 is the standard one (CD44s, 8595 kDa), which lacks the entire variable region and is usually modified by chondroitin sulfate (CD44s-CS, 180200 kDa) (4). While CD44s is expressed on most normal cells, the repertoire of CD44 variants is more restricted, being mainly confined to T lymphocytes and other leukocytes following activation (in particular V6 and V9), to epithelial cells (particularly CD44V8V10, also known as epithelial CD44, 130 kDa) and to keratinocytes (CD44V3V10, one of the largest CD44 isoforms, 230 kDa) (1).
The intracellular domain of CD44 is linked to the cytoskeleton (57) and mediates two broad functions: regulation of cell adhesion via changes in the affinity of CD44 for its ligands (`inside-out' signaling) and signal transduction leading to cell activation and regulation of cell growth and death (`outside-in' signaling) (814).
CD44 has gained interest in oncology following the observation that expression of CD44s and the distribution of its variant isoforms are altered in a variety of tumors and metastases (reviewed in refs 1,15).
Studies of squamous cell carcinoma (SCC), the most frequent cancer arising from dysplastic or metaplastic squamous epithelia, report increased levels of CD44s and unusual expression of CD44 splice variants containing the V5, V7, V8 and, most notably, V6 exon products in pre-invasive and high risk pre-cancerous lesions (1,15). In contrast, other studies showed that progression towards highly invasive undifferentiated squamous tumors is accompanied by a decrease in and subsequent loss of CD44 isoforms (1618) or unaltered expression (19). Thus, it is not clear which specific changes in CD44 confer a selective advantage in the course of SCC transformation. In this respect, it may be relevant to define the role of CD44 relative to the cell's `position' in the squamous malignant transformation sequence.
To this end, we utilized an in vitro model of squamous cell carcinogenesis. This model consists of normal human keratinocytes, human papilloma virus (HPV)-immortalized keratinocytes and tumorigenic keratinocytes (HPV-immortalized/v-Ha-ras-transfected) (`triple keratinocyte model'). This model represents an in vitro correlate of sequential stages of progression from normal to dysplastic squamous epithelium and to SCC (20,21). In addition, we investigated five different tumorigenic SCC cell lines sorted according to their susceptibility to cell death-inducing stimuli.
We have analyzed the expression of CD44 mRNA by RTPCR and suitable primers (22) and of CD44 protein by flow cytometric surface immunophenotyping using monoclonal antibodies to CD44 and to the V5, V6, V7 and V7-8 epitopes and western blot analysis of total cell lysates. We then investigated the functional properties of CD44 and of its splice variants, by Ca2+ mobilization assays using anti-CD44 monoclonal antibodies (mAbs). We found no relationship between the CD44 phenotype and the stage of squamous cell carcinogenesis in the `triple keratinocyte model' nor the level of cell resistance to external cytotoxic stimuli of the squamous tumor cell lines. In contrast, a direct relationship was found between the signal transduction ability of CD44 and the level of cell malignancy and resistance to cell death-inducing stimuli, independent of CD44 qualitative and quantitative expression.
| Materials and methods |
|---|
|
|
|---|
Cells and cell cultures
Human keratinocytes were obtained from skin biopsies of healthy donors and cultured on a lethally irradiated feeder layer of 3T3 fibroblasts, as previously described (23). The non-tumorigenic UP cell line derived from keratinocytes immortalized by transfection with the E6 and E7 early genes of HPV type 16 and the tumorigenic UPR cell line derived from UP by transfection with v-Ha-ras were kindly provided by Dr F.M.Watt (Imperial Cancer Research Fund, London, UK). Keratinocytes and UP and UPR cells were cultured in Dulbecco's modified Eagle's medium and Ham's F12 medium (3:1 mixture) containing 10% fetal calf serum (FCS), 5 µg/ml insulin, 5 µg/ml transferrin, 0.18 mM adenine, 0.4 µg/ml hydrocortisone, 0.1 nM cholera toxin, 2 nM triiodothyronine, 10 ng/ml epidermal growth factor (EGF), 4 mM glutamine and 50 IU/ml penicillin/streptomycin. The SCC cell lines LX-1 and A431, from the American Type Culture Collection (ATCC, Rockville, MD), and ME-180 and HeLa, kindly provided by the Interlab Cell Line Collection (ICLC, National Institute for Cancer Research, Genoa, Italy), were cultured as indicated by the provider. Jurkat cells that lack the entire CD44 gene were from ATCC and represented a negative control.
DNA flow cytometry for apoptosis and cell proliferation
Cells were harvested and fixed in cold 70% ethanol for 24 h. After washing with phosphate-buffered saline (PBS), samples were incubated for 30 min at room temperature with 30 µg/ml propidium iodide (PI) (Sigma Chemical Co., St Louis, MO) and 0.5 mg/ml RNase. Flow cytometric measurements were performed using a FACSCalibur (Becton Dickinson, San Jose, CA) equipped with filters for PI excitation and emission fluorescence. DNA histograms were analyzed for the evaluation of apoptosis and of the percentage of cells in the various phases of the cell cycle, as described (24).
Cytotoxicity assays
Lymphokine-activated killer (LAK) cells were obtained from PBL of healthy donors incubated for 4 days at 37°C with 1000 U/ml IL-2. The susceptibility of tumor cells to LAK cell-induced cytotoxicity was measured in a conventional 4 h 51Cr release assay (25). Briefly, tumor cells were labeled for 1 h with 51Cr (100 µCi/106 cells), washed twice with PBS, resuspended in RPMI with 10% FCS and plated at 5x103 cells/well in 96-well U-bottom plates. Effector cells were plated in triplicate at various LAK cell:tumor cell ratios. After 4 h, 100 µl of supernatant were collected from each well and analyzed in a
counter for 51Cr release. Percent specific lysis was calculated as: [(experimental release spontaneous release)/(maximum release spontaneous release)]x100.
Surface immunofluorescence and flow cytometry
Cells were incubated with mouse mAbs to CD44 (CD44 pan, clone J-173; Immunotech, Marseille, France) and to the variant exon products V5 (clone VFF-8), V6 (clone VFF-18), V7 (clone VFF-9) and V7-8 (co-presence of both exons, clone VFF-17) (Bender MedSystems,Vienna, Austria), followed by FITC-labeled, isotype-specific goat anti-mouse IgG (Southern Biotechnology Associates, Birmingham, AL) as described (26). Controls were provided by cells incubated with the secondary reagent alone. The mean fluorescence intensity was expressed as molecules of equivalent soluble fluorescein units, calculated using calibrated FITC-labeled microbead standards (Flow Cytometry Standards Corp., San Juan, PR) (27).
mRNA analyses by RTPCR
Total RNA was extracted from 107 cells using the RNA Clean solution (TIB Molbiol, Genova, Italy), according to the manufacturer's instructions. One microgram of total RNA was transcribed into cDNA by incubation at 42°C for 1 h with 20 pmol of oligo(dT), 500 µM dNTPs (Roche Molecular Biochemicals, Milano, Italy), 30 U RNase inhibitor (5Prime-3Prime, Boulder, CO), 200 U MLV reverse trancriptase (Gibco BRL Inc., Gaithersburg, MD) in a total volume of 20 µl.
To check mRNA expression of all CD44 isoforms and of isoforms containing the variant exons V5, V6, V7 and V8 the following primers were synthesized: a common CD44 forward primer on exon 5 with sequence GCAACCCTACTGATGATGACG; a CD44 reverse primer on exon 18 with sequence AGGGATGCCAAGATGATCAGC; a CD44 V5 (exon 10) specific reverse primer with sequence GTTTGGCGATATCCCTCATGC; a CD44 V6 (exon 11) specific reverse primer with sequence TTCCTGCTTGATGACCTCGTC; a CD44 V7 (exon 12) specific reverse primer with sequence TGAAAGAGGTCCTGTCCTGTC; a CD44 V8 (exon 13) specific reverse primer with sequence CCTTCATGTGATGTAGAGAAGC.
One microliter of cDNA was amplified using 20 pmol of CD44 forward primer and 20 pmol of one of the reverse primers CD44, CD44 V5, CD44 V6, CD44 V7 or CD44 V8, 200 µM dNTPs, 1.5 mM MgCl2, 1.25 U Taq Gold (Perkin Elmer Corp., Pomona, CA). The reaction was amplified in a Mastercycler Personal (Eppendorf GmbH, Hamburg, Germany) with the following profile: one cycle of 95°C for 10 min; five cycles of 94°C for 60 s, 64°C for 30 s, 72°C for 90 s; 30 cycles of 94°C for 30 s, 64°C for 30 s, 72°C for 90 s; one cycle of 72°C for 5 min. Ten microliters of the product were run in a 1.2% agarose gel and stained with ethidium bromide.
Western blots
Cells (108/ml) were lysed with RIPA buffer (10 mM NaH2PO4, 1 mM EDTA, 1 mM EGTA, 1 mM NaF) containing 150 mM NaCl, 1% Nonidet P40, 1 mM phenylmethylsulfonyl fluoride and 5 µg/ml leupeptin. After nuclei removal by centrifugation at 400 g, the protein concentration was estimated with BCA Protein Assay Reagent (Pierce, Rockford, IL) and 25 µg/lane were fractionated by SDSPAGE on 8% polyacrylamide gels under reducing conditions. The separated polypeptides were blotted to nitrocellulose membranes (Hybond-C Extra; Amersham, Little Chalfont, UK). Protein antigens were detected by incubating the membrane with mAbs to CD44 and to V5, V6, V7 and V7-8 variant exon products (Bender MedSystems) (concentration according to the manufacturer's instructions) in 10 mM TrisHCl buffer, pH 8.0, 150 mM NaCl, 0.01% Tween-20 and 2% (w/v) low fat milk solids, followed by biotin-conjugated goat antibodies to mouse IgG and subsequently by peroxidase-labeled streptavidin. Negative controls were obtained by replacing the anti-CD44 mAbs with isotype-matched unrelated antibodies. Peroxidase was revealed by enhanced chemiluminescence (ECL; Amersham) detected by autoradiography (Hyperfilm; Amersham).
Ca2+ mobilization assay
To determine cytoplasmic free [Ca2+]i concentrations, cells were stained with the acetoxymethylester of Fura-2 (1 µM final concentration) (Sigma Chemical Co., St Louis, MO). Briefly, cells (106 cells) were trypsinized, washed twice at room temperature, incubated with Fura-2 for 30 min at 37°C and washed again before starting the measurements. The Fura-2 fluorescence of the cellular suspension was monitored at 37°C with an LS-5 Spectrofluorimeter (Perkin Elmer Corp., Pomona, CA). The excitation wavelength was 345 nm and fluorescence emission was measured at 496 nm. Stimulation was performed with the different anti-CD44 antibodies at 2 µg/ml, followed by a goat anti-mouse antiserum (Jackson ImmunoResearch, West Grove, PA) as a crosslinker. Goat anti-mouse antiserum alone, as well as anti-HLA Class I (clone 3A3) mAb, were used as negative controls, while EGF (10 ng/ml) and the ionophore ionomycin (1 µg/ml) were used as positive controls. The concentration of free [Ca2+]i was calculated by the method of Grynkiewicz et al. (28).
| Results |
|---|
|
|
|---|
In vitro models of squamous cell carcinogenesis and of squamous tumor cell resistance to external cytotoxic stimuli
To investigate the role of CD44 in squamous cell carcinogenesis we used two different in vitro models.
The first, which we called `the triple keratinocyte model', consisted of primary cultures of normal keratinocytes, of an HPV-immortalized keratinocyte line (UP) and an HPV-immortalized/v-Ha-ras-transfected tumorigenic keratinocyte line (UPR) (20,21). This model represents an in vitro equivalent of the progressive stages from normal squamous epithelium to dysplastic lesion and eventually to SCC, thus providing the possibility of investigating expression and function of CD44 according to the cell's `position' in the squamous cell carcinogenic sequence.
In addition, we utilized four established SCC cell lines, along with the UPR cell line, to account for a second in vitro model of squamous tumor cell resistance to external cytotoxic stimuli. The five tumorigenic cell lines were sorted according to their cellular susceptibility to external cytotoxic stimuli: (i) susceptibility to apoptotic cell death and/or to decreased proliferation under starving culture conditions; (ii) susceptibility to cell death following treatment with an apoptosis inducer, i.e. the synthetic retinoid N-(4-hydroxyphenyl) retinamide (4-HPR) (29); (iii) susceptibility to the cytolytic effects of LAK cells.
As shown in Table I
, A431 cells displayed by far the highest resistance, followed by ME180 cells. ME180 cells were resistant to apoptosis when treated with 4-HPR or when cultured under starving conditions, but they were also partially arrested by 4-HPR in the G2 phase of the cell cycle, thus slowing the proliferation rate, whereas A431 cells continued to grow at the same rate, even at higher 4-HPR concentration (20 µM) (data not shown). In addition, ME180 cells displayed a susceptibility to LAK cell-induced lysis higher than that of A431 cells. On the other hand, HeLa and LX-1 cells displayed the weakest resistance, as they were highly sensitive to serum-free medium and 4-HPR, as well as to LAK cell-induced lysis. Finally, UPR cells displayed intermediate resistance. Thus, according to these results, we have ordered the tumor cell lines A431 > ME180 > UPR > HeLa
LX-1 as to their resistance to external cytotoxic stimuli.
|
CD44 expression bears no relationship to stage of squamous cell carcinogenesis nor to level of squamous tumor cell resistance to cytotoxic stimuli
To define the expression of CD44 and splice variants, both on a quantitative and qualitative basis, we investigated surface expression of the molecule, the presence of its mRNA and the total cell content of these proteins.
Surface expression of all CD44 isoforms and of its splice variants containing V5, V6, V7 and V7-8 was analyzed by flow cytometry using suitable mAbs. The results of the mean fluorescence intensity are reported in Table II
. The number of CD44 molecules is highly variable among the different cell lines and bears no relationship to the stage of squamous cell carcinogenesis (`triple keratinocyte model') nor to the level of tumor cell susceptibility to death-inducing conditions as defined previously. Accordingly, no clear-cut trend of expression of CD44 containing each of the variant exon products has been detected in the various cell lines, suggesting that no relationship exists between CD44 expression evaluated by immunofluorescence and squamous cell carcinogenesis.
|
Several cell lines tested by immunofluorescence and flow cytometry revealed scarce expression of some variant exons and LX-1 cells were almost negative with the CD44 pan mAb. We therefore investigated upstream events by evaluating the presence of mRNA in the seven cell lines of our model by RTPCR. We did not perform quantitative PCR, since our aim was to investigate whether or not the cell lines tested were able to transcribe mRNA of any CD44 isoform (forward and reverse primers on constant exons always transcribed in any CD44 isoform) or of isoforms containing the variant exons V5, V6, V7 and V8, respectively, independent of possible combinations with other variant exons or of the relative amount of the different CD44 isoforms. We found mRNA with all primers utilized in all cell lines investigated. As an example, Figure 1
|
As CD44 mRNA was found also in cell lines which were negative for surface expression by immunofluorescence, we investigated the presence of CD44 proteins in crude cell extracts by western blotting. mAbs to CD44 and to the V5, V6, V7 and V7-8 variants were used to probe equal amounts of proteins from the seven cell lines. Each mAb yielded several bands which represent CD44 molecules with different variant exon combinations (each cell may simultaneously express CD44 molecules containing one specific variant exon in different combinations with other variant exons, thus creating different CD44 isoforms all containing that specific variant exon), as well as post-translationally modified CD44 molecules with different patterns of glycosylation and glycanation (Figure 2
|
Differences in the intensity of individual bands in the various cell lines were detected. However, such differences could not be related to the stage of squamous cell carcinogenesis (`triple keratinocyte model') nor to the level of tumor susceptibility to cell death-inducing conditions. It is worth remembering here that the comparison between antibodies with widely different affinities and reactive with subsets of molecules within a heterogeneous pool is not suitable to define the relative quantities of the different variants (as it may lead to under- or over-estimation). Thus, we cannot claim which isoforms are expressed in what quantities. However, we can conclude that each variant, as defined by its immunoreactivity, is present, demonstrating that at least some CD44 mRNAs detected by RTPCR were also translated.
Signal transduction via CD44 is confined to the neoplastic stage of squamous tumor progression and particularly to tumor cells most resistant to cell death
Since, in leukocytes, Ca2+ mobilization is involved in the transduction of activatory signals via CD44 (9), we studied the Ca2+ mobilizing ability of CD44 in cells of the `triple keratinocyte model'. Figure 3
and Table III
report the effect of anti-CD44 and anti-V5, -V6, -V7 and -V7-8 mAbs on free [Ca2+]i. Experiments were repeated three times with superimposable results.
|
|
Normal keratinocytes and UP cells, which represent the normal counterpart and the earliest stage in squamous cell tumorigenesis, respectively, showed almost no response (with the exception of normal keratinocytes to V6 mAb). In contrast, UPR cells displayed a significant increase in [Ca2+]i, particularly upon binding of variant exon mAbs. Ca2+ mobilization ability seems to be completely independent of the density of CD44 surface receptors, as can be seen from Figure 4
|
Ca2+ mobilization experiments were also performed on the five squamous tumor cell lines. The cell lines most susceptible to cell death-inducing conditions, i.e. LX-1 and HeLa, showed almost no response or a modest one, respectively. In contrast, the more resistant tumor cell lines UPR, ME180 and A431 showed a significant increase in [Ca2+]i. Jurkat cells, used as a negative control, did not mobilize Ca2+ ions (not shown). These data suggest that a trend of increasing signal transduction ability via CD44 exists with increasing `apoptosis resistance' phenotype. In addition, the magnitude of Ca2+ mobilization in the more resistant cell lines is heterogeneous when different mAbs are used. A431 cells were most sensitive to V5 mAb, while ME180 and UPR cells responded strongly to V7 mAb. The different Ca2+ mobilization intensities obtained with different mAbs on the same cell line may be due both to the different affinities of the antibodies, thus yielding more or less efficient dimerization of the CD44 receptors, as well as to recognition of different subsets of CD44 isoforms.
Ca2+ mobilization ability did not bear any relationship to protein expression, as can be seen by comparing Table III
with Table II
. For instance, HeLa cells bore a surface amount of CD44 isoforms (CD44 pan mAb) 5-fold higher than ME180 and A431 cells, however, they were virtually unable to mobilize Ca2+, while ME180 and A431 cells showed a greater than 2-fold increase in [Ca2+]i. On the other hand, UPR cells displayed a virtually negative expression of V7-containing isoforms, but a very strong increase in [Ca2+]i (+185%). In contrast, HeLa cells had slightly higher V7 expression, but showed no Ca2+ mobilization.
| Discussion |
|---|
|
|
|---|
We have previously demonstrated an activatory role of CD44 in human T lymphocytes (8,9,26). Engagement of CD44 by HA or anti-CD44 mAbs has also been shown to activate signalling in NK cells, fibroblasts and endothelial cells (911,30). In contrast, no information is available for epithelial cells, neither for the standard form nor for its splice variants, expressed at high levels (particularly V6) in epithelial regions rich in proliferating cells, such as the stem cells present in the basal layer of squamous epithelia (1). Also, no information is available on the role of CD44 in the disruption of tissue homeostasis that occurs during squamous cell carcinogenesis. Adhesion molecules are relevant for the maintenance of homeostasis, as cell adhesion is intimately coupled to signal transduction and regulation of cell growth and death. Normal squamous cells proliferate when attached to molecules of the ECM and undergo apoptosis when adhesion to ECM is denied (anoikis) (31). Disruption of the anoikis machinery may lead to abnormal proliferation and, in turn, to disruption of tissue homeostasis, thereby promoting dysplastic lesions which, with the occurrence of other events, may progress to overt neoplasia.
Several studies have been thus far carried out on fresh and archival tissue samples in the search for a possible relationship between expression of CD44 isoforms and different stages of squamous transformation. However, the results do not contribute to determining the role of this molecule in the squamous cell system, since quite contraddictory data have been reported. Some studies report increased levels of CD44 and unusual expression of CD44 splice variants containing V5, V7, V8 and, most notably, V6 exon products in pre-invasive and high risk pre-cancerous lesions (reviewed in refs 1,15). In contrast, other studies show that progression towards highly invasive undifferentiated squamous tumors is accompanied by a decrease in and subsequent loss of CD44 isoforms (1618) or unaltered expression (19). These apparently contradictory results may only in part be explained by differences in tumor type, staging and grading, as well as by differences in techniques and antibodies among the different laboratories.
Thus, to further clarify the contradictory results in the literature, we have investigated the association between CD44 alterations and squamous cell carcinogenesis in an in vitro model which represents the sequential stages of squamous tumor progression from normal tissue (keratinocytes), through dysplasia (HPV-16 immortalized keratinocytes) to neoplasia (tumorigenic HPV-16/v-Ha-ras transfected keratinocytes). The three keratinocyte cell lines have been reported to represent the three stages of squamous cell carcinogenesis (20,21). We also utilized five squamous tumor cell lines which were ordered according to their degree of cell resistance to external cytotoxic stimuli, i.e. to starving conditions, to drug treatment and to the cytolytic activity of effector LAK cells. We are aware that the in vitro cellular resistance to cell death-inducing conditions alone, though being an experimental parameter which might suggest a progression within the SCC malignant process, is not a sufficient marker for cellular malignancy.
In these models, we first investigated the CD44 phenotype at the mRNA, surface protein and total protein levels and found no relationship between CD44 expression and stage of squamous cell carcinogenesis or level of tumor cell resistance to death-inducing stimuli, neither from a quantitative point of view (CD44 molecular amount) nor from a qualitative point of view (distribution of CD44 splice variants).
However, investigation of the functional features of CD44, as Ca2+ mobilization ability upon anti-CD44 mAb binding, revealed that only cells of the neoplastic stage of the squamous cell carcinogenic scale (UPR) are able to transduce signals via CD44. In particular, this holds true only for the tumor cells with higher resistance to external cytotoxic stimuli (UPR, ME180 and A431). These data suggest a strong relationship between the signal transduction ability of CD44 and squamous tumor progression, independent of the molecular surface density and of the variant isoform phenotype.
Several studies on the anoikis phenomenon show that keratinocytes undergo apoptosis when kept in suspension for a period of time, variable among the different studies. The shortest time reported was 7.5 h, while in other studies cell death was observed after 12, 24 and even 48 h (reviewed in ref. 31). We performed our Ca2+ mobilization assays using cells in suspension, but we believe that at the time of measurement keratinocytes were viable and metabolically active. This is supported by the following observations. First, measurements were carried out ~5060 min after cell trypsinization, a much shorter time than that required for keratinocytes in suspension to undergo apoptosis (31). Second, as can be seen from the data in Table III
, keratinocytes showed a significant rise in [Ca2+]i upon EGF and ionomycin stimulation, as well as on V6 mAb crosslinking. Third, Ca2+ mobilization assays on normal human keratinocytes have been conducted under identical experimental and instrumental conditions as ours (32). However, to straighforwardly prove that our keratinocytes were not in apoptosis during our Ca2+ assays, we tested the annexin V stainability of keratinocytes kept in suspension for 30 min at 37°C followed by 30 min at room temperature and found the same viability as that of keratinocytes detached just before incubation with annexin V. We may therefore conclude that the lack of Ca2+ mobilization by keratinocytes is not due to cellular impairment of the metabolic apparatus.
The difference in CD44-mediated signal transduction ability between the cell lines of our model, representing the early stages of carcinogenesis and the more advanced neoplastic cell lines, cannot be attributed to differences in the pattern of glycosylation. UP and UPR cells, which display a significantly different Ca2+ mobilization, have identical binding affinities for the CD44 mAbs, as suggested by identical immunofluorescence profiles and similar patterns of glycosylated proteins, as indicated by western blot analyses. We are aware that glycosylation and glycanation could influence CD44 ligand binding, as it has been demonstrated that glycosylation is required for HA binding, to a certain degree, and that further glycosylation and glycanation reduces the binding affinity (2,3).
In conclusion, our results suggest that the overall contradictions in the literature cannot be ascribed to a lack of a role for CD44 in squamous cell carcinogenesis, but rather are due to the fact that either quantitative or qualitative expression of CD44 in the squamous cell system is not informative. At variance, the role of CD44 is revealed by its functional features, which suggest that this molecule may cooperate in the process of carcinogenesis by eliciting a constitutive activatory signal transduction pathway, once the cell reaches an advanced stage of tumor progression.
We are aware that the results of the present study mainly derive from the observation of relevant cellular phenomena, but do not provide, at this stage, information on possible causal links between the CD44-mediated rise in [Ca2+]i and the properties of the cell, with particular regard to elements of the cell cycle control machinery, central to the process of cell carcinogenesis. To further address this issue, we will investigate molecular elements involved in control of the CD44 signal transduction pathway that are altered in the late stages of squamous cell carcinogenesis. The alteration of such elements may be responsible in vivo for the tumor-associated disruption of the anoikis machinery and, consequently, of tissue homeostasis and may operate, among other mechanisms, by triggering uncontrolled CD44-mediated activatory signals. A search for these elements might be driven by the observation that UPR cells (which show a strong CD44-mediated signal transduction) are derived from UP (whose CD44 fails to mobilize Ca2+) following v-Ha-ras transfection. Oncogenic activated Ha-ras cooperates with the E6 and E7 early genes of HPV-16 to fully transform human keratinocytes, by increasing transcriptional activity of the E6 and E7 promoters (33), which have been shown to inhibit p53, p21 (Cip1, Waf1), Rb and other cdk inhibitors (3436). Also, it has recently been shown that transfection with v-Ha-ras blocks keratinocyte differentiation by altering the regulation of cyclin D1 and cdk2 (37). Thus, it might be that the signaling cascade activated by CD44ligand interaction in our in vitro model requires deregulated expression of relevant components of the cell cycle machinery control elements, such as ras, p53 and cdk inhibitors, which we will investigate further.
| Acknowledgments |
|---|
This study was supported by grants from the Associazione Italiana Ricerca sul Cancro (AIRC), from the Consiglio Nazionale delle Ricerche (CNR) and from the Ministero Università e Ricerca Scientifica e Tecnologica (MURST).
| Notes |
|---|
5 To whom correspondence should be addressed Email silviab{at}anatomiau.unige.it
| References |
|---|
|
|
|---|
- Naor,D., Sionov,R.V. and Ish-Shalom,D. (1997) CD44: structure, function and association with the malignant process. Adv. Cancer Res., 71, 241319.[Web of Science][Medline]
- Kincade,P.W., Zheng,Z., Katoh,S. and Hanson,L. (1997) The importance of cellular environment to function of the CD44 matrix receptor. Curr. Opin. Cell Biol., 9, 635642.[Web of Science][Medline]
-
Skelton,T.P., Zeng,C., Nocks,A. and Stamenkovic,I. (1998) Glycosylation provides both stimulatory and inhibitory effects on cell surface and soluble CD44 binding to hyaluronan. J. Cell Biol., 140, 431446.
[Abstract/Free Full Text] - Jalkanen,S., Jalkanen,M., Bargatze,R., Tammi,M. and Butcher,E.C. (1988) Biochemical properties of glycoproteins involved in lymphocyte recognition of high endothelial venules in man. J. Immunol., 141, 16151623.[Abstract]
-
Lokeshwar,V.B., Fregien,N. and Bourguignon,L.Y.W. (1994) Ankyrin-binding domain of CD44 (GP85) is required for the expression of hyaluronic acid-mediated adhesion function. J. Cell Biol., 126, 10991109.
[Abstract/Free Full Text] -
Tzukita,T., Oishi,K., Sato,N., Sagara,J., Kawai,A. and Tzukita,S. (1994) ERM family members as molecular linkers between CD44 and actin-based cytoskeleton. J. Cell Biol., 126, 391421.
[Abstract/Free Full Text] -
Taher,T.E., Smit,L., Griffioen,A.W., Schilder-Tol,E.J., Borst,J. and Pals,S.T. (1996) Signaling through CD44 is mediated through tyrosine kinases. Association with p56lck in T lymphocytes. J. Biol. Chem., 271, 28632867.
[Abstract/Free Full Text] - Galandrini,R., Galluzzo,E., Albi,N., Grossi,C.E. and Velardi,A. (1994) Hyaluronate is costimulatory for human T cell effector functions and binds to CD44 on activated T cells. J. Immunol., 153, 2131.[Abstract]
- Galluzzo,E., Albi,N., Fiorucci,S., Merigiola,C., Ruggeri,L., Tosti,A., Grossi,C.E. and Velardi,A. (1995) Involvement of CD44 variant isoforms in hyaluronate adhesion by human activated T cells. Eur. J. Immunol., 25, 29322939.[Web of Science][Medline]
-
Ayroldi,E., Cannarile,L., Migliorati,G., Bartoli,A., Nicoletti,I. and Riccardi,C. (1995) CD44 (Pgp-1) inhibits CD3 and dexamethasone-induced apoptosis. Blood, 86, 26722678.
[Abstract/Free Full Text] - Henke,C., Bitterman,P., Roongta,U., Ingbar,D. and Polunovsky,V. (1996) Induction of fibroblast apoptosis by anti-CD44 antibody: implications for the treatment of fibroproliferative lung disease. Am. J. Pathol., 149, 16391650.[Abstract]
- Bourguignon,L.Y.W., Zhu,D. and Zhu,H. (1998) CD44 isoform-cytoskeleton interaction in oncogenic signaling and tumor progression. Front. Biosci., 3, d637d649.[Medline]
- Moll,J., Khaldoyanidi,S., Sleeman,J.P., Achtnich,M., Preuss,I., Ponta,H. and Herrlich,P. (1998) Two different functions for CD44 proteins in human myelopoiesis. J. Clin. Invest., 102, 10241034.[Web of Science][Medline]
-
Khaldoyanidi,S., Moll,J., Karakhanova,S., Herrlich,P. and Ponta,H. (1999) Hyaluronate-enhanced hematopoiesis: two different receptors trigger the release of interleukin-1beta and interleukin-6 from bone marrow macrophages. Blood, 94, 940949.
[Abstract/Free Full Text] - Goodison,S. and Tarin,D. (1998) Clinical implications of anomalous CD44 gene expression in neoplasia. Front. Biosci., 3, e89e109.[Medline]
- Hudson,D.L., Speight,P.M. and Watt,F.M. (1996) Altered expression of CD44 isoforms in squamous-cell carcinomas and cell lines derived from them. Int. J. Cancer, 66, 457463.[Web of Science][Medline]
-
Soukka,T., Salmi,M., Joensuu,H., Hakkinen,L., Sointu,P., Koulu,L., Kalimo,K., Klemi,P., Grenman,R. and Jalkanen,S. (1997) Regulation of CD44v6-containing isoforms during proliferation of normal and malignant epithelial cells. Cancer Res., 57, 22812286.
[Abstract/Free Full Text] - Saegusa,M., Hashimura,M., Machida,D. and Okayasu,I. (1999) Down-regulation of CD44 standard and variant isoforms during the development and progression of uterine cervical tumours. J. Pathol., 187, 173183.[Web of Science][Medline]
- Van Hal,N.L., van Dongen,G.A., Stigter-Van Walsum,M., Snow,G.B. and Brakenhoff,R.H. (1999) Characterization of cd44v6 isoforms in head-and-neck squamous-cell carcinoma. Int. J. Cancer, 82, 837845.[Web of Science][Medline]
- DiPaolo,J.A., Woodworth,C.D., Popescu,N.C., Notario,V. and Doniger,J. (1989) Induction of human cervical squamous carcinoma by sequential transfection with human papillomavirus 16 DNA and viral Harvey ras. Oncogene, 4, 395399.[Web of Science][Medline]
- Hodivala,K.J., Pei,X.-F., Liu,Q.-Y., Jones,P.H., Rytina,E.R.C., Gilbert,C., Singer,A. and Watt,F.M. (1994) Integrin expression and function in HPV16-immortalised human keratinocytes in the presence or absence of v-HA-ras. Comparison with cervical intraepithelial neoplasia. Oncogene, 9, 943948.[Web of Science][Medline]
-
Screaton,G.R., Bell,M.V., Jackson,D.G., Cornelis,F.B., Gerth,U. and Bell,J.I. (1992) Genomic structure of the DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc. Natl Acad. Sci. USA, 89, 1216012164.
[Abstract/Free Full Text] -
Mathor,M.B., Ferrari,G., Dellambra,E., Cilli,M., Mavilio,F., Cancedda,R. and De Luca,M. (1996) Clonal analysis of stably transduced human epidermal stem cells in culture. Proc. Natl Acad. Sci. USA, 93, 1037110376.
[Abstract/Free Full Text] - Darzynkiewicz,Z., Bruno,S., Del Bino,G., Gorczyca,W., Hotz,M.A., Lassota,P. and Traganos,F. (1992) Features of apoptotic cells measured by flow cytometry. Cytometry, 13, 795808.[Web of Science][Medline]
-
Saverino,D., Tenca,C., Zarcone,D., Merlo,A., Megiovanni,A.M., Valle,M.T., Manca,F., Grossi,C.E. and Ciccone,E. (1999) CTLA-4 (CD152) inhibits the specific lysis mediated by human cytolytic T lymphocytes in a clonally distributed fashion. J. Immunol., 162, 651658.
[Abstract/Free Full Text] - Galandrini,R., Albi,N., Tripodi,G., Zarcone,D., Terenzi,A., Moretta,A., Grossi,C.E. and Velardi,A. (1993) Antibodies to CD44 trigger effector functions of human T cell clones. J. Immunol., 150, 42254235.[Abstract]
- Schwartz,A., Marti,G.E., Poon,R., Gratama,J.W. and Fernandez-Repollet,E. (1998) Standardizing flow cytometry: a classification system of fluorescence standards used for flow cytometry. Cytometry, 33, 106114.[Web of Science][Medline]
-
Grynkiewicz,G., Poenic,M. and Tsien,R.Y. (1985) A new generation of Ca++ indicators with greatly improved fluorescence properties. J. Biol. Chem., 260, 34403450.
[Abstract/Free Full Text] -
Oridate,N., Suzuki,S., Higuchi,M., Mitchell,M.F., Hong,W.K and Lotan,R. (1997) Involvement of reactive oxygen species in N-(4-hydroxyphenyl)retinamide-induced apoptosis in cervical carcinoma cells. J. Natl Cancer Inst., 89, 11911198.
[Abstract/Free Full Text] - Trochon,V., Mabilat,C., Bertrand,P., Legrand,Y., Smadja-Joffe,F., Soria,C., Delpech,B. and Lu,H. (1996) Evidence of involvement of CD44 in endothelial cell proliferation, migration and angiogenesis in vitro. Int. J. Cancer, 66, 664668.[Web of Science][Medline]
- Frisch,S.M. and Ruoslahti,E. (1997) Integrins and anoikis. Curr. Opin. Cell Biol., 9, 701706.[Web of Science][Medline]
- Jones,K.T. and Sharpe,G.R. (1994) Ni2+ blocks the Ca2+ influx in human keratinocytes following a rise in extracellular Ca2+. Exp. Cell Res., 212, 409413.[Web of Science][Medline]
- Medina-Martinez,O., Vallejo,V., Guido,M.C. and Garcia-Carranca,A. (1997) Ha-ras oncogene-induced transcription of human papillomavirus type 18 E6 and E7 oncogenes. Mol. Carcinog., 19, 8390.[Web of Science][Medline]
-
Jones,D.L., Alani,R.M. and Munger,K. (1997) The human papillomavirus E7 oncoprotein can uncouple cellular differentiation and proliferation in human keratinocytes by abrogating p21Cip1-mediated inhibition of cdk2. Genes Dev., 11, 21012111.
[Abstract/Free Full Text] -
Song,S., Gulliver,G.A. and Lambert,P.F. (1998) Human papillomavirus type 16 E6 and E7 oncogenes abrogate radiation-induced DNA damage responses in vivo through p53-dependent and p53-independent pathways. Proc. Natl Acad. Sci. USA, 95, 22902295.
[Abstract/Free Full Text] -
Martin,L.G., Demers,G.W. and Galloway,D.A. (1998) Disruption of the G1/S transition in human papillomavirus type 16 E7-expressing human cells is associated with altered regulation of cyclin E. J. Virol., 72, 975985.
[Abstract/Free Full Text] - Martinez,L.A., Chen,Y., Fischer,S.M. and Conti,C.J. (1999) Coordinated changes in cell cycle machinery occur during keratinocyte terminal differentiation. Oncogene, 18, 397406.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. Y. W. Bourguignon, P. A. Singleton, and F. Diedrich Hyaluronan-CD44 Interaction with Rac1-dependent Protein Kinase N-{gamma} Promotes Phospholipase C{gamma}1 Activation, Ca2+ Signaling, and Cortactin-Cytoskeleton Function Leading to Keratinocyte Adhesion and Differentiation J. Biol. Chem., July 9, 2004; 279(28): 29654 - 29669. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bruno, C. Tenca, D. Saverino, E. Ciccone, and C. E. Grossi Apoptosis of squamous cells at different stages of carcinogenesis following 4-HPR treatment Carcinogenesis, March 1, 2002; 23(3): 447 - 456. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





