Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Schlosshauer, P. W.
Right arrow Articles by Kitajewski, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schlosshauer, P. W.
Right arrow Articles by Kitajewski, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 21, No. 7, 1453-1456, July 2000
© 2000 Oxford University Press


Short Communication

APC truncation and increased ß-catenin levels in a human breast cancer cell line

Peter W. Schlosshauer1,3, Stephen A. Brown2, Katarina Eisinger2, Qingyou Yan1, Enrica R. Guglielminetti2, Ramon Parsons1, Lora Hedrick Ellenson3 and Jan Kitajewski1,2,4

1 Department of Pathology and
2 Department of Obstetrics and Gynecology, Columbia University, College of Physicians and Surgeons, 630 West 168th Street, New York, NY 10032 and
3 Department of Pathology, Weill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021, USA


    Abstract
 Top
 Abstract
 Introduction
 References
 
Mutations in the Adenomatous Polyposis Coli (APC) tumor suppressor gene or the ß-catenin gene are present in most colon cancers and less frequently in other tumor types. In this study, we screened 24 human breast cancer cell lines and three immortalized human breast epithelial cell lines for alterations in ß- and {gamma}-catenin and APC by western blotting, protein truncation assay and DNA sequence analysis. In one cell line (DU 4475), an APC mutation was identified (E1577stop) that resulted in expression of truncated APC. This mutation was associated with elevated cytosolic ß-catenin levels, probably due to loss of APC function, as in colon cancers. No mutations were found in exon 3 of the ß- or {gamma}-catenin genes. We conclude that APC mutations and ß-catenin upregulation may occur with low frequency in human breast cancer cells.


    Introduction
 Top
 Abstract
 Introduction
 References
 
ß-Catenin, a key cytosolic component of the Wnt signal transduction pathway, is implicated in embryonic development and carcinogenesis. Normally, cytosolic ß-catenin is maintained at low levels by the APC gene product, which promotes ß-catenin degradation, and by cadherins, which integrate ß-catenin into adherens junctions (1). Wnt signal activation results in stabilization of ß-catenin (24) and subsequent translocation of ß-catenin to the nucleus, where it binds to TCF-class transcriptional factors and induces expression of TCF-responsive genes (5,6). {gamma}-Catenin has structural and functional similarities to ß-catenin (1) but its role in Wnt signaling has not been elucidated. Several reports have documented that deregulation of the Wnt pathway is associated with human tumorigenesis. Truncations of the APC protein are linked to the familial adenomatous polyposis (FAP) coli syndrome and are found in the majority of sporadic colon carcinomas (7). Mutations in either APC or ß-catenin, resulting in deregulation of ß-catenin turnover, increase ß-catenin/Tcf signaling in colon cancer (8) and melanoma cell lines (9).

The APC encoding locus on chromosome 5q21 shows loss of heterozygosity (LOH) in ~25% of breast cancers (10). Frequent alterations in expression of E-cadherin and {alpha}- and ß-catenins have been reported in a survey of 18 human breast cancer cell lines (11). High Wnt gene expression (Wnt-2, Wnt-4, Wnt-7b) has been seen in human proliferative breast lesions (12). Overexpression of Wnt-1 and Wnt-3 in the murine mammary gland induces mammary hyperplasia and increases the incidence of mammary gland tumors (1). In addition, APCmin mice, which represent a model for the human FAP syndrome, have an increased incidence not only for intestinal neoplasias but also for mammary tumors (13). Despite the link between Wnt signal activation and mammary gland tumors in the mouse, comparable signal activation due to mutations in genes encoding Wnt signaling components has not been documented in human breast cancer. In the present study, we screened a panel of 27 cell lines, either derived from human breast carcinomas or established by immortalization of normal breast epithelial cells, for alterations in the ß-catenin, {gamma}-catenin and APC proteins and for mutations in the APC, ß- and {gamma}-catenin genes.

Cell lines BT 20, BT 474, BT 483, BT 549, CAMA 1, DU 4475, HBL 100, HS 578 T, MCF7, MCF10A, MDA-MB 157, MDA-MB 175 VII, MDA-MB 231, MDA-MB 330, MDA-MB 361, MDA-MB 415, MDA-MB 435S, MDA-MB 436, MDA-MB 453, MDA-MB 468, SKBR 3, T 47 D, UACC 812, UACC 893, ZR 75-1 and ZR 75-30 were purchased from the American Type Culture Collection (ATCC; Rockville, MD). MCF10A is a spontaneously immortalized line from normal human breast epithelial cells, and HBL 100 is an SV40 immortalized human breast epithelial cell line. HB2, another SV40 immortalized human breast epithelial cell line, was obtained from Dr Joyce Taylor-Papadimitriou (London, UK). Cells were grown under recommended conditions and harvested at 90–100% confluency. For total cell protein extraction, cells were lysed in TENT buffer (50 mM Tris pH 8.0, 1 mM EDTA, 150 mM NaCl, 1% Triton X-100), centrifuged, the supernatant admixed with protein sample buffer and boiled. Cytosolic and membranous fractionation was carried out as described previously (3). Total protein (30 µg) was separated by electrophoresis on 8% SDS–polyacrylamide gels, transferred onto nitrocellulose (Micron Separations Inc., Westboro, MA) and identified using primary antibodies against ß- and {gamma}-catenin (Transduction Laboratories, Lexington, KY), and chemiluminescence detection (ECL; Amersham, Arlington Heights, IL). To screen for mutations in exon 3 of the ß- and {gamma}-catenin genes, a portion of that exon was amplified from genomic DNA from all cell lines using the following primer pairs: ß-catenin, Forward(F) 5'-ATTTGATGGAGTTGGACATGGC-3' and Reverse(R) 5'-GAGGAAGAGGATGTGGATACCTCC-3'; {gamma}-catenin, F 5'-AGCCACGATGGAGGTGATGAAC-3' and R 5'-CCTGGGTGTAAGTGGTGGTTTTC-3'.

To analyze the entire ß-catenin gene from DU4475, cDNA was synthesized in 12 separate RT–PCR reactions (primer sequences available upon request) using total RNA as template. cDNA was then PCR-amplified, submitted to automated sequencing and compared to the published ß-catenin sequence (14). To screen breast cancer cell lines for truncation mutations in APC, the TNT® coupled reticulocyte lysate system (Promega, Madison, WI) was used, following the manufacturer's instructions. Two overlapping segments of the APC gene, spanning the region from codon 686 to 1693, were amplified from cDNA using the following T7-modified primers (T7-trans = GGATCCTAATACGACTCACTATAGGGAGACCACCATGG): segment A (codons 686-1217 ), F 5'-T7-trans–ATGCATGTGGAACTTTGTGG-3' and R 5'-GAGGATCCATTAGATGAAGGTGTGGACG-3'; segment B (codons 1099–1693), F 5'-T7-trans–TTTCTCCATACAGGTCACGG-3' and R 5'-GGAGGATCCTGTAGGAATGGTATCTCG-3'.

Aliquots of 5 µl of the in vitro transcription/translation reaction were separated on 4–20% Tris–HCl SDS–polyacrylamide gels (Ready Gel®; Bio-Rad, Hercules, CA) and the product visualized by autoradiography (BioMax Kodak, Rochester, NY). Segment B of the APC gene in cell line DU 4475 was sequenced using the Thermo Sequenase® kit (Amersham, Arlington Heights, IL). Additional primers (sequences available upon request) were obtained from Operon Technologies Inc. (Alameda, CA). An aliquot of 2 µl of the chain-termination reaction products were submitted to electrophoresis on a CastAway® sequencing device (Stratagene, La Jolla, CA) using precast 6% polyacrylamide–7 M urea gels and visualized by autoradiography (BioMax; Kodak, Rochester, NY). All experiments were performed at least twice.

Total cell lysate western blot analysis (Figure 1Go) showed strong expression of ß-catenin in BT 20, BT 474, BT 483, BT 549, DU 4475, HB2, HBL 100, HS 578 T, MCF7, MCF10A, MDA-MB 157, MDA-MB 175 VII, MDA-MB 231, MDA-MB 361, MDA-MB 415, MDA-MB 468, T 47 D, UACC 893, ZR 75-1 and C57-Wnt-1 (positive control); weak expression was seen in CAMA 1, MDA-MB 435 S, MDA-MB 436, MDA-MB 453 and UACC 812; ß-catenin was detected at very low levels in MDA-MB 330, SKBR 3 and ZR75-30. In DU 4475, ß-catenin expression was extremely strong, exceeding the positive control (Figure 1AGo). In MDA-MB 468, a double band was seen with a second signal at ~80 kDa (Figure 1AGo).



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 1. Total cell lysates from breast cancer cell lines analyzed by western blot for ß-catenin (A) and {gamma}-catenin (B). HB2 serves as control. (A) ß-Catenin blot. Note significant overexpression of ß-catenin in DU 4475 as compared to control and other cell lines. (B) {gamma}-Catenin blot. {gamma}-catenin expression in DU 4475 is strong, but not exceeding levels in other cell lines.

 
{gamma}-Catenin expression was strong in BT 20, BT 474, BT 483, BT 549, CAMA 1, DU 4475, HB2, HBL 100, MCF7, MCF10A, MDA-MB 157, MDA-MB 175 VII, MDA-MB 361, MDA-MB 415, MDA-MB 468, SKBR 3, T47D, UACC 812, UACC 893 and ZR 75-1; weak in HS 578 T. MDA-MB 231, MDA-MB 435 S, MDA-MB 436, MDA-MB 453, ZR 75–30 and C 57-Wnt-1; and not detectable in MDA-MB 330 (Figure 1BGo). All detectable ß- and {gamma}-catenin signals migrated at the expected position for an apparent molecular weight of 92 and 82 kDa, respectively.

On the basis of these results, the following cell lines were selected for analysis of cytosolic (Figure 2Go) and membranous protein fractions (data not shown): CAMA 1 (weak expression of ß-catenin), DU 4475 (high expression of ß-catenin), HS 578 T (low levels of {gamma}-catenin), MDA-MB 468 (ß-catenin double band), SKBR 3 (low levels of ß-catenin) and HB2 (control). As expected, in most lines ß- and {gamma}-catenin levels were very low in the cytoplasmic fraction (Figure 2Go), whereas both proteins were prominent in the membranous fraction (data not shown). Of the cell lines analyzed, ß-catenin was significantly elevated in the cytosolic fraction of DU 4475 (Figure 2Go). {gamma}-Catenin levels were slightly stronger in the cytosolic fraction of DU 4475, as compared with the other cell lines analyzed, but not to the extent exhibited for ß-catenin. Low levels of ß-catenin in CAMA 1 (Figure 1Go) were confirmed in the fractionated analysis (Figure 2Go).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2. ß- and {gamma}-catenin levels in the cytosolic fraction of selected breast cancer cell lines, analyzed by western blot. HB2 serves as control. Note increased content of cytosolic ß-catenin in DU 4475.

 
We analyzed the serine/threonine region encoded by exon 3 of the ß- and {gamma}-catenin genes from all cell lines and the entire ß-catenin gene from DU 4475. However, no mutations were identified in our study.

The protein truncation assay was performed on two APC segments encompassing codons 686 through 1693 for all cell lines listed except HB2, MCF10A, MDA-MB 330 and MDA-MB 435S. Of all protein products, one showed an aberrant size: The segment B product from DU 4475 had an apparent molecular weight of 70 kDa instead of the expected 100 kDa (Figure 3AGo). No wild-type allele, or full length protein product, was detected in this cell line (Figure 3AGo). Sequencing of the respective APC gene segment revealed a point mutation at position 4747 of the coding sequence (G->T), converting codon 1577 into a stop codon (E1577stop) (Figure 3BGo).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3. (A) Protein truncation assay of segment B (codons 1099 to 1693) of the APC gene. The control was generated with a human genomic DNA sample known to have the wild type APC gene. A truncated protein is expressed in DU 4475. Representative for all other breast cancer cell lines, the protein segment in ZR 75-1 is of normal size. (B) Partial sequence of the APC gene from genomic DNA of cell line DU4475 and a normal control. As denoted by arrows, a G->T transversion creates a stop codon at amino acid 1577.

 
We analyzed 24 human breast carcinoma cell lines and three immortalized human breast epithelial cell lines for alterations in ß-/{gamma}-catenin and APC. Mutations in the APC or ß-catenin genes that result in accumulation of ß-catenin have been reported in several carcinoma cell lines (8,9,15,16). We hypothesized that similar aberrancies may play a role in human mammary tumorigenesis. Our analysis focused on cancer cell lines to correlate mutations in APC or ß-catenin with changes in ß-catenin levels. Our APC analysis comprised the region from codon 686 to codon 1693 of the APC coding sequence. This includes the mutation cluster region (MCR; codons 1286–1513) which contains 65% of the APC mutations in colorectal tumors (17). We identified an APC mutation in one cell line (DU 4475) that is associated with upregulation of ß-catenin. This is the first report of an APC truncation resulting in deregulation of ß-catenin in human breast cancer cells. The increased ß-catenin levels in DU 4475 is in keeping with the current concept that the truncated APC protein fails to promote ß-catenin degradation (8,9). The APC mutation in DU 4475 leads to a profound excess of ß-catenin in total cellular extracts (Figure 1AGo) and cytosolic pools (Figure 2Go), whereas {gamma}-catenin levels are less affected (Figures 1B and 2GoGo).

The APC mutation reported here (E1577stop), has not been described previously (based on the Human Gene Mutation Database, http://www.uwcm.ac.uk/uwcm/mg/hgmd0.html ,as of March 6, 2000). It is located at the end of the MCR, in the domain containing seven phosphorylation-dependent ß-catenin binding sites and results in a protein lacking the basic region, the microtubule, DLG and EB1 binding domains (7). Although studies have shown that loss of heterozygosity at the APC site on chromosome 5q21 occurs in up to 38% of primary breast cancers (18,19) only two mutations of the APC gene have been reported, both are point mutations leading to amino acid substitutions (18). In addition, an APC mutation in a primary breast cancer has been reported (20), but no documentation of alterations in ß-catenin levels was presented.

The DU 4475 cell line was derived from a recurrent thoracic wall tumor following mastectomy for a poorly differentiated invasive ductal breast carcinoma in a postmenopausal patient (21). DU4475 cells are highly transformed and do not adhere to the culture dish, but rather grow in suspension. It is not clear whether upregulation of ß-catenin contributes to these growth characteristics. Since APC mutations are rare in breast cancer, we considered the possibility that this mutation was acquired in culture. In our analysis, there was no evidence of a second normal allele. This is interpreted as a hemizygous loss of the other allele since homozygosity for a point mutation would be extremely unlikely. Presumably, the point mutation in one allele (Figure 3BGo) was complemented by loss of the other allele (Figure 3AGo). The acquisition of these two independent mutations is unlikely to occur during propagation in vitro; although it cannot be formally excluded. There is no evidence from the original description (21) that the patient had FAP, suggesting a germline APC mutation.

The variability of expression levels of ß- and {gamma}-catenin in the other lines may represent the normal range of variation. Alternatively, it may be due to translational and post-translational influences or mutations in other regions of the respective genes. Our results of ß- and {gamma}-catenin expression are largely concordant with other reports (11,22). The significance of minor deviations [in contrast to Pierceall et al. (11) we found strong ß-catenin expression in BT 474, MCF7, MDA-MB 231, MDA-MB 468 and ZR 75-1] is uncertain. Concurring with our results, a study of 11 breast carcinomas revealed no mutations in exon 3 of the {alpha}- or ß-catenin genes by RT–PCR and single strand conformation polymorphism (SSCP) analysis (23).

In conclusion, we screened 27 human cell lines derived from breast carcinomas or immortalized breast epithelial cells for alterations in the downstream elements of the Wnt signaling pathway; APC, ß- and {gamma}-catenin. We report the first APC mutation with associated ß-catenin upregulation in a human breast carcinoma cell line (DU 4475). Unlike colon carcinomas and melanomas, however, deregulation of the Wnt signaling pathway does not seem to be a frequent event in human breast carcinomas.


    Notes
 
4 To whom correspondence should be addressed Email: jkk9{at}columbia.edu Back


    Acknowledgments
 
The authors thank Martin Julius, Nick Papadopoulos and Dan Smith for providing comments on the manuscript. This work was supported by grants NIH RO1CA75353 and Marilyn Bokemeier Sperry Fund (to J.K.) and R21CA66224 (to L.H.E.)


    References
 Top
 Abstract
 Introduction
 References
 

  1. Cadigan,K.M. and Nusse,R. (1997) Wnt signaling: a common theme in animal development. Genes Dev., 11, 3286–3305.[Free Full Text]
  2. Giarre,M., Semenov,M.V. and Brown,A.M. (1998) Wnt signaling stabilizes the dual-function protein beta-catenin in diverse cell types. Ann. NY Acad. Sci., 857, 43–55.[Web of Science][Medline]
  3. Shimizu,H., Julius,M.A., Giarre,M., Zheng,Z., Brown,A.M.C. and Kitajewski,J. (1997) Transformation by Wnt family proteins correlates with regulation of ß-catenin. Cell Growth Differ., 8, 1349–1358.[Abstract]
  4. Young,C.S., Kitamura,M., Hardy,S. and Kitajewski,J. (1998) Wnt-1 induces growth, cytosolic ß-catenin and Tcf/Lef transcriptional activation in rat-1 fibroblasts. Mol. Cell. Biol., 18, 2474–2485.[Abstract/Free Full Text]
  5. Kolligs,F.T., Hu,G., Dang,C.V. and Fearon,E.R. (1999) Neoplastic transformation of RK3E by mutant beta-catenin requires deregulation of Tcf/Lef transcription but not activation of c-myc expression. Mol. Cell. Biol., 19, 5696–5706.[Abstract/Free Full Text]
  6. Korinek,V., Barker,N., Morin,P.J., van Wichen,D., de Weger,R., Kinzler,K.W., Vogelstein,B. and Clevers,H. (1997) Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC–/– colon carcinoma. Science, 275, 1784–1787.[Abstract/Free Full Text]
  7. Kinzler,K.W. and Vogelstein,B. (1996) Lessons from hereditary colorectal cancer. Cell, 87, 159–170.[Web of Science][Medline]
  8. Morin,P.J., Sparks,A.B., Korinek,V., Barker,N., Clevers,H., Vogelstein,B. and Kinzler,K.W. (1997) Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science, 275, 1787–1790.[Abstract/Free Full Text]
  9. Rubinfeld,B., Robbins,P., El-Gamil,M., Albert,I., Porfiri,E. and Polakis,P. (1997) Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science, 275, 1790–1792.[Abstract/Free Full Text]
  10. Medeiros,A.C., Nagai,M.A., Neto,M.M. and Brentani,R.R. (1994) Loss of heterozygosity affecting the APC and MCC genetic loci in patients with primary breast carcinomas. Cancer Epidemiol. Biomarkers Prev., 3, 331–333.[Abstract]
  11. Pierceall,W.E., Woodard,A.S., Morrow,J.S., Rimm,D. and Fearon,E.R. (1995) Frequent alterations in E-cadherin and alpha- and beta-catenin expression in human breast cancer cell lines. Oncogene, 11, 1319–1326.[Web of Science][Medline]
  12. Huguet,E.L., McMahon,J.A., McMahon,A.P., Bicknell,R. and Harris,A.L. (1994) Differential expression of human Wnt genes 2, 3, 4 and 7B in human breast cell lines and normal and disease states of human breast tissue. Cancer Res., 54, 2615–2621.[Abstract/Free Full Text]
  13. Moser,A.R., Mattes,E.M., Dove,W.F., Lindstrom,M.J., Haag,J.D. and Gould,M.N. (1993) ApcMin, a mutation in the murine Apc gene, predisposes to mammary carcinomas and focal alveolar hyperplasias. Proc. Natl Acad. Sci. USA, 90, 8977–8981.[Abstract/Free Full Text]
  14. Nollet,F., Berx,G., Molemans,F. and van Roy,F. (1996) Genomic organization of the human beta-catenin gene (CTNNB1). Genomics, 32, 413–424.[Web of Science][Medline]
  15. Caca,K., Kolligs,F.T., Ji,X., Hayes,M., Qian,J., Yahanda,A., Rimm,D.L., Costa,J. and Fearon,E.R. (1999) Beta- and gamma-catenin mutations, but not E-cadherin inactivation, underlie T-cell factor/lymphoid enhancer factor transcriptional deregulation in gastric and pancreatic cancer. Cell Growth Differ., 10, 369–376.[Abstract/Free Full Text]
  16. Garcia-Rostan,G., Tallini,G., Herrero,A., D'Aquila,T.G., Carcangiu,M.L. and Rimm,D.L. (1999) Frequent mutation and nuclear localization of beta-catenin in anaplastic thyroid carcinoma. Cancer Res., 59, 1811–1815.[Abstract/Free Full Text]
  17. Miyoshi,Y., Nagase,H., Ando,H., Horii,A., Ichii,S., Nakatsuru,S., Aoki,T., Miki,Y., Mori,T. and Nakamura,Y. (1992) Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in the APC gene. Hum. Mol. Genet., 1, 229–233.[Abstract/Free Full Text]
  18. Kashiwaba,M., Tamura,G. and Ishida,M. (1994) Aberrations of the APC gene in primary breast carcinoma. J. Cancer Res. Clin. Oncol., 120, 727–731.[Web of Science][Medline]
  19. Sato,T., Tanigami,A., Yamakawa,K., Akiyama,F., Kasumi,F., Sakamoto,G. and Nakamura,Y. (1990) Allelotype of breast cancer: cumulative allele losses promote tumor progression in primary breast cancer. Cancer Res., 50, 7184–7189.[Abstract/Free Full Text]
  20. Sorlie,T., Bukholm,I. and Borrensen-Dale,A.L. (1998) Truncating somatic mutation in exon 15 of the APC gene is a rare event in human breast carcinomas. Mutations in brief no. 179. Online. Hum. Mutat., 12, 215.
  21. Langlois,A.J., Holder,W.D.Jr, Iglehart,J.D., Nelson-Rees,W.A., Wells,S.A.Jr and Bolognesi,D.P. (1979) Morphological and biochemical properties of a new human breast cancer cell line. Cancer Res., 39, 2604–2613.[Abstract/Free Full Text]
  22. Sommers,C.L., Gelmann E.P., Kemler R., Cowin P. and Byers S.W. (1994) Alterations in beta-catenin phosphorylation and plakoglobin expression in human breast cancer cells. Cancer Res., 54, 3544–3552.[Abstract/Free Full Text]
  23. Candidus,S., Bischoff,P., Becker,K.F. and Hofler,H. (1996) No evidence for mutations in the alpha- and beta-catenin genes in human gastric and breast carcinomas. Cancer Res., 56, 49–52.[Abstract/Free Full Text]
Received January 11, 2000; revised March 22, 2000; accepted March 29, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Cancer ResHome page
X. Hu, H. M. Stern, L. Ge, C. O'Brien, L. Haydu, C. D. Honchell, P. M. Haverty, B. A. Peters, T. D. Wu, L. C. Amler, et al.
Genetic Alterations and Oncogenic Pathways Associated with Breast Cancer Subtypes
Mol. Cancer Res., April 1, 2009; 7(4): 511 - 522.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
X. Wang, E. L. Goode, Z. S. Fredericksen, R. A. Vierkant, V. S. Pankratz, W. Liu-Mares, D. N. Rider, C. M. Vachon, J. R. Cerhan, J. E. Olson, et al.
Association of Genetic Variation in Genes Implicated in the {beta}-Catenin Destruction Complex with Risk of Breast Cancer
Cancer Epidemiol. Biomarkers Prev., August 1, 2008; 17(8): 2101 - 2108.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. P.V. Shekhar, L. Tait, and B. Gerard
Essential Role of T-Cell Factor/{beta}-Catenin in Regulation of Rad6B: A Potential Mechanism for Rad6B Overexpression in Breast Cancer Cells
Mol. Cancer Res., October 1, 2006; 4(10): 729 - 745.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. Meniel, T. Hay, A. Douglas-Jones, O. J. Sansom, and A. R. Clarke
Mutations in Apc and p53 Synergize to Promote Mammary Neoplasia
Cancer Res., January 15, 2005; 65(2): 410 - 416.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Rios-Doria, R. Kuefer, S. P. Ethier, and M. L. Day
Cleavage of {beta}-Catenin by Calpain in Prostate and Mammary Tumor Cells
Cancer Res., October 15, 2004; 64(20): 7237 - 7240.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Ryo, Y.-C. Liou, K. P. Lu, and G. Wulf
Prolyl isomerase Pin1: a catalyst for oncogenesis and a potential therapeutic target in cancer
J. Cell Sci., March 1, 2003; 116(5): 773 - 783.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Yan, M. Wiesmann, M. Rohan, V. Chan, A. B. Jefferson, L. Guo, D. Sakamoto, R. H. Caothien, J. H. Fuller, C. Reinhard, et al.
Elevated expression of axin2 and hnkd mRNA provides evidence that Wnt/beta -catenin signaling is activated in human colon tumors
PNAS, December 18, 2001; 98(26): 14973 - 14978.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. K. Virmani, A. Rathi, U. G. Sathyanarayana, A. Padar, C. X. Huang, H. T. Cunnigham, A. J. Farinas, S. Milchgrub, D. M. Euhus, M. Gilcrease, et al.
Aberrant Methylation of the Adenomatous Polyposis Coli (APC) Gene Promoter 1A in Breast and Lung Carcinomas
Clin. Cancer Res., July 1, 2001; 7(7): 1998 - 2004.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Soriano, D. E. Kang, M. Fu, R. Pestell, N. Chevallier, H. Zheng, and E. H. Koo
Presenilin 1 Negatively Regulates {beta}-Catenin/T Cell Factor/Lymphoid Enhancer Factor-1 Signaling Independently of {beta}-Amyloid Precursor Protein and Notch Processing
J. Cell Biol., February 19, 2001; 152(4): 785 - 794.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. van de Wetering, N. Barker, I. C. Harkes, M. van der Heyden, N. J. Dijk, A. Hollestelle, J. G. M. Klijn, H. Clevers, and M. Schutte
Mutant E-cadherin Breast Cancer Cells Do Not Display Constitutive Wnt Signaling
Cancer Res., January 1, 2001; 61(1): 278 - 284.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. C. Mertani, T. Zhu, E. L. K. Goh, K.-O. Lee, G. Morel, and P. E. Lobie
Autocrine Human Growth Hormone (hGH) Regulation of Human Mammary Carcinoma Cell Gene Expression. IDENTIFICATION OF CHOP AS A MEDIATOR OF hGH-STIMULATED HUMAN MAMMARY CARCINOMA CELL SURVIVAL
J. Biol. Chem., June 8, 2001; 276(24): 21464 - 21475.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Schlosshauer, P. W.
Right arrow Articles by Kitajewski, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schlosshauer, P. W.
Right arrow Articles by Kitajewski, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?