Carcinogenesis, Vol. 21, No. 6, 1117-1120,
June 2000
© 2000 Oxford University Press
Cancer Biology |
Frequent mutations of the ß-catenin gene in mouse colon tumors induced by azoxymethane
Cancer Prevention Division, National Cancer Center Research Institute, 1-1 Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan
| Abstract |
|---|
|
|
|---|
The ß-catenin gene is frequently mutated at codons 33, 41 and 45 of the glycogen synthase kinase-3ß phosphorylation motif in human colon cancers in patients without APC mutations. Frequent mutations at codons 32 and 34, as well as 33 and 41, have been detected in rat colon tumors induced by azoxymethane (AOM), with the second G of CTGGA sequences being considered as a mutational hot-spot. In the present study, exon 3 of the ß-catenin gene in mouse colon tumors induced by AOM was amplified by PCR and mutations were detected by the single strand conformation polymorphism method, restriction enzyme fragment length polymorphism and direct sequencing. All 10 colon tumors tested were found to have ß-catenin mutations, four in codon 34, three in codon 33, two in codon 41 and one in codon 37, nine being G:C
A:T transitions. However, no mutations were found in codon 32 of the mouse ß-catenin gene. On immmunostaining, ß-catenin was observed in the cytoplasm and nucleus of the tumor cells. The cytoplasmic staining was homogeneous, while both homogeneous and heterogeneous patterns were noted for the nuclei. Highly frequent mutations of the ß-catenin gene in AOM-induced mouse colon tumors suggest that consequent alterations in the stability and localization of the protein may play an important role in this colon carcinogenesis model.
Abbreviations: AOM, azoxymethane; DMH, 1,2-dimethylhydrazine; GSK-3ß, glycogen synthase kinase-3ß; RFLP, restriction enzyme fragment length polymorphism; SSCP, single strand conformation polymorphism; Tcf, T cell factor.
| Introduction |
|---|
|
|
|---|
ß-Catenin plays important roles in the cadherin-mediated cellcell adhesion system and in Wnt signal transduction, binding to T cell factor (Tcf) in the nucleus and regulating transcription of genes related to the development and differentiation of cells (1). Down-regulation of ß-catenin requires binding of APC protein and phosphorylation by the serine-threonine glycogen synthase kinase-3ß (GSK-3ß) (2,3). Mutations in the GSK-3ß phosphorylation consensus motif of ß-catenin genes, as well as APC mutations, cause stabilization of ß-catenin in the cytoplasm and induce constitutive transcriptional activation with Tcf-4, a member of the Tcf family of DNA-binding proteins (4). Recently, mutations of the ß-catenin gene have been found in 50% of human colon tumors possessing an intact APC gene (5), suggesting that activation of the ß-catenin/Tcf-mediated transcription pathway caused by mutations of the APC or ß-catenin genes is very important for colon neoplasia.
In rat colon carcinogenesis induced by azoxymethane (AOM), K-ras gene mutations are as frequent as in human colorectal tumors (6), but Apc gene alterations are only rarely observed (7). Recently, we have reported frequent mutation and altered cellular localization of ß-catenin in rat colon adenocarcinomas induced by AOM (8). In the mouse case, Maltzman et al. have reported that expression of Apc protein appears to be reduced in AOM-induced tumors (9), so it is expected that Apc may be a mutational target of the carcinogen. In the present study, to clarify the mechanisms of AOM-induced colon carcinogenesis in the mouse, we investigated alteration of ß-catenin in AOM-induced mouse colon tumors in terms of mutations and immunostaining pattern.
| Materials and methods |
|---|
|
|
|---|
Tumor samples
Male ICR mice (Charles River Japan, Atsugi, Japan) at 6 weeks of age were treated with AOM at a dose of 10 mg/kg body wt, once a week for 6 weeks, as previously reported (10). Tumors obtained at week 30 were fixed in 10% formalin, embedded in paraffin, sectioned and stained with hematoxylin and eosin for histological examination. Ten adenocarcinomas from five randomly selected AOM-treated mice were subjected to mutation analysis of the ß-catenin and K-ras genes and immunohistochemical staining of ß-catenin.
PCRsingle strand conformation polymorphism (SSCP) analysis
DNA was extracted from paraffin sections using DEXPATTM (TaKaRa Shuzo Co. Ltd, Shiga, Japan). Tumor tissues were scraped off from paraffin sections entirely, i.e. not from particular parts of tumor tissues, using needles under a stereomicroscope to avoid contamination with normal tissue. PCR primers for detection of ß-catenin mutations were designed to amplify exon 3 of the ß-catenin gene containing the consensus sequence for GSK-3ß phosphorylation (8): 5'-primer, GCTGACCTGATGGAGTTGGA; 3'-primer, GCTACTTGCTCTTGCGTGAA. The length of the PCR product with these primers is 227 bp. PCR primers for detection of K-ras mutations were designed to amplify exon 1 of the gene (11) with a PCR product length of 123 bp: 5'-primer, GCCTGCTGAAAATGACTGAG; 3'-primer, CCTCTATCGTAGGGTCGTAC. The primers were synthesized with a 394 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) and purified with an OPC cartridge (Applied Biosystems). PCR for non-radioisotopic SSCP was performed in 50 µl of reaction mixture consisting of 0.5 µM of each primer, 1x PCR buffer (Perkin Elmer, Applied Biosystems Division, Foster City, CA), 200 µM each dNTP, 2.5 U AmpliTaq GoldTM (Perkin Elmer) and 0.050.5 µg of template DNA. The mixture was heated to 94°C for 9 min and subjected to 50 cycles of denaturation (94°C, 1 min), annealing (55°C, 2 min) and extension (72°C, 3 min) using a Perkin-Elmer Cetus thermal cycler. The PCR products were purified and concentrated to 20 µl using Microcon 100 (Amicon Inc., Beverley, MA), before SSCP analysis and direct sequencing. Ten volumes of 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol were added to 0.5 µl of purified PCR products, heated to 90°C for 3 min and applied to 10% polyacrylamide gels containing 5% glycerol. Electrophoresis was carried out at 300 V for 2 h at 20°C and the gels were soaked in 10% trichloroacetic acid and in 50% methanol for 10 min each. DNA bands were detected by silver staining using 2D Silver Staining Solution II (Daiichi Chemical Co., Tokyo, Japan).
Restriction fragment length polymorphism (RFLP) assay for PCR products of ß-catenin
To detect ß-catenin mutations at codons 32, 33 and 34, PCR products were treated with the restriction enzymes HinfI and EcoRI and electrophoresed on 5 and 3% agarose gels, respectively. Recognition sequences of these enzymes are GANTC for HinfI and GAATTC for EcoRI. The PCR product of 227 bp is digested by HinfI to 82, 7 and 138 bp in the case of the wild-type, to 89 and 138 bp with mutations at the first or second bases of codons 32 or 33 and to 82 and 145 bp with mutations at the second or third bases of codons 34 or 35. EcoRI does not cut the wild-type PCR product, but generates 81 and 146 bp fragments if there is a G
A mutation at the first base of codon 32.
Direct DNA sequencing
With 1 µl of the purified PCR products and 5'DyeAmidite-667-labeled 5' or 3' PCR primers (synthesized by Pharmacia Biotech, Tokyo, Japan), cycle sequencing reactions were carried out using a Thermo SequenaseTM fluorescent labeled primer cycle sequencing kit (Amersham) and the sequences were determined with an ALF expressTM DNA sequencer (Pharmacia Biotech).
Immunohistochemical staining
Immunohistochemical analyses were carried out by the avidinbiotin complex immunoperoxidase technique as previously described (8). As the primary antibody, monoclonal mouse anti-ß-catenin (Transduction Laboratories, Lexington, KY) was used at 100 times dilution. As the secondary antibody, biotinylated anti-mouse IgG (H+L) raised in a horse, affinity purified and absorbed with rat serum (Vector Laboratories Inc., Burlingame, CA) was employed at 200 times dilution. Staining was performed using avidin biotin reagents (Vectastain ABC reagents; Vector Laboratories Inc.), 3,3'-diaminobenzidine and hydrogen peroxide. The sections were counterstained with methyl green. As a negative control, duplicate sections were immunostained without exposure to the primary antibody.
| Results |
|---|
|
|
|---|
By PCRSSCP and RFLP analyses, mutations in the GSK-3ß phosphorylation consensus motif of the ß-catenin gene were detected in all 10 AOM-induced colon tumors of male ICR mice (Figures 1 and 2
A:T transitions (Figure 3
|
|
|
|
Using the same DNA samples employed for mutation analysis of the ß-catenin gene, K-ras gene mutations were analyzed by PCRSSCP. A mutation in exon 1 was detected in one of the 10 tumors (data not shown) and determined to be a G
A transition at the second base of codon 12 by direct sequencing (Table I
In normal colon mucosa, immunostaining revealed ß-catenin to be mainly localized at the cell membranes of the surface epithelial cells, with a possible cytoplasmic location, and ß-catenin immunoreactivity in crypt cells was relatively low (Figure 4A
). In contrast, cytoplasmic and nuclear immunostaining or loss of cell membrane staining was observed in all of the tumors examined (Figure 4C and D
). The cytoplasmic staining in tumor cells was homogeneous, while the nuclear staining was homogeneous or heterogeneous, the latter being either scattered or focal. Patterns of nuclear staining of ß-catenin were homogeneous in four tumors and heterogeneous in five tumors, three of scattered type and two focal (Table I
). In one tumor, nuclear staining of ß-catenin was very weak, although cytoplasmic staining was observed.
|
| Discussion |
|---|
|
|
|---|
In the present study of AOM-induced colon tumors in mice, ß-catenin gene mutations were detected in all tumor samples tested. Alteration of the subcellular localization of ß-catenin was also observed. These results indicate that AOM-induced colons carcinogenesis is similarly mediated by ß-catenin mutations in both rats and mice, although there are differences in immunostaining patterns and the mutation spectrum between the two species.
The ß-catenin gene is frequently mutated at codons 33, 41 and 45 of the GSK-3ß phosphorylation motif in human colon cancers without APC mutations (6). Besides mutations at codons 33 and 41 of the ß-catenin gene, mutations at codons 32 and 34 are frequent in rat colon tumors induced by AOM (8). The second G of the CTGGA sequence is commonly mutated to A in codons 32 and 34 of the rat ß-catenin gene and this site is considered to be a mutational hot-spot with AOM (8). In the present study, the mouse ß-catenin gene was found to be mutated at codons 34, 33, 41 and 37, nine of 10 mutations being G:C
A:T transitions, but not at codon 32. Thus the hot-spot in codon 34 may be present in common, further supporting our hypothesis that the second G of the CTGGA sequence is of particular importance.
In rat colon carcinogenesis induced by AOM or 1,2-dimethylhydrazine (DMH), K-ras gene mutations are as frequent as in human colorectal tumors (6). However, K-ras mutations were not detected in DMH-induced colon tumors in SWR mice (12) and, in the present study, only one of 10 colon tumors induced by AOM in ICR mice had a K-ras gene mutation. These findings suggest that activation of the K-ras gene is not essential for colon tumor development in mice.
In Min/+ and Apc
716 knockout mice, animal models for familial adenomatous polyposis, nuclear translocation of ß-catenin in intestinal adenomas has been reported (13). The tumors in these model mice have been shown to lack a wild-type allele of the Apc gene (14,15) and the loss of intact Apc protein may cause stabilization of ß-catenin (2). On the other hand, as mentioned in the Introduction, Maltzman et al. reported reduced expression of Apc protein also in AOM-induced tumors (9), suggesting that Apc is a mutational target of the carcinogen. The discrepancy with the findings of the present study, taking into account data for rats, might not be related to species differences. Immunostaining of the samples used in the present study for Apc protein using a C-terminal anti-APC antibody showed reduced expression in nine of 10 tumors (data not shown). Therefore, it is possible that mutant ß-catenin causes a reduction in Apc expression. Alternatively, immunoreactivity could be different between free Apc and the protein bound to exon 3-mutated ß-catenin.
In our previous study in rats, nuclear staining of ß-catenin in most tumors showed a scattered heterogeneous pattern (8) and the homogeneous nuclear staining observed in the present study seems to be distinctive for mouse colon tumors. It is known that ß-catenin is tyrosine-phosphorylated in response to transformation via activated Ras and Src or stimulation by EGF and HGF (1). Modifications like tyrosine phosphorylation and/or the presence of other factors such as Tcf may be involved in determining the location of ß-catenin.
In conclusion, ß-catenin gene mutations may be common main events in AOM-induced colon carcinogenesis in both rats and mice, even if other background factors vary with the species. These animal models are thus useful for investigation of the role of ß-catenin mutations in colon neoplasia.
| Notes |
|---|
1 To whom correspondence should be addressed Email: mtakahas{at}gan2.ncc.go.jp
| Acknowledgments |
|---|
We thank Emi Abe for expert technical assistance. This work was supported in part by a Grant-in-Aid for Cancer Research from the Ministry of Health and Welfare, Japan, a grant from the TAKEDA Science Foundation, Japan, and a grant from the Organization for Pharmaceutical Safety and Research (OPSR) of Japan.
| References |
|---|
|
|
|---|
-
Miller,J.R. and Moon,R.T. (1996) Signal transduction through ß-catenin and specification of cell fate during embryogenesis. Genes Dev., 10, 25272539.
[Free Full Text] -
Munemitsu,S., Albert,I., Souza,B., Rubinfeld,B. and Polakis,P. (1995) Regulation of intracellular ß-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc. Natl Acad. Sci. USA, 92, 30463050.
[Abstract/Free Full Text] -
Yost,C., Torres,M., Miller,J.R., Huang,E., Kimelman,D. and Moon,R.T. (1996) The axis-inducing activity, stability, and subcellular distribution of ß-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev., 10, 14431454.
[Abstract/Free Full Text] -
Morin,P.J., Sparks,A.B., Korinek,V., Barker,N., Clevers,H., Vogelstein,B. and Kinzler,K.W. (1997) Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science, 275, 17871790.
[Abstract/Free Full Text] -
Sparks,A.B., Morin,P.J., Vogelstein,B. and Kinzler,K.W. (1998) Mutational analysis of the APC/ß-catenin/Tcf pathway in colorectal cancer. Cancer Res., 58, 11301134.
[Abstract/Free Full Text] - Erdman,S.H., Wu,H.D., Hixson,L.J., Ahnen,D.J. and Gerner,E.W. (1997) Assessment of mutations in Ki-ras and p53 in colon cancers from azoxymethane- and dimethylhydrazine-treated rats. Mol. Carcinog., 19, 137144.[Web of Science][Medline]
- Caderni,G., Filippo,D., Luceri,C., Fazi,M., Dolara,P. and Bazzicalupo,M. (1997) Apc mutations in aberrant crypt foci and colonic tumors induced by azoxymethane in rats. Proc. Am. Assoc. Cancer Res., 38, 467.
-
Takahashi,M., Fukuda,K., Sugimura,T. and Wakabayashi,K. (1998) ß-Catenin is frequently mutated and demonstrates altered cellular location in azoxymethane-induced rat colon tumors. Cancer Res., 58, 4246.
[Abstract/Free Full Text] -
Maltzman,T., Whittington,J., Driggers,L., Stephens,J. and Ahnen,D. (1997) AOM-induced mouse colon tumors do not express full-length APC protein. Carcinogenesis, 18, 24352439.
[Abstract/Free Full Text] -
Fukutake,M., Nakatsugi,S., Isoi,T., Takahashi,M., Ohta,T., Mamiya,S., Taniguchi,Y., Sato,H., Fukuda,K., Sugimura,T. and Wakabayashi,K. (1998) Suppressive effects of nimesulide, a selective inhibitor of cyclooxygenase-2, on azoxymethane-induced colon carcinogenesis in mice. Carcinogenesis, 19, 19391942.
[Abstract/Free Full Text] - George,D.L., Scott,A.F., Trusko,S., Glick,B., Ford,E. and Dorney,D.J. (1985) Structure and expression of amplified cKi-ras gene sequences in Y1 mouse adrenal tumor cells. EMBO J., 4, 11991203.[Web of Science][Medline]
-
Jackson,P.E., Cooper,D.P., O'Connor,P.J. and Povey,A.C. (1999) The relationship between 1,2-dimethylhydrazine dose and the induction of colon tumours: tumour development in female SWR mice does not require a K-ras mutational event. Carcinogenesis, 20, 509513.
[Abstract/Free Full Text] -
Sheng,H., Shao,J., Williams,C.S., Pereira,M.A., Taketo,M.M., Oshima,M., Reynolds,A.B., Washington,M.K., DuBois,R.N. and Beauchamp,R.D. (1998) Nuclear translocation of ß-catenin in hereditary and carcinogen-induced intestinal adenomas. Carcinogenesis, 19, 543549.
[Abstract/Free Full Text] -
Luongo,C., Moser,A.R., Gledhill,S. and Dove,W.F. (1994) Loss of APC+ in intestinal adenomas from Min mice. Cancer Res., 54, 59475952.
[Abstract/Free Full Text] -
Oshima,M., Oshima,H., Kitagawa,K., Kobayashi,M., Itakura,C. and Taketo,M. (1995) Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene. Proc. Natl Acad. Sci. USA, 92, 44824486.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
W. Qiu, E. B. Carson-Walter, S. F. Kuan, L. Zhang, and J. Yu PUMA Suppresses Intestinal Tumorigenesis in Mice Cancer Res., June 15, 2009; 69(12): 4999 - 5006. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Fields, S. R. Calcagno, M. Krishna, S. Rak, M. Leitges, and N. R. Murray Protein Kinase C{beta} Is an Effective Target for Chemoprevention of Colon Cancer Cancer Res., February 15, 2009; 69(4): 1643 - 1650. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Rosenberg, C. Giardina, and T. Tanaka Mouse models for the study of colon carcinogenesis Carcinogenesis, February 1, 2009; 30(2): 183 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tao, J. Hart, L. Lichtenstein, L. J. Joseph, M. J. Ciancio, S. Hu, E. B. Chang, and M. Bissonnette Inducible heat shock protein 70 prevents multifocal flat dysplastic lesions and invasive tumors in an inflammatory model of colon cancer Carcinogenesis, January 1, 2009; 30(1): 175 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hu, G. H. McIntosh, R. K. Le Leu, R. Woodman, and G. P. Young Suppression of Colorectal Oncogenesis by Selenium-Enriched Milk Proteins: Apoptosis and K-ras Mutations Cancer Res., June 15, 2008; 68(12): 4936 - 4944. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Raufman, R. Samimi, N. Shah, S. Khurana, J. Shant, C. Drachenberg, G. Xie, J. Wess, and K. Cheng Genetic Ablation of M3 Muscarinic Receptors Attenuates Murine Colon Epithelial Cell Proliferation and Neoplasia Cancer Res., May 15, 2008; 68(10): 3573 - 3578. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Uronis, H. H. Herfarth, T. C. Rubinas, A. C. Bissahoyo, K. Hanlon, and D. W. Threadgill Flat Colorectal Cancers Are Genetically Determined and Progress to Invasion without Going through a Polypoid Stage Cancer Res., December 15, 2007; 67(24): 11594 - 11600. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-C. L. Chang, R. A. Coudry, M. L. Clapper, X. Zhang, K.-L. Williams, C. S. Spittle, T. Li, and H. S. Cooper Loss of p53 enhances the induction of colitis-associated neoplasia by dextran sulfate sodium Carcinogenesis, November 1, 2007; 28(11): 2375 - 2381. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Suzuki, H. Kohno, S. Sugie, H. Nakagama, and T. Tanaka Strain differences in the susceptibility to azoxymethane and dextran sodium sulfate-induced colon carcinogenesis in mice Carcinogenesis, January 1, 2006; 27(1): 162 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Paulsen, E. M. Loberg, H. B. Olstorn, H. Knutsen, I.-L. Steffensen, and J. Alexander Flat Dysplastic Aberrant Crypt Foci Are Related to Tumorigenesis in the Colon of Azoxymethane-Treated Rat Cancer Res., January 1, 2005; 65(1): 121 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tanaka, R. Suzuki, H. Kohno, S. Sugie, M. Takahashi, and K. Wakabayashi Colonic adenocarcinomas rapidly induced by the combined treatment with 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine and dextran sodium sulfate in male ICR mice possess {beta}-catenin gene mutations and increases immunoreactivity for {beta}-catenin, cyclooxygenase-2 and inducible nitric oxide synthase Carcinogenesis, January 1, 2005; 26(1): 229 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dong, K. Guda, P. R. Nambiar, M. Nakanishi, A. C. Lichtler, M. Nishikawa, C. Giardina, and D. W. Rosenberg Azoxymethane-induced pre-adipocyte factor 1 (Pref-1) functions as a differentiation inhibitor in colonic epithelial cells Carcinogenesis, November 1, 2004; 25(11): 2239 - 2246. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Fujiwara, M. Ochiai, T. Ohta, M. Ohki, H. Aburatani, M. Nagao, T. Sugimura, and H. Nakagama Global gene expression analysis of rat colon cancers induced by a food-borne carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine Carcinogenesis, August 1, 2004; 25(8): 1495 - 1505. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kaneko, K. Morimura, T. Nishikawa, H. Wanibuchi, N. Takada, H. Osugi, H. Kinoshita, and S. Fukushima Different genetic alterations in rat forestomach tumors induced by genotoxic and non-genotoxic carcinogens Carcinogenesis, October 1, 2002; 23(10): 1729 - 1735. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Gupta and R. N. Dubois Controversy: PPARgamma as a target for treatment of colorectal cancer Am J Physiol Gastrointest Liver Physiol, August 1, 2002; 283(2): G266 - G269. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takagi, Y. Nakano, S. Takekoshi, T. Inagami, and M. Tamura Hemizygous mice for the angiotensin II type 2 receptor gene have attenuated susceptibility to azoxymethane-induced colon tumorigenesis Carcinogenesis, July 1, 2002; 23(7): 1235 - 1241. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Koesters, M. A. Hans, A. Benner, R. Prosst, J. Boehm, J. Gahlen, and M. von Knebel Doeberitz Predominant mutation of codon 41 of the {beta}-catenin proto-oncogene in rat colon tumors induced by 1,2-dimethylhydrazine using a complete carcinogenic protocol Carcinogenesis, November 1, 2001; 22(11): 1885 - 1890. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Erik Paulsen, I.-L. Steffensen, E. M. Loberg, T. Husoy, E. Namork, and J. Alexander Qualitative and Quantitative Relationship between Dysplastic Aberrant Crypt Foci and Tumorigenesis in the Min/+ Mouse Colon Cancer Res., July 1, 2001; 61(13): 5010 - 5015. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


X174/HaeIII digest); lanes N1 and N2, normal colon mucosa samples; lanes T1T10, colon tumors. Tumor-specific bands are indicated by arrows.



