Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (68)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 21, No. 7, 1319-1327, July 2000
© 2000 Oxford University Press


Cancer Biology

Altered expression of ß-catenin, inducible nitric oxide synthase and cyclooxygenase-2 in azoxymethane-induced rat colon carcinogenesis

Mami Takahashi1, Michihiro Mutoh, Toshihiko Kawamori, Takashi Sugimura and Keiji Wakabayashi

Cancer Prevention Division, National Cancer Center Research Institute, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Activation of the ß-catenin/T cell factor-mediated transcription pathway through mutations of the APC or ß-catenin gene is suggested to play an important role in colon carcinogenesis and there is great interest in the target genes. We have described the frequent mutation and an altered cellular localization of ß-catenin in rat colon adenocarcinomas induced by azoxymethane (AOM), along with up-regulation of inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2. In the present study, the relation between ß-catenin alteration and expression of iNOS and COX-2 in AOM-induced rat colon carcinogenesis was examined in hyperplastic and dysplastic type aberrant crypt, adenoma and adenocarcinoma samples. K-ras gene mutations were also investigated. Mutation analysis by the PCR–single strand conformation polymorphism method and direct sequencing demonstrated the ß-catenin gene to be mutated in two of three dysplastic aberrant crypt foci (ACF), two of six adenomas and 20 of 26 adenocarcinomas, while K-ras was mutated in seven of 10 hyperplastic ACF and seven of 26 adenocarcinomas. Immunohistochemical staining showed an alteration in cellular localization of ß-catenin in all dysplastic ACF, adenomas and adenocarcinomas examined. iNOS expression was also observed in all but one of the lesions in which ß-catenin alterations were observed. Neither iNOS expression nor ß-catenin alterations were observed in any hyperplastic ACF. COX-2 expression in stromal elements was found even in normal colon mucosa and increased in adenomas and adenocarcinomas, while epithelial cells were only positive in large adenocarcinomas. These results show that ß-catenin alterations may be related to induction of iNOS expression, these being early events in AOM-induced colon tumorigenesis which may play important roles in causing dysplastic changes.

Abbreviations: ACF, aberrant crypt foci; AOM, azoxymethane; APC, adenomatous polyposis coli; COX, cyclooxygenase; GSK, glycogen synthase kinase; iNOS, inducible nitric oxide synthase; PGE2, prostaglandin E2; RFLP, restriction fragment length polymorphism; SSCP, single strand conformation polymorphism; Tcf, T cell factor.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
ß-Catenin is a key component of the cadherin-mediated cell–cell adhesion system (1). In addition, it is an important factor in Wnt signal transduction, binding to T cell factor (Tcf) in the nucleus and thereby regulating transcription of genes related to the development and differentiation of cells (1). The adenomatous polyposis coli (APC) tumor suppressor protein, which associates with ß-catenin (2), is involved in down-regulation of ß-catenin together with serine-threonine glycogen synthase kinase (GSK)-3ß (3,4). Mutations in the GSK-3ß phosphorylation consensus motif of ß-catenin genes, as well as APC mutations, cause stabilization of ß-catenin in the cytoplasm and induce constitutive transcriptional activation with Tcf-4, a member of the Tcf family of DNA-binding proteins (5). Recently, mutations of the ß-catenin gene have been found in 50% of human colon tumors possessing an intact APC gene (6). Therefore, activation of the ß-catenin/Tcf-mediated transcription pathway caused by mutations of the APC or ß-catenin gene may play an important role in colon carcinogenesis. To understand the mechanisms, investigation of targets of the ß-catenin/Tcf-mediated transcription pathway is a high priority.

Expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2 is often increased in human colon tumors (7,8) and their reaction products, nitric oxide (NO) and prostaglandin E2 (PGE2), could contribute to colon tumorigenesis. However, any relation between their expression and the ß-catenin/Tcf pathway remains to be clarified.

In rat colon carcinogenesis induced by azoxymethane (AOM), K-ras gene mutations are as frequent as in human colorectal tumors (9), but Apc gene alterations are only rarely observed (10). Recently, we have reported the frequent mutation and altered cellular localization of ß-catenin in rat colon adenocarcinomas induced by AOM (11), and iNOS and COX-2 were also found to be expressed in these carcinomas (12). In addition, there are reports on increased expression of COX-2 in rat colon tumors induced by AOM (13,14). In the present study, the relation between ß-catenin alteration and expression of iNOS and COX-2 in both early and late stages of AOM-induced rat colon tumorigenesis was examined using hyperplastic and dysplastic aberrant crypt, adenoma and adenocarcinoma samples. K-ras gene mutations were also investigated.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Animals and treatment
Male F344 rats (Charles River Japan Inc., Kanagawa, Japan) at 6 weeks of age were treated with AOM (Sigma Chemical Co., St Louis, MO) to induce colon lesions, as previously reported (15). At week 36, the animals were killed and colon tumors and aberrant crypt foci (ACF) were collected. Large tumors were each cut into two, one half being immediately frozen and stored at –80°C. The other half, with small tumors and ACF, were fixed in formalin at 4°C overnight, embedded in paraffin, sectioned and either stained with hematoxylin and eosin for histological examination or used for immunohistochemistry. Besides the eight paired samples of the normal mucosa and large carcinomas employed for previous studies (11,12), parraffin-embedded samples of six large adenocarcinomas >5 mm in a diameter, six medium adenocarcinomas 2–5 mm in diameter, six small adenocarcinomas 1–2 mm in diameter, six adenomas 1–2 mm in diameter, three dysplastic ACF consisting of 20–50 crypts and 10 hyperplastic ACF consisting of 4–16 crypts were here used for mutation analyses and immunohistochemical staining.

PCR–single strand conformation polymorphism (SSCP) analysis
DNA was extracted from frozen tissue using ISOGEN (Nippon Gene Inc., Japan) or from paraffin sections using DEXPATTM (TaKaRa Shuzo Co. Ltd, Shiga, Japan). ACF samples were scraped off 5–10 paraffin sections, using needles, under a stereomicroscope. PCR primers for detection of ß-catenin mutations were designed to amplify the consensus sequence for GSK-3ß phosphorylation of the ß-catenin gene (11): 5'-primer, GCTGACC- TGATGGAGTTGGA; 3'-primer, GCTACTTGCTCTTGCGTGAA (L) or TCTTCTTCTCAGGATTGCC (S). The lengths of the PCR products with these primers were 227 (L) and 155 bp (S). PCR primers for detection of K-ras mutations were designed to amplify exon 1 of the gene (16), with a PCR product length of 133 bp: 5'-primer, GCCTGCTGAAAATGACTGAG; 3'-primer, GCAGCATTTACCTCTATCGT. The primers were synthesized in a 394 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) and purified with an OPC cartridge (Applied Biosystems). PCR for non-radioisotopic SSCP was performed in 50 µl of reaction mixture consisting of 0.5 µM each primer, 1x PCR buffer (Applied Biosystems Division, Perkin Elmer, Foster City, CA), 200 µM each dNTP, 2.5 U AmpliTaq GoldTM (Perkin Elmer) and 0.05–0.5 µg template DNA. The mixture was heated at 94°C for 9 min and subjected to 30 or 50 cycles of denaturation (94°C, 1 min), annealing (55°C, 2 min) and extension (72°C, 3 min) using a Perkin Elmer-Cetus thermal cycler. The PCR products were purified and concentrated to 20 µl using Microcon 100 (Amicon Inc., Beverley, MA), before SSCP analysis and direct sequencing. Ten volumes of 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol were added to 1 µl of PCR products or 0.5 µl of purified PCR products, heated to 90°C for 3 min and applied to 10 or 12.5% polyacrylamide gels containing 5% glycerol. Electrophoresis was carried out at 300 V for 2 h at 20°C and the gels were soaked in 10% trichloroacetate and in 50% methanol for 10 min each. DNA bands were detected by silver staining using 2D Silver Staining Solution II (Daiichi Chemical Co., Japan).

Restriction fragment length polymorphism (RFLP) assay of PCR products of ß-catenin
To detect ß-catenin mutations at hot-spots in codons 32, 33 and 34, PCR products were treated with restriction enzymes (HinfI and EcoRI) and electrophoresed on 5 and 3% agarose gels, respectively. The recognition sequences of these enzymes are GANTC for HinfI and GAATTC for EcoRI. The PCR product of 227 bp (L) is digested by HinfI to 82, 7 and 138 bp in the case of the wild-type, to 89 and 138 bp with mutations at the first or second bases of codons 32 or 33 and to 82 and 145 bp with mutations at the second or third bases of codons 34 or 35. EcoRI does not cut the wild-type PCR product, but generates 81 and 146 bp fragments if there is a G->A mutation at the first base of codon 32. The PCR product of 155 bp (S) is digested by HinfI to 82, 7 and 66 bp in the case of the wild-type, to 89 and 66 bp with mutations at the first or second bases of codons 32 or 33 and to 82 and 73 bp with mutations at the second or third bases of codons 34 or 35. EcoRI does not cut the wild-type PCR product, but results in 81 and 74 bp fragments if there is a G->A mutation at the first base of codon 32.

Direct DNA sequencing
With 1 µl of the purified PCR products and 5'DyeAmidite-667-labeled 5' or 3' PCR primers (synthesized by Pharmacia Biotech, Tokyo, Japan), cycle sequencing reactions were carried out using a Thermo SequenaseTM fluorescent labeled primer cycle sequencing kit (Amersham), and the sequences were determined with an ALF ExpressTM DNA sequencer (Pharmacia Biotech).

Immunohistochemical staining
Immunohistochemical analyses were carried out with the avidin–biotin complex immunoperoxidase technique as previously described (11,12). As the primary antibodies, monoclonal mouse anti-ß-catenin, anti-iNOS and anti-COX-2 antibodies (Transduction Laboratories, Lexington, KY) were used at 100x, 50x and 50x dilutions, respectively. As the secondary antibody, biotinylated anti-mouse IgG (H+L), raised in a horse, affinity purified and absorbed with rat serum (Vector Laboratories Inc., Burlingame, CA), was employed at 200x dilution. Staining was performed using avidin–biotin reagents (Vectastain ABC reagents; Vector Laboratories Inc.), 3,3'-diamino- benzidine and hydrogen peroxide. The sections were counterstained with methyl green. As a negative control, duplicate sections were immunostained without exposure to the primary antibody.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Detection of ß-catenin gene mutations in rat colon adeno- carcinomas, adenomas and ACF
As previously reported, the GSK-3ß phosphorylation consensus region of the ß-catenin gene, which is important for protein stability and function, was frequently mutated in most large adenocarcinomas induced by AOM in the rat colon (12). In the present study, ß-catenin gene mutations in additional large adenocarcinomas, medium and small adenocarcinomas, adenomas and ACF induced by AOM in the rat colon were analyzed by the PCR–SSCP and RFLP methods.

Mutations were detected in five of six large carcinomas, four of six medium carcinomas, five of six small carcinomas, two of six adenomas and two of three dysplastic ACF, but none of 10 hyperplastic ACF (Figures 1 and 2GoGo). Table IGo lists the mutated sequences determined by direct sequencing of PCR products. Including the previously reported eight mutations in six of eight large adenocarcinomas, out of the total 26 mutations, nine were located at the second base of codon 34, eight at the first base of codon 32, five at the second base of codon 41, two at the second base of codon 33, one at the first base of codon 33 and one at the second base of codon 32. Except for the last two cases, all were G:C->A:T transitions. In particular, 17 mutations were CTGGA->CTGAA (Figure 3Go).



View larger version (104K):
[in this window]
[in a new window]
 
Fig. 1. PCR–SSCP analysis of the ß-catenin gene in AOM-induced rat colon lesions. (A) PCR products of 277 bp (L) were electrophoresed in 10% polyacrylamide gels containing 5% glycerol at 20°C. Lane N, a normal colon mucosa sample; lanes Ad1–Ad6, adenomas (1–2 mm); lanes ST1–ST6, small adenocarcinomas (1–2 mm); lanes MT1–MT6, medium adenocarcinomas (2–5 mm); lanes LT1–LT6, large adenocarcinomas (>5 mm). (B) PCR products of 155 bp (S) were electrophoresed in 12.5% polyacrylamide gels containing 5% glycerol at 20°C. Lanes ACF-d1–ACF-d3, dysplastic ACF; lanes ACF-h1–ACF-h10, hyperplastic ACF; lanes WT, 32Ia, 32IIg, 33IIt, 34IIa and 41IIt, controls for the wild-type and mutants at the first base of codon 32 (G->A), at the second base of codon 32 (A->G), at the second base of codon 33 (C->T), at the second base of codon 34 (G->A) and at the second base of codon 41 (C->T), respectively, which had been obtained in a previous study (11). Samples that showed tumor-specific bands are underlined; tumor-specific bands are indicated with arrowheads.

 


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 2. RFLP analysis of the ß-catenin gene in AOM-induced rat colon lesions. (A) PCR products of 277 bp (L) were treated with HinfI and electrophoresed on 5% agarose gels (I) or treated with EcoRI and electrophoresed on 3% agarose gels (II). Lanes Ad1–Ad6, adenomas (1–2 mm); lanes ST1–ST6, small adenocarcinomas (1–2 mm); lanes MT1–MT6, medium adenocarcinomas (2–5 mm); lanes LT1–LT6, large adenocarcinomas (>5 mm); lane M, DNA size markers ({phi}X174 HaeIII digest). (B) PCR products of 155 bp (S) were treated with HinfI and electrophoresed on 5% agarose gels (I) or treated with EcoRI and electrophoresed on 3% agarose gels (II). Lanes ACF-d1–ACF-d3, dysplastic ACF; lanes ACF-h1–ACF-h10, hyperplastic ACF. (C) PCR products of 277 (L) (left) and 155 bp (S) (right) were treated with HinfI and electrophoresed on 5% agarose gels (I) or treated with EcoRI and electrophoresed on 3% agarose gels (II). Lanes WT, 32Ia, 33IIt, 34IIa and 41IIt, controls for the wild-type and mutants at the first base of codon 32 (G->A), at the second base of codon 33 (C->T), at the second base of codon 34 (G->A) and at the second base of codon 41 (C->T), respectively, which had been obtained in a previous study (11). Samples that showed tumor-specific bands are underlined; tumor-specific bands are indicated with arrowheads.

 

View this table:
[in this window]
[in a new window]
 
Table I. Mutations in exon 3 of the ß-catenin gene in AOM-induced rat colon lesions
 


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 3. Mutations in the GSK-3ß phosphorylation consensus motif of the rat ß-catenin gene. The serine residues in codons 33, 37 and 45 and the threonine residue in codon 41 are GSK-3ß phosphorylation sites. The sites and nature of the 26 point mutations found in AOM-induced rat colon carcinomas, adenomas and dysplastic ACF are indicated above the sequence.

 
Detection of K-ras gene mutations in rat colon adenocarcinomas, adenomas and ACF
Using the same DNA samples employed for mutation analysis of the ß-catenin gene, K-ras gene mutations were analyzed. Using PCR–SSCP analysis, mutations in exon 1 of the K-ras gene were detected in six of 14 large carcinomas, one of six small carcinomas and seven of 10 hyperplastic ACF. No mutations were detected in six medium carcinomas, six adenomas and three dysplastic ACF. Table IIGo shows the mutated sequences determined by direct sequencing of the PCR products. Out of the 14 mutations, one was a silent mutation at codon 23 and the others were activating mutations at codon 12 or 13. All were G:C->A:T transitions. In particular, 11 mutations at the second base of codon 12 were CTGGT->CTGAT.


View this table:
[in this window]
[in a new window]
 
Table II. Mutations in exon 1 of the K-ras gene in AOM-induced rat colon lesions
 
Subcellular localization of ß-catenin protein and expression of iNOS and COX-2 in rat colon adenocarcinomas, adenomas and ACF
To determine at which stage of colon carcinogenesis the alterations in subcellular ß-catenin localization and induction of iNOS and COX-2 occur, immunohistochemical analyses of the three proteins in the same tissue samples used in the mutation analyses were performed.

In normal colon epithelial cells, ß-catenin was mainly localized at the membranes at the cell–cell borders (Figure 4AGo). In contrast, homogeneous cytoplasmic and scattered nuclear immunostaining was pronounced in all 14 large adenocarcinomas, six medium adenocarcinomas, six small adenocarcinomas and six small adenomas examined (Figure 4D and GGo). A cytoplasmic and nuclear localization of ß-catenin or loss of cell membrane staining was also observed in all three dysplastic ACF examined (data not shown). The 10 hyperplastic ACF (4–16 crypts/focus) only stained for ß-catenin at the cell membranes, as with normal colon epithelial cells. Negative control sections showed no positive staining when the primary antibody step was omitted.




View larger version (330K):
[in this window]
[in a new window]
 
Fig. 4. Immunohistochemical staining of normal colon mucosa (A–C), large adenocarcinomas (D–F and J–L) and a small adenoma (G–I) for ß-catenin (A, D, G and J), iNOS (B, E, H and K) and COX-2 (C, F, I and L). (A) ß-Catenin is mainly localized at the membranes of the cell–cell borders in normal colon epithelial cells; (B) iNOS expression is hardly detectable in either epithelial or stromal cells of normal colon mucosa; (C) COX-2 expression is apparent in some stromal cells and intraepithelial lymphocytes in normal colon mucosa; (D) cytoplasmic and nuclear immunostaining for ß-catenin is pronounced in adenocarcinoma cells; (E) positive staining for iNOS is clear in carcinoma epithelial cells, predominantly at the luminal surfaces in areas with glandular patterns; (F) COX-2 expression is evident in the cytoplasm and nuclear membranes of carcinoma epithelial cells forming glandular patterns; (G) cytoplasmic and nuclear immunostaining for ß-catenin is positive in adenoma cells; (H) iNOS immunoreactivity in adenoma cells; (I) COX-2 immunoreactivity in stromal cells of a small tumor; (J) cytoplasmic and nuclear immunostaining for ß-catenin is pronounced in both well-differentiated (upper left) and moderately differentiated (lower right) adenocarcinoma cells; (K) iNOS immunoreactivity is positive in the cytoplasm of macrophages (middle part) and at the luminal surfaces of well-differentiated (upper left) but not moderately differentiated (lower right) adenocarcinoma cells; (L) COX-2 is immunostained in well-differentiated adenocarcinoma cells (upper left), macrophages (middle part) and stromal cells (upper left and lower right), but not in the moderately differentiated adenocarcinoma cells (lower right). x100.

 
In normal colon mucosal tissue, iNOS expression was hardly detectable in either epithelial or stromal cells (Figure 4BGo). In contrast, positive staining for iNOS was clearly observed in the carcinoma epithelial cells, predominantly at the luminal surfaces of cells forming glandular patterns (Figure 4EGo) and occasionally in macrophages but not other cells in the stroma (Figure 4KGo), as previously reported (18). iNOS staining was observed in all 14 large adenocarcinomas, six medium adenocarcinomas and five of six small adenocarcinomas, all six adenomas (Figure 4HGo) and three dysplastic ACF, although the staining was rather weak. Positive immunostaining for iNOS was not apparent in any of the 10 hyperplastic ACF (data not shown).

COX-2 expression was observed in stromal elements and intra-epithelial lymphocytes, even in normal colon mucosa (Figure 4CGo). The immunoreactive band for COX-2 in normal colon mucosa was confirmed by immunoblot analysis, with the same monoclonal antibody used in immunohistochemical staining (data not shown). In tumor tissues, COX-2 immunoreactivity was increased in the stroma and, furthermore, the cytoplasm and nuclear membranes were positive in epithelial cells forming glandular patterns (Figure 4FGo). Such expression was observed in 11 of 14 large adenocarcinomas, five of six medium adenocarcinomas and one of six small adenomas, but not in any small adenocarcinomas (Figure 4IGo) nor dysplastic and hyperplastic ACF (data not shown). The staining in most of the medium adenocarcinomas and small adenomas was weaker than in large adenocarcinomas.

Interestingly, iNOS and COX-2 expression were observed in well-differentiated adenocarcinoma cells (Figure 4E and FGo, upper left), but not in moderately differentiated adenocarcinoma cells not forming clear glandular patterns (Figure 4K and LGo, lower right). Altered localization of ß-catenin was seen in both types of carcinoma cells (Figure 4JGo, upper left and lower right).

The results of immunostaining of iNOS and COX-2 are summarized in Table IIIGo. The incidences of K-ras and ß-catenin gene mutations, the altered subcellular localization of ß-catenin and iNOS and COX-2 overexpression in epithelial cells are summarized in Table IVGo.


View this table:
[in this window]
[in a new window]
 
Table III. Expression of iNOS and COX-2 proteins in AOM-induced rat colon lesions
 

View this table:
[in this window]
[in a new window]
 
Table IV. Incidences of mutations of K-ras and ß-catenin genes and expression of iNOS and COX-2 in AOM-induced rat colon lesions
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In the present study of rat colon carcinogenesis, cytoplasmic and nuclear localization of ß-catenin was observed in all dysplastic ACF, adenomas and adenocarcinomas induced by AOM. ß-catenin gene mutations in the GSK-3ß phosphorylation consensus motif, which could have caused accumulation of the protein, were also frequent in dysplastic ACF, adenomas and adenocarcinomas. On the other hand, alteration of ß-catenin was not observed in hyperplastic ACF, although K-ras mutations were frequent, as previously described (17,18). In human ACF, K-ras mutations are also reported to be frequent, whereas APC mutations are relatively rare (<5%), those ACF harboring APC mutations showing dysplastic changes (1921). Moreover, K-ras mutations in human colon tumors have been reported to be rare in small adenomas but frequent in large adenomas (22), as found here. Thus, activation of K-ras may be involved in the formation of hyperplastic ACF and promotion of lesion growth, but is not essential for tumor formation itself. In contrast, alterations of ß-catenin may play an important role in causing early dysplastic changes.

Most of the ß-catenin mutations found in the present study were G:C->A:T transitions, with mutation hot-spots at the second base of codon 34 and the first base of codon 32. The DNA sequences in these two sites are common, being CTGGA->CTGAA. The amino acid sequences neighboring the serine residue at codon 33 are conserved in both ß-catenin and I{kappa}B and are presumed to affect its phosphorylation (23,24). Since the K-ras mutations found in the present study were CTGGT->CTGAT at the second base of codon 12, as previously reported (17,18), CTGGA or CTGGT sites can be considered to be major targets of AOM.

While mutations in the GSK-3ß phosphorylation consensus motif of the ß-catenin gene appear to be associated with alteration of the cellular localization, the mutations were not present in all lesions with cytoplasmic and nuclear immunostaining. Therefore, mutations in other regions, including the APC-binding site, could have been responsible. They have been found to be present in human colon cancer cell lines (25). It is also possible that APC was inactivated by nonsense mutations or that other factors that are involved in the regulation of ß-catenin, such as axin (26) and conductin (27), were genetically altered.

In the present AOM-induced rat colon carcinogenesis model, iNOS was found to be clearly expressed in the carcinoma epithelial cells, predominantly at the luminal surfaces in areas of glandular patterns. The positive expression in dysplastic, but not hyperplastic, ACF suggests that iNOS, like ß-catenin, could play an important role in the early stages of tumor formation. NO is known to cause DNA damage and nitrosylation of proteins (28,29) and increased production in tumor cells would be expected to facilitate accumulation of sequential mutations. Since altered localization of ß-catenin was apparent in all lesions expressing iNOS, a direct or indirect causal relationship is possible. However, iNOS expression within tumors was not homogeneous, in contrast to the ß-catenin alteration, being strongest at the luminal surfaces of well-differentiated adenocarcinoma cells. This implies the involvement of factors other than alteration of ß-catenin alone. In this context, it is of interest that some colon cancer cell lines are known to express iNOS on cytokine treatment (30). Cytokine receptors and/or subcellular components present in well-differentiated cells might thus be involved in their iNOS expression.

Up-regulation of iNOS and/or neuronal nitric oxide synthase has been reported in human tumors of the colon (7), prostate (31), ovary and uterus (32,33). Recently, ß-catenin mutations were also reported in cancers of these organs (5,6,3437). iNOS expression has also been demonstrated for human gastric cancers (38), known in some cases to bear APC mutations (39). Clarification of the possibility that activation of the APC–ß-catenin/Tcf pathway may be involved in NOS expression awaits examination of both parameters in the same samples.

The present finding of increased COX-2 expression in epithelial cells predominantly in relatively large adenocarcinomas suggests some association with carcinoma growth. COX-2 overexpression has been demonstrated to render tumor cells resistant to apoptosis (40) and to enhance neovascularization (41), thus conferring a survival advantage.

While evidence of an involvement of the Wnt–APC–ß-catenin/Tcf pathway in COX-2 expression has been presented (4244), our results indicate that ß-catenin alteration is not in itself sufficient for its induction. Like iNOS, COX-2 is preferentially expressed in well-differentiated carcinoma cells forming glandular patterns and it has been reported that NO enhances activity and expression of COX-2 in several cell lines (4547). Co-expression of iNOS and COX-2 has been reported for human cancers of the colon (7,8), stomach (38,48), breast (49,50), lung (51,52), esophagus (53,54) and head and neck region (55,56). A causal relationship between the two is therefore conceivable.

In conclusion, alterations of ß-catenin and increased expression of iNOS and, to a lesser extent, of COX-2 occur early in AOM-induced colon carcinogenesis in rats, suggesting that alteration of ß-catenin may be involved in the induction of iNOS expression. ß-Catenin alterations and iNOS expression may play important roles in causing dysplastic changes, while COX-2 overexpression may contribute to tumor growth. Further studies of links among the cancer-related factors ß-catenin, iNOS and COX-2 are warranted.


    Notes
 
1 To whom correspondence should be addressed Email: mtakahas{at}gan2.ncc.go.jp Back


    Acknowledgments
 
We thank Emi Abe for expert technical assistance. This work was supported in part by a Grant-in-Aid for Cancer Research from the Ministry of Health and Welfare, Japan, a grant from the TAKEDA Science Foundation, Japan, a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (J.S.P.S.), and a grant from the Organization for Pharmaceutical Safety and Research (OPSR) of Japan. M.M. is the recipient of a Research Resident Fellowship from the Foundation for Promotion of Cancer Research.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Miller,J.R. and Moon,R.T. (1996) Signal transduction through ß-catenin and specification of cell fate during embryogenesis. Genes Dev., 10, 2527–2539.[Free Full Text]
  2. Rubinfeld,B., Souza,B., Albert,I., Müller,O., Chamberlain,S.H., Masiarz,F.R., Munemitsu,S. and Polakis,P. (1993) Association of the APC gene product with ß-catenin. Science, 262, 1731–1734.[Abstract/Free Full Text]
  3. Munemitsu,S., Albert,I., Souza,B., Rubinfeld,B. and Polakis,P. (1995) Regulation of intracellular ß-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc. Natl Acad. Sci. USA, 92, 3046–3050.[Abstract/Free Full Text]
  4. Yost,C., Torres,M., Miller,J.R., Huang,E., Kimelman,D. and Moon,R.T. (1996) The axis-inducing activity, stability, and subcellular distribution of ß-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev., 10, 1443–1454.[Abstract/Free Full Text]
  5. Morin,P.J., Sparks,A.B., Korinek,V., Barker,N., Clevers,H., Vogelstein,B. and Kinzler,K.W. (1997) Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science, 275, 1787–1790.[Abstract/Free Full Text]
  6. Sparks,A.B., Morin,P.J., Vogelstein,B. and Kinzler,K.W. (1998) Mutational analysis of the APC/ß-catenin/Tcf pathway in colorectal cancer. Cancer Res., 58, 1130–1134.[Abstract/Free Full Text]
  7. Ambs,S., Merriam,W.G., Bennett,W.P., Felley-Bosco,E., Ogunfusika,M.O., Oser,S.M., Klein,S., Shields,P.G., Billiar,T.R. and Harris,C.C. (1998) Frequent nitric oxide synthase-2 expression in human colon adenomas: implication for tumor angiogenesis and colon cancer progression. Cancer Res., 58, 334–341.[Abstract/Free Full Text]
  8. Eberhart,C.E., Coffey,R.J., Radhika,A., Giardiello,F.M., Ferrenbach,S. and DuBois,R.N. (1994) Up-regulation of cyclooxygenase 2 gene expression in human colorectal adenomas and adenocarcinomas. Gastroenterology, 107, 1183–1188.[Web of Science][Medline]
  9. Erdman,S.H., Wu,H.D., Hixson,L.J., Ahnen,D.J. and Gerner,E.W. (1997) Assessment of mutations in Ki-ras and p53 in colon cancers from azoxymethane- and dimethylhydrazine-treated rats. Mol. Carcinog., 19, 137–144.[Web of Science][Medline]
  10. Caderni,G., Filippo,D., Luceri,C., Fazi,M., Dolara,P. and Bazzicalupo,M. (1997) Apc mutations in aberrant crypt foci and colonic tumors induced by azoxymethane in rats. Proc. Am. Assoc. Cancer Res., 38, 467.
  11. Takahashi,M., Fukuda,K., Sugimura,T. and Wakabayashi,K. (1998) ß-Catenin is frequently mutated and demonstrates altered cellular location in azoxymethane-induced rat colon tumors. Cancer Res., 58, 42–46.[Abstract/Free Full Text]
  12. Takahashi,M., Fukuda,K., Ohata,T., Sugimura,T. and Wakabayashi,K. (1997) Increased expression of inducible and endothelial constitutive nitric oxide synthases in rat colon tumors induced by azoxymethane. Cancer Res., 57, 1233–1237.[Abstract/Free Full Text]
  13. DuBois,R.N., Radhika,A., Reddy,B.S. and Entingh,A.J. (1996) Increased cyclooxygenase-2 levels in carcinogen-induced rat colonic tumors. Gastroenterology, 110, 1259–1262.[Web of Science][Medline]
  14. Shao,J., Sheng,H., Aramandla,R., Pereira,M.A., Lubet,R.A., Hawk,E., Grogan,L., Kirsch,I.R., Washington,M.K., Beauchamp,R.D. and DuBois,R.N. (1999) Coordinate regulation of cyclooxygenase-2 and TGF-ß1 in replication error-positive colon cancer and azoxymethane-induced rat colonic tumors. Carcinogenesis, 20, 185–191.[Abstract/Free Full Text]
  15. Takahashi,M., Fukutake,M., Isoi,T., Fukuda,K., Sato,H., Yazawa,K., Sugimura,T. and Wakabayashi,K. (1997) Suppression of azoxymethane-induced rat colon carcinoma development by a fish oil component, docosahexaenoic acid (DHA). Carcinogenesis, 18, 1337–1342.[Abstract/Free Full Text]
  16. Takahashi,M., Minamoto,T., Sugimura,T. and Esumi,H. (1993) High frequency and low specificity of ras gene mutations in rat Zymbal's gland tumors induced by 2-amino-3-methylimidazo[4,5-f]quinoline. Carcinogenesis, 14, 1355–1357.[Abstract/Free Full Text]
  17. Stopera,S.A., Murphy,L.C. and Bird,R.P. (1992) Evidence for a ras gene mutation in azoxymethane-induced colonic aberrant crypts in Sprague–Dawley rats: earliest recognizable precursor lesions of experimental colon cancer. Carcinogenesis, 13, 2081–2085.[Abstract/Free Full Text]
  18. Vivona,A.A., Shpitz,B., Medline,A., Bruce,W.R., Hay,K., Ward,M.A. Stern,H.S. and Gallinger,S. (1993) K-ras mutations in aberrant crypt foci, adenomas and adenocarcinomas during azoxymethane-induced colon carcinogenesis. Carcinogenesis, 14, 1777–1781.[Abstract/Free Full Text]
  19. Jen,J., Powell,S.M., Papadopoulos,N., Smith,K.J., Hamilton,S.R., Vogelstein,B. and Kinzler,K.W. (1994) Molecular determinants of dysplasia in colorectal lesions. Cancer Res., 54, 5523–5526.[Abstract/Free Full Text]
  20. Smith,A.J., Stern,H.S., Penner,M., Hay,K., Mitri,A., Bapat,B.V. and Gallinger,S. (1994) Somatic APC and K-ras codon 12 mutations in aberrant crypt foci from human colons. Cancer Res., 54, 5527–5530.[Abstract/Free Full Text]
  21. Otori,K., Konishi,M., Sugiyama,K., Hasebe,T., Shimoda,T., Kikuchi-Yanoshita,R., Mukai,K., Fukushima,S., Miyaki,M. and Esumi, H. (1998) Infrequent somatic mutation of the adenomatous polyposis coli gene in aberrant crypt foci of human colon tissue. Cancer, 83, 896–900.[Web of Science][Medline]
  22. Ichii,S., Takeda,S., Horii,A., Nakatsuru,S., Miyoshi,Y., Emi,M., Fujiwara,Y., Koyama,K., Furuyama,J., Utsunomiya,J. and Nakamura,Y. (1993) Detailed analysis of genetic alterations in colorectal tumors from patients with and without familial adenomatous polyposis (FAP). Oncogene, 8, 2399–2405.[Web of Science][Medline]
  23. Aberle,H., Bauer,A., Stappert,J., Kispert,A. and Kemler,R. (1997) ß-Catenin is a target for the ubiquitin-proteasome pathway. EMBO J., 16, 3797–3804.[Web of Science][Medline]
  24. Chen,Z., Hagler,J., Palombella,V.J., Melandri, F., Scherer,D., Ballard,D. and Maniatis,T. (1995) Signal-induced site-specific phosphorylation targets I{kappa}B{alpha} to the ubiquitin-proteasome pathway. Genes Dev., 9, 1586–1597.[Abstract/Free Full Text]
  25. Ilyas,M., Tomlinson,I.P.M., Rowan,A., Pignatelli,M. and Bodmer,W.F. (1997) ß-Catenin mutations in cell lines established from human colorectal cancers. Proc. Natl Acad. Sci. USA, 94, 10330–10334.[Abstract/Free Full Text]
  26. Ikeda,S., Kishida,S., Yamamoto,H., Murai,H., Koyama,S. and Kikuchi,A. (1998) Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3ß and ß-catenin and promotes GSK-3ß-dependent phosphorylation of ß-catenin. EMBO J., 17, 1371–1384.[Web of Science][Medline]
  27. Behrens,J., Jerchow,B.-A., Würtele,M., Grimm,J., Asbrand,C., Wirtz,R., Kühl,M., Wedlich,D. and Birchmeier,W. (1998) Functional interaction of an axin homolog, conductin, with ß-catenin, APC and GSK-3ß. Science, 280, 596–599.[Abstract/Free Full Text]
  28. Wink,D.A., Vodovotz,Y., Laval,J., Laval,F., Dewhirst,M.W. and Mitchell,J.B. (1998) The multifaceted roles of nitric oxide in cancer. Carcinogenesis, 19, 711–721.[Abstract/Free Full Text]
  29. Stamler,J.S., Simon,D.I., Osborne,J.A., Mullins,M.E., Jaraki,O., Michel,T., Singel,D.J. and Loscalzo,J. (1992) S-Nitrosylation of proteins with nitric oxide: synthesis and characterization of biologically active compounds. Proc. Natl Acad. Sci. USA, 89, 444–448.[Abstract/Free Full Text]
  30. Jenkins,D.C., Charles,I.G., Baylis,S.A., Lelchuk,R., Radomski,M.W. and Moncada,S. (1994) Human colon cancer cell lines show a diverse pattern of nitric oxide synthase gene expression and nitric oxide generation. Br. J. Cancer, 70, 847–849.[Web of Science][Medline]
  31. Klotz,T., Bloch,W., Volberg,C., Engelmann,U. and Addicks,K. (1998) Selective expression of inducible nitric oxide synthase in human prostate carcinoma. Cancer, 82, 1897–1903.[Web of Science][Medline]
  32. Thomsen,L.L., Lawton,F.G., Knowles,R.G., Beesley,J.E., Riveros-Moreno,V. and Moncada,S. (1994) Nitric oxide synthase activity in human gynecological cancer. Cancer Res., 54, 1352–1354.[Abstract/Free Full Text]
  33. Franchi,A.M., Chaud,M., Rettori,V., Suburo,A., McCann,S.M. and Gimeno,M. (1994) Role of nitric oxide in eicosanoid synthesis and uterine motility in estrogen-treated rat uteri. Proc. Natl Acad. Sci. USA, 91, 539–543.[Abstract/Free Full Text]
  34. Voeller,H.J., Truica,C.I. and Gelmann,E.P. (1998) ß-Catenin mutations in human prostate cancer. Cancer Res., 58, 2520–2523.[Abstract/Free Full Text]
  35. Palacios,J. and Gamallo,C. (1998) Mutations in the ß-catenin gene (CTNNB1) in endometrioid ovarian carcinomas. Cancer Res., 58, 1344–1347.[Abstract/Free Full Text]
  36. Fukuchi,T., Sakamoto,M., Tsuda,H., Maruyama,K., Nozawa,S. and Hirohashi,S. (1998) ß-Catenin mutation in carcinoma of the uterine endometrium. Cancer Res., 58, 3526–3528.[Abstract/Free Full Text]
  37. Kobayashi,K., Sagae,S., Nishioka,Y., Tokino,T. and Kudo,R. (1999) Mutations of the ß-catenin gene in endometrial carcinomas. Jpn J. Cancer Res., 90, 55–59.[Web of Science][Medline]
  38. Rajnakova,A., Goh,P.M.Y., Chan,S.T.F., Ngoi,S.S., Alponat,A. and Moochhala,S. (1997) Expression of differential nitric oxide synthase isoforms in human normal gastric mucosa and gastric cancer tissue. Carcinogenesis, 18, 1841–1845.[Abstract/Free Full Text]
  39. Horii,A., Nakatsuru,S., Miyoshi,Y., Ichii,S., Nagase,H., Kato,Y., Yanagisawa,A. and Nakamura,Y. (1992) The APC gene, responsible for familial adenomatous polyposis, is mutated in human gastric cancer. Cancer Res., 52, 3231–3233.[Abstract/Free Full Text]
  40. Tsujii,M. and DuBois,R.N. (1995) Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2. Cell, 83, 493–501.[Web of Science][Medline]
  41. Tsujii,M., Kawano,S., Tsujii,S., Sawaoka,H., Hori,M. and DuBois,R.N. (1998) Cyclooxygenase regulates angiogenesis induced by colon cancer cells. Cell, 93, 705–716.[Web of Science][Medline]
  42. Prescott,S.M. and White,R.L. (1996) Self-promotion? Intimate connections between APC and prostaglandin H synthase-2. Cell, 87, 783–786.[Web of Science][Medline]
  43. Howe,L.R., Subbaramaiah,K., Chung,W.J., Dannenberg,A.J. and Brown,A.M.C. (1999) Transcriptional activation of Cyclooxygenase-2 in Wnt-1-transformed mouse mammary epithelial cells. Cancer Res., 59, 1572–1577.[Abstract/Free Full Text]
  44. Mei,J.M., Hord,N.G., Winterstein,D.F., Donald,S.P. and Phang,J.M. (1999) Differential expression of prostaglandin endoperoxide H synthase-2 and formation of activated ß-catenin-LEF-1 transcription complex in mouse colonic epithelial cells contrasting in Apc. Carcinogenesis, 20, 737–740.[Abstract/Free Full Text]
  45. Salvemini,D., Misko,T.P., Masferrer,J.L., Seibert,K., Currie,M.G. and Needleman,P. (1993) Nitric oxide activates cyclooxygenase enzymes. Proc. Natl Acad. Sci. USA, 90, 7240–7244.[Abstract/Free Full Text]
  46. Corbett,J.A., Kwon,G., Turk,J. and McDaniel,M.L. (1993) IL-1ß induces the coexpression of both nitric oxide synthase and cyclooxygenase by islets of Langerhans: activation of cyclooxygenase by nitric oxide. Biochemistry, 32, 13767–13770.[Medline]
  47. Salvemini,D., Seibert,K., Masferrer,J.L., Misko,T.P., Currie,M.G. and Needleman,P. (1994) Endogenous nitric oxide enhances prostaglandin production in a model of renal inflammation. J. Clin. Invest., 93, 1940–1947.
  48. Ristimäki,A., Honkanen,N., Jänkälä,H., Sipponen,P. and Härkönen,M. (1997) Expression of cyclooxygenase-2 in human gastric carcinoma. Cancer Res., 57, 1276–1280.[Abstract/Free Full Text]
  49. Thomsen,L.L., Miles,D.W., Happerfield,L., Bobrow,L.G., Knowles,R.G. and Moncada,S. (1995) Nitric oxide synthase activity in human breast cancer. Br. J. Cancer, 72, 41–44.[Web of Science][Medline]
  50. Parrett,M.L., Harris,R.E., Joarder,F.S., Ross,M.S., Clausen,K.P. and Robertson F.M. (1997) Cyclooxygenase-2 gene expression in human breast cancer. Int. J. Oncol., 10, 503–507.
  51. Fujimoto,H., Ando,Y., Yamashita,T., Terazaki,H., Tanaka,Y., Sasaki,J., Matsumoto,M., Suga,M. and Ando,M. (1997) Nitric oxide synthase activity in human lung cancer. Jpn J. Cancer Res., 88, 1190–1198.[Web of Science][Medline]
  52. Hida,T., Yatabe,Y., Achiwa,H., Muramatsu,H., Kozaki,K., Nakamura, S., Ogawa,M., Mitsudomi,T., Sugiura,T. and Takahashi,T. (1998) Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res., 58, 3761–3764.[Abstract/Free Full Text]
  53. Wilson,K.T., Fu,S., Ramanujam,K.S. and Meltzer,S.J. (1998) Increased expression of inducible nitric oxide synthase and cyclooxygenase-2 in Barrett's esophagus and associated adenocarcinomas. Cancer Res., 58, 2929–2934.[Abstract/Free Full Text]
  54. Zimmermann,K.C., Sarbia,M., Weber,A.-A., Borchard,F., Gabbert,H.E. and Schrör,K. (1999) Cyclooxygenase-2 expression in human esophageal carcinoma. Cancer Res., 59, 198–204.[Abstract/Free Full Text]
  55. Rosbe,K.W., Prazma,J., Petrusz,P., Mims,W., Ball,S.S. and Weissler,M.C. (1995) Immunohistochemical characterization of nitric oxide synthase activity in squamous cell carcinoma of the head and neck. Otolaryngol. Head Neck Surg., 113, 541–549.[Web of Science][Medline]
  56. Chan,G., Boyle,J.O., Yang,E.K., Zhang,F., Sacks,P.G., Shah,J.P., Edelstein,D., Soslow,R.A., Koki,A.T., Woerner,B.M., Masferrer,J.L. and Dannenberg,A.J. (1999) Cyclooxygenase-2 expression is up-regulated in squamous cell carcinoma of the head and neck. Cancer Res., 59, 991–994.[Abstract/Free Full Text]
Received January 10, 2000; revised March 7, 2000; accepted March 8, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
R. Tammali, A. B. M. Reddy, K. V. Ramana, J. M. Petrash, and S. K. Srivastava
Aldose reductase deficiency in mice prevents azoxymethane-induced colonic preneoplastic aberrant crypt foci formation
Carcinogenesis, May 1, 2009; 30(5): 799 - 807.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Takahashi, T. Kitahashi, R. Ishigamori, M. Mutoh, M. Komiya, H. Sato, Y. Kamanaka, M. Naka, T. Maruyama, T. Sugimura, et al.
Increased expression of inducible nitric oxide synthase (iNOS) in N-nitrosobis(2-oxopropyl)amine-induced hamster pancreatic carcinogenesis and prevention of cancer development by ONO-1714, an iNOS inhibitor
Carcinogenesis, August 1, 2008; 29(8): 1608 - 1613.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T. Imai, K. Fukuta, M. Hasumura, Y.-M. Cho, Y. Ota, S. Takami, H. Nakagama, and M. Hirose
Significance of inflammation-associated regenerative mucosa characterized by Paneth cell metaplasia and {beta}-catenin accumulation for the onset of colorectal carcinogenesis in rats initiated with 1,2-dimethylhydrazine
Carcinogenesis, October 1, 2007; 28(10): 2199 - 2206.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Zhang, A. Ma, S. J. Urbanski, and D.-M. McCafferty
Induction of inducible nitric oxide synthase: a protective mechanism in colitis-induced adenocarcinoma
Carcinogenesis, May 1, 2007; 28(5): 1122 - 1130.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Vanamala, T. Leonardi, B. S. Patil, S. S. Taddeo, M. E. Murphy, L. M. Pike, R. S. Chapkin, J. R. Lupton, and N. D. Turner
Suppression of colon carcinogenesis by bioactive compounds in grapefruit
Carcinogenesis, June 1, 2006; 27(6): 1257 - 1265.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Wang and W. K. MacNaughton
Overexpressed {beta}-Catenin Blocks Nitric Oxide-Induced Apoptosis in Colonic Cancer Cells
Cancer Res., October 1, 2005; 65(19): 8604 - 8607.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. P.Y. Lee, D. D. Mruk, C.-h. Wong, and C. Y. Cheng
Regulation of Sertoli-Germ Cell Adherens Junction Dynamics in the Testis Via the Nitric Oxide Synthase (NOS)/cGMP/Protein Kinase G (PRKG)/{beta}-Catenin (CATNB) Signaling Pathway: An In Vitro and In Vivo Study
Biol Reprod, September 1, 2005; 73(3): 458 - 471.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T. Tanaka, R. Suzuki, H. Kohno, S. Sugie, M. Takahashi, and K. Wakabayashi
Colonic adenocarcinomas rapidly induced by the combined treatment with 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine and dextran sodium sulfate in male ICR mice possess {beta}-catenin gene mutations and increases immunoreactivity for {beta}-catenin, cyclooxygenase-2 and inducible nitric oxide synthase
Carcinogenesis, January 1, 2005; 26(1): 229 - 238.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. A. Adegboyega, O. Ololade, J. Saada, R. Mifflin, J. F. Di Mari, and D. W. Powell
Subepithelial Myofibroblasts Express Cyclooxygenase-2 in Colorectal Tubular Adenomas
Clin. Cancer Res., September 1, 2004; 10(17): 5870 - 5879.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Liu, G. L. Borchert, and J. M. Phang
Polyoma Enhancer Activator 3, an Ets Transcription Factor, Mediates the Induction of Cyclooxygenase-2 by Nitric Oxide in Colorectal Cancer Cells
J. Biol. Chem., April 30, 2004; 279(18): 18694 - 18700.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Ochiai, M. Ushigome, K. Fujiwara, T. Ubagai, T. Kawamori, T. Sugimura, M. Nagao, and H. Nakagama
Characterization of Dysplastic Aberrant Crypt Foci in the Rat Colon Induced by 2-Amino-1-Methyl-6-Phenylimidazo[4,5-b]Pyridine
Am. J. Pathol., October 1, 2003; 163(4): 1607 - 1614.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. A. Crowell, V. E. Steele, C. C. Sigman, and J. R. Fay
Is Inducible Nitric Oxide Synthase a Target for Chemoprevention?
Mol. Cancer Ther., August 1, 2003; 2(8): 815 - 823.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
H. Chung, D. Wu, R. Gay, S. N. Han, B. Goldin, R. Bronson, J. Mason, D. E. Smith, and S. N. Meydani
Effect of Age on Susceptibility to Azoxymethane-Induced Colonic Aberrant Crypt Foci Formation in C57BL/6JNIA Mice
J. Gerontol. A Biol. Sci. Med. Sci., May 1, 2003; 58(5): B400 - 405.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T. Kawamori, N. Uchiya, T. Sugimura, and K. Wakabayashi
Enhancement of colon carcinogenesis by prostaglandin E2 administration
Carcinogenesis, May 1, 2003; 24(5): 985 - 990.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Araki, S. Okamura, S. P. Hussain, M. Nagashima, P. He, M. Shiseki, K. Miura, and C. C. Harris
Regulation of Cyclooxygenase-2 Expression by the Wnt and Ras Pathways
Cancer Res., February 1, 2003; 63(3): 728 - 734.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Murakami, D. Takahashi, T. Kinoshita, K. Koshimizu, H. W. Kim, A. Yoshihiro, Y. Nakamura, S. Jiwajinda, J. Terao, and H. Ohigashi
Zerumbone, a Southeast Asian ginger sesquiterpene, markedly suppresses free radical generation, proinflammatory protein production, and cancer cell proliferation accompanied by apoptosis: the {alpha},{beta}-unsaturated carbonyl group is a prerequisite
Carcinogenesis, May 1, 2002; 23(5): 795 - 802.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (68)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, M.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?