Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hulla, J. E.
Right arrow Articles by Dunnick, J. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hulla, J. E.
Right arrow Articles by Dunnick, J. K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 22, No. 1, 89-98, January 2001
© 2001 Oxford University Press


CANCER BIOLOGY

Chromosome 11 allelotypes reflect a mechanism of chemical carcinogenesis in heterozygous p53-deficient mice

Janis E. Hulla2, John E. French1 and June K. Dunnick1

University of North Dakota School of Medicine, Grand Forks, ND and
1 National Institute of Environmental Health Sciences, Research Park, NC, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mice heterozygous for a null p53 allele were administered three well-characterized carcinogens to learn more about mechanisms of carcinogenesis and to evaluate the p53-deficient mouse as a tool for identifying potential human carcinogens. Benzene-induced sarcomas, p-cresidine-induced bladder carcinomas and phenolphthalein-induced thymic lymphomas were allelotyped at the Trp53 locus and chromosome 11 simple sequence length polymorphic (SSLP) loci. Loss of Trp53 and loss of one copy of chromosome 11 occurred in each of 10 lymphomas examined and each of the eight sarcomas examined. Loss of Trp53 and loss of heterozygosity (LOH) at SSLP loci were sporadic in the bladder carcinomas. However, LOH was detected at two or more SSLP loci in six of the eight bladder tumors examined. Loss of one complete copy of chromosome 11 was implicated in three of the bladder tumors where LOH occurred at seven or more widely dispersed SSLP loci. Loss of one copy of chromosome 11 likely occurred through a p53-mediated selection process since Trp53 is located on mouse chromosome 11 and only one copy harbored a functional gene. The data suggest that loss occurred through a mechanism common among the three tumor types. Allelotype patterns of the maternal chromosome 11 were inconsistent with those expected from a nullizygous C57BL/6-Trp53 (N4)xinbred C57BL/6 cross which was reported for production of the mice under investigation. However, comparison with individual control tissues still allowed deduction of maternal chromosome loss. If the breeding protocols were carried out as described, the unexpected allelotype patterns observed in histologically normal tissues might be due to mitotic homologous recombination during embryogenesis.

Abbreviations: HCC, hepatocellular carcinoma; LOH, loss of heterozygosity; NTP, National Toxicology Program; SSLPs, simple sequence length polymorphisms.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
p-Cresidine, benzene and phenolphthalein were identified as carcinogens through epidemiological and/or conventional rodent bioassays. Epidemiological studies linked aromatic amines, including p-cresidine, to a high incidence of bladder cancer among individuals working in the dye manufacturing industry. Benzene is also used in the production of dyes, as well as insecticides, drugs and plastics, and is a component of gasoline. Epidemiologists have defined links between some types of leukemia and individuals occupationally exposed to benzene (1,2). In the light of the epidemiological evidence, pervasiveness in the environmental and positive laboratory tests for genotoxicity (1,2), benzene and p-cresidine were tested in the US National Toxicology Program (NTP) rodent bioassay for identifying carcinogens. Phenolphthalein was also tested. Prior to 1997, phenolphthalein was a widely used over-the-counter laxative. No epidemiological study with a significant prevalence of phenolphthalein users has been reported to suggest that phenolphthalein is a human carcinogen (3). However, phenolphthalein was tested because the potential for abuse of laxatives containing it was high, and it was determined to be genotoxic in vivo (4,5). Benzene and p-cresidine were found to be multi-species, multi-site carcinogens and are now classified as human carcinogens (6,7). Phenolphthalein also induced tumors in a variety of tissues in rats and mice (8). Its status as a human carcinogen is not established. Since the carcinogenic effects were reported, drug manufacturers have reformulated over-the-counter laxatives such that they do not now contain phenolphthalein (9). Less hazardous agents now substitute for benzene, once commonly used as a solvent.

Epidemiological methods and conventional animal bioassays have significant limitations. Epidemiology is retrospective in nature and confounding factors reduce its sensitivity. Animal bioassays retain inherent uncertainties associated with extrapolating from inbred rodent strains to genetically diverse human populations. Therefore, the NTP continues to evaluate transgenic animal models for their usefulness in identifying human carcinogens. The p53-deficient mouse model (10) is currently under evaluation. Mice heterozygous for a null p53 allele [p53(+/–)] were predicted to be selectively responsive to genotoxins in a shortened time frame since carcinogenesis is mediated by dysfunction of one wild-type Trp53. Benzene, p-cresidine and phenolphthalein were among the carcinogens selected for the first phase of the p53(+/–) model evaluation because each agent was well characterized in conventional bioassays as a genotoxic, multi-site, trans-species carcinogen (5,7,8,11).

Many of the carcinogenic effects observed in conventional 2 year cancer bioassays were reproducible in the p53(+/–) mice within 6 months of exposure. In the conventional 2 year bioassay for carcinogenesis increases in the incidences of bladder carcinoma were observed in both sexes of Fischer 344 rats and B6C3F1 mice after p-cresidine was administered in the feed for 104 weeks (7). In p53(+/–) mice p-cresidine induced the same type of bladder tumors after only 24 weeks of feeding (12). In the 2 year phenolphthalein study treatment-related effects observed in B6C3F1 mice included malignant lymphoma of thymic origin (8,13). Thymic lymphomas were induced in p53(+/–) mice after only 4 weeks of feeding phenolphthalein.

The carcinogenic effects of benzene produced in C57BL/6-p53(+/–) mice did not parallel the effects observed in B6C3F1 mice. Strain-specific carcinogenic effects were observed. In a 2 year bioassay where benzene was administered by oral gavage, 344 rats and B6C3F1 mice developed dose-related Zymbal gland carcinoma. Lymphocytopenia was also observed in both rats and mice (6). The benzene-induced subcutaneous sarcomas detected in p53(+/–) mice were not seen in a conventional 2 year study of benzene carcinogenesis. This strain-dependent effect was attributed to tissue-specific mechanisms involving p53 (12). In this context we have been investigating the mechanisms by which phenolphthalein, p-cresidine and benzene induce cancer in p53(+/–) mice. A manuscript reporting the complete loss of one copy of chromosome 11 from phenolphthalein-induced thymic lymphomas is in preparation (J.E.Hulla, J.E.French and J.K.Dunnick, in preparation).


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Animal dose–response assay
The N5 C57BL/6-p53(+/–) mice used in all three investigations were heterozygous for a null p53 allele. Mice were exposed to phenolphthalein (CAS no. 77-09-8), benzene (CAS no. 71-43-2) and p-cresidine (CAS no. 120-71-8) in 26 week bioassays for the purpose of evaluating the p53(+/–) mouse as an efficient model for carcinogen testing. Exposure protocols used in the conventional 2 year studies were followed as closely as possible (68). Benzene was administered by oral gavage at 100 mg/kg (corn oil vehicle at 10 ml/kg body wt). Animals were exposed to p-cresidine in their feed at 0.50%. Phenolphthalein was fed in the diet at doses up to 12 000 p.p.m. Specifics of each study are summarized in Table IGo. The N5 C57BL/6-p53(+/–) TSG-p53 mice were obtained from Taconic (Germantown, NY) and were produced by crossing C57BL/6 males homozygous for the p53 null allele [p53(–/–)] with inbred C57BL/6 females (Figure 1Go).


View this table:
[in this window]
[in a new window]
 
Table I. Mutagenic carcinogen-induced loss of the wild-type p53 allele in C57BL/6 p53(+/–) (N5) mice
 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. The supplier's breeding protocol for production of the wild-type [p53(+/+)], study mice and study mice heterozygous at the null allele [p53(+/–)] is illustrated. N1, N2, N3 and N4 generations were produced by crossing males homozygous at the null allele [p53(–/–)] with inbred C57BL/6 females. The wild-type p53 alleles of the p53(+/–) N5 study mice originated with maternal (N4) C57BL/6NTac animals.

 
Genomic DNA
Genomic DNA samples were isolated from tissues of the p53(+/–) mice obtained at necropsy, flash frozen in liquid nitrogen and stored at –80°C. Each sarcoma-derived DNA was matched with DNA from the normal lung of the same animal. Likewise, DNA from bladder tumors was matched with DNA from normal liver tissue and DNA from thymic lymphomas was matched with DNA from either normal kidney or ear tissue, as previously reported (14). Genomic DNA samples isolated from non-tumor tissues of 129SvJ and C57BL/6J mice were used as controls. Dr Norman R.Drinkwater (University of Wisconsin McArdle Laboratory for Cancer Research) generously provided the control DNA samples.

Primers
To selectively amplify the wild-type p53 allele, upstream priming was targeted to sequence located in the region of exon 5 deleted from the null allele. The upstream and downstream primer sequences were TGCCCTGTGCAGTTGTGGGTCA and ATTTCCTTCCACCCGGATAAGATG, respectively. Primers used to amplify a 386 bp fragment of the neo sequence were ATTGAACAAGATGGATTGCAC and GGTAGCCGGATCAAGCGTATG. The sets of primers used to amplify simple sequence length polymorphisms (SSLPs) were purchased from Research Genetics (Huntsville, AL).

Conditions
The final volume of each SSLP PCR reaction that used sarcoma- or bladder tumor-derived template DNA was 5 µl. The 5 µl reactions contained 6 ng template DNA, 0.15 U Taq polymerase, 0.132 µM each primer, 10 mM Tris–HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 and 0.001% gelatin. SSLP amplicons were radiolabeled with [{alpha}-32P]dATP (6000 Ci/mmol, 0.13–0.25 µCi/5 µl reaction volume) in 5 µM non-radioactive dATP. The concentration of each of the other deoxynucleoside triphosphates was 200 µM (15). PCR amplification conditions for the analyses of DNA from the phenolphthalein-treated mice were essentially the same but scaled for a final volume of 20 µl (J.E.Hulla, J.E.French and J.K.Dunnick, in preparation). Reactions were thermal cycled: one cycle at 96°C for 3 min, 38 cycles at 92°C for 30 s, 55°C for 30 s, 72°C for 30 s, and one cycle at 72°C for 3 min. All amplifications included a negative control where sterile water was added in place of template DNA. Radiolabeled SSLP amplicons were separated under denaturing conditions on 12x16 inch, 6% polyacrylamide gels and recorded on film by autoradiography. All PCR reactions for the determination of SSLP allelotypes were run in duplicate.

The p53 amplicons were generated under slightly different conditions. An aliquot of 24 ng genomic DNA was used for each 20 µl reaction. Reactions were thermal cycled: one cycle at 96°C for 3 min, 42 cycles at 96°C for 30 s, 55°C for 30 s, 72°C for 45 s, and one cycle at 72°C for 3 min. The amplicons were electrophoretically separated on 2.0% agarose containing ethidium bromide. PCR reactions for the determination of allelotype at the p53 locus were run in duplicate for the lymphomas and sarcomas and in triplicate for the bladder tumors.

Determination of percent Trp53 loss, Trp53/pseudogene ratio and loss of heterozygosity (LOH)
Since background heterozygosity may be indicative of tissue-specific mechanisms, quantitative data for Trp53 loss are reported for the lymphomas, sarcomas and bladder tumors (Figure 2Go). Two parameters were determined. The percent loss was calculated from the Trp53 and pseudogene amplicon fluorescence measured from agarose gels containing ethidium bromide (Figure 2Go). Measurements were made with NucleoVision software (NucleoTech Corp., Hayward, CA). Percent Trp53 loss was calculated for each tumor as [1 – {Trp53/(Trp53 + pseudogene)}Tumor/{Trp53/(Trp53 + pseudogene)}Non-tumor]x100. The Trp53/pseudogene ratio was calculated by dividing the fluorescence associated with the top band by the fluorescence associated with the bottom band in each lane. The parameters for the lymphomas and sarcomas were single calculations from the gels shown. The averages reported for the bladder carcinomas were calculated from either duplicate or triplicate amplifications.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2. The exon 5–exon 6 region of Trp53 was amplified from each of the lymphomas, sarcomas and bladder tumors using primers specific for the wild-type p53 allele. Amplicons were separated electrophoretically on 2.0% agarose gels containing ethidium bromide. (A) The non-tumor tissues (N) generated 260 bp amplicons from wild-type Trp53 and 180 bp co-amplicons from the pseudogene. The Trp53/pseudogene ratios and percent Trp53 loss show that the phenolphthalein-induced thymic lymphomas (T) generated much smaller yields of the Trp53 fragment compared with non-tumor tissue from the same animal. (B) Yields of the Trp53 fragment from the benzene-induced sarcomas (T) were clearly less than yields from non-tumor tissues (N) from the same animal. The relative loss of Trp53 was greater in lymphomas than in sarcomas. (C) Loss of Trp53 was clearly evident in the p-cresidine-induced bladder tumors (T) from animals 500, 502, 522 and 523 only. Data generated from a wild-type p53(+/+) animal are provided for comparison.

 
High levels of background heterozygosity blurred the distinction of LOH at some bladder carcinoma loci. At loci where LOH was difficult to distinguish, we performed densitometry on the autoradiographs. We compared tumors with non-tumor tissues for loss of one allele relative to the remaining allele. The data are not reported but were used to establish the bladder carcinoma allelotypes.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
p53 null and Trp53 alleles
DNA isolated from the lymphomas, sarcomas, bladder carcinomas and non-tumor tissues all generated the expected 386 bp neo fragment from the p53 null allele (data not shown).

Figure 2Go shows representative results from PCR amplifications that targeted Trp53 and the p53 processed pseudogene. All the DNA samples isolated from non-tumor tissues yielded a 260 bp amplicon from the single wild-type Trp53 allele and a 180 bp amplicon from the p53 pseudogene alleles (Figure 2A–CGo). DNA isolated from phenolphthalein-induced thymic lymphomas (Figure 2AGo) yielded the pseudogene amplicon but only traces of the Trp53 amplicon. The low specific content of Trp53 template in the lymphomas suggested that wild-type Trp53 was lost during the early stages of lymphomagenesis (J.E.Hulla, J.E.French and J.K.Dunnick, in preparation).

Each of the sarcomas yielded a Trp53/pseudogene ratio that was much reduced from the ratio generated from the non-tumor tissue of the same animal (Figure 2BGo). Thus, the specific content of wild-type Trp53 present in the sarcomas was less than the specific content of wild-type Trp53 present in the non-tumor tissues. Trp53 was lost in all the sarcomas and lymphomas examined. The percent of Trp53 loss was greater in lymphomas than in sarcomas.

DNA isolated from p-cresidine-induced bladder carcinomas yielded both the Trp53 and pseudogene amplicons. However, loss of Trp53 was clearly distinguishable in bladder tumors from animals 500, 502 and 522 (Figure 2CGo). The average Trp53/pseudogene ratios generated from the lymphomas, sarcomas and bladder tumors were 0.02 ± 0.02 (n = 10), 0.09 ± 0.03 (n = 8) and 0.30 ± 0.15 (n = 8), respectively. The average ratios generated from the matched non-tumor tissues were 0.27 ± 0.10, 0.32 ± 0.06 and 0.41 ± 0.21, respectively. The average percent Trp53 losses for the lymphomas, sarcomas and bladder tumors were 85 ± 10, 64 ± 14 and 28 ± 29%, respectively. The differences in Trp53 specific content may reflect tissue-specific mechanisms or merely the relative difficulty in resecting the tumors from surrounding normal tissues.

LOH at SSLPs
A manuscript reporting the SSLP allelotypes from thymic lymphomas induced in p53(+/–) mice by phenolphthalein is in preparation (J.E.Hulla, J.E.French and J.K.Dunnick, in preparation). Data generated from two of the phenolphthalein-treated mice, animals 928 and 931, are presented in Figure 3Go for comparison with data from the benzene and p-cresidine studies. The non-tumor DNA isolated from phenolphthalein-treated mice harbored loci heterozygous for the C57BL/6 and 129Sv alleles (mouse 928 at D11MIT149, D11MIT60, D11MIT194 and D11MIT48; mouse 931 at D11MIT149, D11MIT313, D11MIT60 and D11MIT194), loci homozygous for the 129Sv allele (mouse 931 at D11MIT48) and loci homozygous for the C57BL/6 allele (mouse 928 at D11MIT313). Each of the 10 lymphomas examined showed loss of one allele at each of the 28 informative loci examined (see Figure 3Go) (mouse 928 at D11MIT149, D11MIT60, D11MIT194 and D11MIT48; mouse 931 at D11MIT149, D11MIT313, D11MIT60 and D11MIT194). The SSLP LOH data were consistent with loss at the Trp53 locus. The data revealed that one complete copy of chromosome 11 was lost during lymphomagenesis. Duplication of chromosomes can occur during chemical-induced tumorigenesis. We did not attempt to determine the number of copies of chromosome 11 that remained in the tumors. However, duplication of the null p53 -harboring chromosome, if it occurred, is not inconsistent with the interpretation that the wild-type p53 allele-harboring chromosome was lost during tumorigenesis.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 3. The autoradiographs show 32P-labeled SSLP amplicons separated on 6% denaturing polyacrylamide gels. The assays used primers specific for D11MIT149, D11MIT313, D11MIT60, D11MIT194 and D11MIT48. The first column shows the controls. The control assays used non-tumor tissue DNA isolated from C57BL/6J (B6) and 129SvJ (129) mice as template. The second column shows data from phenolphthalein-induced lymphomas generated in animals 928 and 931. The third and fourth columns show data generated from benzene-induced sarcomas isolated from animals 581, 584 and 591 and p-cresidine-induced bladder carcinomas from animals 502, 505, 519 and 522. The chromosome location of each SSLP locus is indicated by the graphic on the right. The scale is in cM. Each tumor (T) was matched with non-tumor tissue (N) from the same animal. As exemplified by animals 928 and 931, LOH in the lymphomas was nearly complete at each of the 27 SSLP loci examined (J.E.Hulla, J.E.French and J.K.Dunnick, in preparation). Although it occurred on a background of heterozygosity, LOH was clearly evident in each sarcoma (animals 581, 584 and 591). LOH in the sarcomas was evident as a diminished yield of one allele relative to the other. LOH was sporadic in the p-cresidine-induced bladder carcinomas. Several tumors harbored homozygosity at loci near the ends of chromosome 11. For example, animals 591, 502, 505 and 519 were homozygous for C57BL/6 at D11MIT149. The 129 homozygosity found in non-tumor tissues from animals 928 (D11MIT313), 931 (D11MIT48) and 519 (D11MIT313) was inconsistent with the breeding protocol.

 
The 129Sv homozygosity at SSLP loci (see Figure 3Go) (D11MIT313 in mice 928 and 519; D11MIT194 in mouse 519; D11MIT48 in mouse 931) was unexpected. Homozygosity is inconsistent with the reported breeding protocol (Figure 1Go) since chromosomes inherited from maternal animals should harbor only C57BL/6 alleles.

The data from mice 581, 584 and 591 presented in Figure 3Go are representative of results from the eight benzene-treated mice we examined. In each of the benzene-induced sarcomas LOH appeared on a background of heterozygosity and varying degrees of loss were apparent. As in the lymphomas, loss was not C57BL/6 or 129Sv specific in the sarcomas. For example, compared with the non-tumor tissue from mouse 591, the sarcoma specific content of the 129Sv allele at D11MIT48 was diminished. In the same sarcoma the specific content of the C57BL/6 allele at D11MIT313, D11MIT60 and D11MIT194 was diminished. Loss was apparent at each of the 23 informative SSLP loci examined in the benzene-induced sarcomas (Table IIGo). The SSLP data were consistent with selective loss of the wild-type allele at the Trp53 locus. The data showed that the Trp53-bearing copy of chromosome 11 was lost during sarcomagenesis.


View this table:
[in this window]
[in a new window]
 
Table II. Allelotypes of sarcomas and matched non-tumor tissues from eight benzene-treated p53(+/–) mice
 
In contrast to the sarcomas and lymphomas, we could not distinguish LOH in the bladder tumors at all of the informative loci. For example, in mouse 522 a diminished signal for the C57BL/6 allele was clearly evident in the tumor at D11MIT313 and D11MIT60 but loss could not be distinguished at D11MIT149 (Figure 3Go). In mouse 519 C57BL/6 was lost at D11MIT48 but loss at D11MIT60 was not distinguishable and in mouse 502 C57BL/6 was lost at D11MIT194 and D11MIT60 but loss was not distinguishable at D11MIT313.

The allelotypes for each of the sarcomas and matched non-tumor tissues are summarized in Table IIGo. Of the 368 alleles identified in non-tumor tissues 143 (39%) were 129Sv. This was higher than the expectation of <3% for a N5 generation. The overly high frequency was, in part, attributed to 129Sv linkage with the p53 selection marker (16). However, five of the eight benzene-treated mice harbored 129Sv homozygosity at one or more loci. Since the study animals were characterized as the offspring of inbred C57BL/6 females, the high frequency of 129Sv alleles and presence of 129Sv homozygosity were unexpected.

A Trp53 flanking region of C57BL/6 genetic character was lost from each sarcoma. The allelotypes at D11MIT260, D11MIT4, D11MIT368, D11MIT60, D11MIT219 and D11MIT194 showed that loss of a 10 cM region of C57BL/6 character was common among the sarcomas (Table IIGo). Similarly, a region of C57BL/6 genetic character was lost from each of 10 lymphomas examined (J.E.Hulla, J.E.French and J.K.Dunnick, in preparation).

The allelotypes for the bladder carcinomas and matched non-tumor tissues are compiled in Table IIIGo. LOH was distinguishable only sporadically in the bladder tumors. Whether LOH in the bladder tumors from mice 505, 508 and 523 was a result of the loss of one complete chromosome or the loss of chromosome fragments was equivocal. LOH was distinguished at only two of 13, three of 18 and three of 11 informative loci, respectively (Figure 2Go and Table IIIGo). However, loss of a complete chromosome was likely in the bladder tumors from animals 502, 519 and 522. LOH was distinguishable in these tumors at 13 of 14, seven of 11 and nine of 10 informative loci, respectively (Figure 2Go and Table IIIGo). In mouse 500 LOH was distinguishable at Trp53 but there were only three other informative loci identified in this animal. LOH was not distinguishable at any of the 11 informative SSLP loci in mouse 516. Loss of Trp53 was 10 ± 7% in this mouse. These data suggest that loss of chromosome 11 did not occur in the bladder tumor from mouse 516.


View this table:
[in this window]
[in a new window]
 
Table III. Allelotypes of bladder tumors and matched non-tumor tissues from eight p-cresidine-treated p53(+/–) mice
 
The frequency of 129Sv polymorphism in the p-cresidine study animals was higher than expected. Forty-five percent (159 of 356) of the non-tumor tissue alleles were 129Sv. Of the eight p-cresidine-treated mice examined, only 505 did not harbor 129Sv homozygosity.

Although the patterns of C57BL/6 and 129Sv alleles were inconsistent with the breeding protocol, there was no evidence to suggest that the wild-type Trp53 in the study animals was not of maternal origin, as outline in Figure 1Go. Thus, we defined the spatial distribution of 129Sv and C57BL/6 alleles along chromosomes 11 for each sarcoma and matched non-tumor tissue. The allelotypes strongly suggest the loss of one complete copy of chromosome 11 from each of the eight sarcomas. We assumed a selection for cells lacking Trp53 occurred during sarcomagenesis. Since the wild-type p53 alleles were harbored on the maternal chromosomes, the maternal copies of chromosome 11 were lost. We deduced the allelotypes along each maternal chromosome 11 from allelotypes of the non-tumor tissues, which harbored maternal and paternal alleles, and tumors, which harbored only paternal alleles. The resultant arrangements of alleles are shown schematically in Figure 4Go.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4. The allelotypes of the maternal and paternal chromosomes from eight of the benzene study animals were deduced and mapped. Black indicates C57BL/6 alleles and gray indicates 129Sv alleles. The scale at the left indicates distance, in cM, from the centromere. We assumed a selection for cells lacking wild-type Trp53 occurred during sarcomagenesis. Since wild-type Trp53 was harbored on the maternal chromosomes, the maternal chromosomes were lost and the paternal chromosomes were retained in the tumors. Gaps are shown where the 129Sv allele was indistinguishable from the C57BL/6 allele at the loci examined. Although the study animals were reported to be from C57BL/6 maternal animals, only the maternal chromosome from animals 565 and 592 harbored only C57BL/6 alleles. Wt indicates the wild-type p53 locus on the maternal chromosome.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Significant heterozygosity was retained in the sarcomas and bladder carcinomas but not in the lymphomas. The heterozygosity underlying the observed LOH may reflect the individual mechanisms of benzene and p-cresidine and/or the pathophysiology of the specific tissues. The unexpected 129Sv homozygosity and mixed distribution of alleles found in the sarcomas (Figure 4Go) might be explained by illegitimate homologous recombination. Genetic recombination occurs normally in germinal tissue (chiasmata of sister chromatids in meiosis) and in the bone marrow (immunoglobulin and T cell receptor gene rearrangements at homologous sites on homologous chromosomes) (17). Aberrant recombination may occur at non-homologous sites within or between chromosomes due to stressor-induced single- or double-stranded breaks and repair (18). Consequently, non-homologous chromosome translocations may result in fusion products between high level constitutive promoters (e.g. immunoglobulin genes) and proto-oncogenes (c-Abl, c-myc, Bcl-2, etc.) or LOH that may result from misrepaired strand breaks. Ultimately, genomic instability enables preneoplastic cells to undergo transformation and progression to malignancy.

Recent evidence indicates that the Atm (a protein kinase), Chk2 (a protein kinase) and Trp53 (a transcription factor) genes are critical in maintaining genomic stability (19,20). In response to ionizing radiation Atm kinase (homologous to yeast Rad3/mec1 checkpoint kinase) phosphorylates p53 at Ser15 and Chk2 (a homolog of yeast Rad53/Cds1) phosphorylates p53 at Ser20, resulting in p53 stabilization, which is critical to transactivation, DNA binding and transcription. In the recognition and response to DNA damage p53 is critical to prolonged cell cycle arrest (DNA repair) or transient arrest during mitosis in maintaining the integrity of the mitotic spindle. There are at least 11 well-described phosphorylation sites on p53 required for oligerimization and tetramerization and p53 function. Evidence suggests that p53 half-life and different p53 functions are determined by the state of phosphorylation of the multiple sites.

p53 is critical in maintaining both normal somatic mitotic recombination [e.g. V(D)J in T cell receptors and immunoglobulin genes] (2124). Cumulative evidence also indicates the importance of p53 in maintaining normal rates of mitotic homologous recombination (2530). In summary, many lines of evidence indicate that p53 plays an important role in maintaining fidelity in homologous recombination and preventing non-homologous recombination.

We considered point mutations within wild-type Trp53 as an alternative mechanism active in the bladder tumors. A recent survey of bladder tumors that retained the wild-type p53 allele revealed no consistent mutations when wild-type Trp53 exons 5–8 were examined by SSCP [J.E.French, G.D.Lacks, C.Trempus, J.K.Dunnick, J.Foley, J.Mahler, R.R.Tice and R.W.Tennant (2000) Carcinogenesis, submitted for publication]. We also considered the possibility that inadvertent inclusion of non-tumor tissue from vascular epithelium or the margins of the resected tumors contributed non-tumor DNA template, increased background heterozygosity and reduced the signal-to-noise ratio, masking LOH at some loci. However, since LOH was detected at seven or more widely distributed SSLP loci in three of the eight bladder tumors examined, we believe there is good evidence that chromosome 11 was lost in these tumors. The absence of background heterozygosity in the lymphomas suggested that loss of Trp53 occurred prior to clonal expansion and/or efficient culling of DNA-damaged cells by the p53-dependent apoptotic pathway that is characteristic of the thymus.

We believe that loss of the wild-type Trp53 allele was the most significant molecular event in phenolphthalein-, benzene- and p-cresidine-induced tumorigenesis. However, in all of the lymphomas and sarcomas and in at least two bladder carcinomas examined loss of Trp53 was accompanied by loss of a flanking region of C57BL/6 character. Thus, C57BL/6-specific resistance and 129Sv-specific susceptibility cannot be dismissed from consideration. Likewise, since loss of one copy of a chromosome occurred in all of the lymphomas and sarcomas and at least three of the bladder tumors examined, a role for monoallelic expression cannot be specifically ruled out (J.E.Hulla, J.E.French and J.K.Dunnick, in preparation).

The heterozygous TSG-p53 mice used in the phenolphthalein, benzene and p-cresidine studies harbored a wild-type Trp53, a null Trp53 and a processed p53 pseudogene (10,31). The null allele is characterized by a deletion that encompasses part of intron 4 and exon 5 and harbors a selection construct containing neo. The original Trp53 null construct was introduced into 129Sv embryonic stem cells and the new p53-deficient mouse strain was introduced on a mixed 75% C57BL/6, 25% 129Sv genetic background (10).

Allelotype data for mice used in all three studies were inconsistent with the supplier's breeding protocol. The mice were reported to be the offspring of the fifth backcross (N5) of p53(–/–) males (N4)xinbred C57BL/6 females. In this regard, the maternally inherited chromosomes of the p53(+/–) study animals should harbor only C57BL/6 alleles. However, 129Sv homozygosity was found in nine of 10 phenolphthalein study mice, five of eight benzene study mice and seven of eight p-cresidine study mice. Furthermore, the frequency of 129Sv polymorphism in the N5 generation should be 3% in the absence of linkage to a selection marker. Since 129Sv alleles were linked to the null p53 selection marker in the study mice, a somewhat higher frequency was expected. However, the overall frequencies of 129Sv in the non-tumor tissues were 50, 39 and 45% in the phenolphthalein, benzene and p-cresidine studies, respectively. Thus, the frequency of occurrence of 129Sv polymorphism and the 129Sv:129Sv allelotypes were inconsistent with the breeding protocol.

Did recombination occur? Homologous recombination in diploid tissue is restricted to specific lineages of lymphocytes undergoing either T cell receptor or immunoglobulin rearrangements during development (25,3234). However, if the breeding protocol was carried out as maintained, the only other possible explanation for the high frequency of 129Sv polymorphism, and the presence of 129Sv homozygosity, is homologous recombination during embryogenesis under p53 haploinsufficient conditions. Such recombination might result in the patterns of C57BL/6 and 129Sv alleles observed in the non-tumor tissues. Further investigation of this possible phenomenon is underway.

Although unexpected, the high frequency of occurrence of 129Sv:C57BL/6 heterozygosity led us to discover that loss of Trp53 and p53 function resulted from non-dysjunction and loss of one complete copy of chromosome 11, rather than intragenic or intrachromosomal deletion. The universality of chromosome 11 loss was striking. Loss was detected in each of 10 lymphomas and eight sarcomas examined. Although equivocal due to high levels of background heterozygosity, patterns of LOH suggested that loss of a copy of chromosome 11 also occurred in at least three of the eight p-cresidine-induced bladder carcinomas.

Loss of chromosome 11 was not tissue specific. Both mesothelium (lymphomas and sarcomas) and endothelium (bladder tumors) exhibited the phenomenon. Furthermore, the subcutaneous sarcomas induced in p53(+/–) mice by benzene were not observed in benzene-treated B6C3F1 mice (12). The absence of sarcomas in benzene-treated B6C3F1 mice leads us to speculate that a p53 haploinsufficiency-related mechanism underlies loss of chromosome 11. In this regard, it is interesting that in spontaneous hepato cellular carcinoma (HCC) and HCC induced by chlordane, methylene chloride, tetrachloroethylene and vinyl carbamate in B6C3F1 mice loss of a whole chromosome was detected in only four of 142 HCC examined. Loss of chromosome 11 was not detected in any of the HCCs (35).

p53 haplo insufficiency-related rearrangement mechanisms might explain the inconsistency between breeding protocol and the allelotype data. Alternatively, a mix-up in the breeding or shipping may have occurred. It is important to determine when mix-ups have occurred because genetic background matters. p53(+/–) mice on MV (36) and 129Sv backgrounds (37,38) were compared to p53-deficient mice on a mixed C57BL/6x129Sv background. Thymic lymphomas arose faster in the MV and 129Sv strains and tumor profiles varied.

Any strain-specific effects related to p53 haplo insufficiency need to be carefully assessed for positive or negative impacts on the C57BL/6-p53(+/–) mouse as a model for human carcinogenesis. If, for example, the carcinogenicity of a test agent was found to be related to p53 haplo insufficiency-mediated segregation dysfunction, then the bioassay may have only succeeded in reaffirming p53 deficiency as a risk factor. Our data suggest that loss of a complete copy of chromosome 11 occurred in three different chemically induced tumor types. This heightens our interest in determining if p53 haplo insufficient-specific mechanisms are involved.

Evaluation of the p53(+/–) mouse must determine how much of a dominant human pathway needs be replicated before a short-term mouse model is valid and useful. The integration of tumor allelotype data with stochastic modeling of tumorigenesis in humans and p53(+/–) mice will greatly facilitate this determination (39).


    Notes
 
2 To whom correspondence should be addressed at: National Institute of Environmental Health Sciences, National Institutes of Health, 111 T.W. Alexander Drive, Box 12233, F1-05, Research Triangle Park, NC, 27709, USA Email: hulla{at}niehs.nih.gov Back


    Acknowledgments
 
We wish to acknowledge excellent technical support from Isaac Grindeland, Jamie Hanrahan, Sherry Levandowski, Lori Pellet, Tanya Schill and Tim Wilkie. Expert review and advice from Drs Norman Drinkwater (University of Wisconsin) and Roger Wiseman (The National Institute of Environmental Health Sciences) were invaluable. This project was funded through NIH grant 5-P20RR11817-03 and the NIEHS Division of Intramural Research (ES21207-05).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Ashby,J. and Tennant,R.W. (1988) Chemical structure, Salmonella mutagenicity and extent of carcinogenicity as indicators of genotoxic carcinogenesis among 222 chemicals tested in rodents by the U.S. NCI/NTP. Mutat. Res., 204, 17–115.[Web of Science][Medline]
  2. Sasaki,Y.F., Nishidate,E., Su,Y.Q., Matsusaka,N., Tsuda,S., Susa,N., Furukawa,Y. and Ueno,S. (1998) Organ-specific genotoxicity of the potent rodent bladder carcinogens o-anisidine and p-cresidine. Mutat. Res., 412, 155–160.[Web of Science][Medline]
  3. Longnecker,M.P., Sandler,D.P., Haile,R.W. and Sandler,R.S. (1997) Phenolphthalein-containing laxative use in relation to adenomatous colorectal polyps in three studies. Environ. Health Perspect., 105, 1210–1212.[Web of Science][Medline]
  4. Tice,R.R., Furedi-Machacek,M., Satterfield,D., Udumudi,A., Vasquez,M. and Dunnick,J.K. (1998) Measurement of micronucleated erythrocytes and DNA damage during chronic ingestion of phenolphthalein in transgenic female mice heterozygous for the p53 gene. Environ. Mol. Mutagen., 31, 113–124.[Web of Science][Medline]
  5. Witt,K.L., Gulati,D.K., Kaur,P. and Shelby,M.D. (1995) Phenolphthalein: induction of micronucleated erythrocytes in mice. Mutat. Res., 341, 151–160.[Web of Science][Medline]
  6. National Toxicology Program (1986) Toxicology and Carcinogenesis Studies of Benzene (CAS No. 71-43-2) in F344/N Rats and B6C3F1 Mice (Gavage Studies). National Toxicology Program.
  7. National Toxicology Program (1979) Bioassay of p-Cresidine for Possible Carcinogenicity (CAS No. 120-71-8). National Toxicology Program.
  8. National Toxicology Program (1996) Toxicology and Carcinogenesis Studies of Phenolphthalein (CAS No. 77-09-8) in F344/N Rats and B6C3F1 Mice (Feed Studies). National Toxicology Program.
  9. US Food and Drug Administration (1997) U.S. Food and Drug Administration laxative drug products for over-the-counter human use; proposed amendment to the tentative final rule [Docket No. 78N-036L]. Fed. Regist., 62, 46223–46227.
  10. Donehower,L.A., Harvey,M., Slagle,B.L., McArthur,M.J., Montgomery,C.A., Butel,J.S. and Bradley,A. (1992) Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature, 356, 215–221.[Medline]
  11. Huff,J.E., Haseman,J.K., DeMarini,D.M., Eustis,S., Maronpot,R.R., Peters,A.C., Persing,R.L., Chrisp,C.E. and Jacobs,A.C. (1989) Multiple-site carcinogenicity of benzene in Fischer 344 rats and B6C3F1 mice. Environ. Health Perspect., 82, 125–163.[Web of Science][Medline]
  12. Tennant,R.W., Spalding,J. and French,J.E. (1996) Evaluation of transgenic mouse bioassays for identifying carcinogens and noncarcinogens. Mutat. Res., 365, 119–127.[Web of Science][Medline]
  13. Dunnick,J.K. and Hailey,J.R. (1996) Phenolphthalein exposure causes multiple carcinogenic effects in experimental model systems. Cancer Res., 56, 4922–4926.[Abstract/Free Full Text]
  14. Dunnick,J.K., Hardisty,J.F., Herbert,R.A., Seely,J.C., Furedi-Machacek,E.M., Foley,J.F., Lacks,G.D., Stasiewicz,S. and French,J.E. (1997) Phenolphthalein induces thymic lymphomas accompanied by loss of the p53 wild type allele in heterozygous p53-deficient (+/–) mice. Toxicol. Pathol., 25, 533–540.[Abstract/Free Full Text]
  15. Weber,J.L. (1989) Length polymorphisms in (dC-dA)n-(dG-dT)n sequences detected using the polymerase chain reaction. In Erlich,H.A., Gibbs,R. and Kazazian,H.H.,Jr (eds), Current Communications in Molecular Biology—Polymerase Chain Reaction. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 141–146.
  16. Silver,L. (1995) Mouse Genetics. Oxford University Press, New York, NY.
  17. Leach,D. (1996) Genetic Recombination. Blackwell Science, Oxford, UK.
  18. Lodish,H., Berk,A., Zipursky,S., Matsudaira,P., Baltimore,D. and Darnell,J. (1999) Molecular Cell Biology, 4th Edn. W.H. Freeman and Co., San Francisco, CA.
  19. Carr,A.M. (2000) Cell cycle. Piecing together the p53 puzzle [comment]. Science, 287, 1765–1766.[Free Full Text]
  20. Hirao,A., Kong,Y.Y., Matsuoka,S., Wakeham,A., Ruland,J., Yoshida,H., Liu,D., Elledge,S.J. and Mak,T.W. (2000) DNA damage-induced activation of p53 by the checkpoint kinase Chk2 [see comments]. Science, 287, 1824–1827.[Abstract/Free Full Text]
  21. Guidos,C.J., Williams,C.J., Grandal,I., Knowles,G., Huang,M.T. and Danska,J.S. (1996) V(D)J recombination activates a p53-dependent DNA damage checkpoint in scid lymphocyte precursors. Genes Dev., 10, 2038–2054.[Abstract/Free Full Text]
  22. Lehar,S.M., Naeht,M., Jacks,T., Vater,C.A., Chittenden,T. and Guild,B.C. (1996) Identification and cloning of EI24, a gene induced by p53 in etoposide-treated cells. Oncogene, 12, 1181–1187.[Web of Science][Medline]
  23. Lista,F., Bertness,V., Guidos,C.J., Danska,J.S. and Kirsch,I.R. (1997) The absolute number of trans-rearrangements between the TCRG and TCRB loci is predictive of lymphoma risk: a severe combined immune deficiency (SCID) murine model. Cancer Res., 57, 4408–4413.[Abstract/Free Full Text]
  24. Nacht,M., Strasser,A., Chan,Y.R., Harris,A.W., Schlissel,M., Bronson,R.T. and Jacks,T. (1996) Mutations in the p53 and SCID genes cooperate in tumorigenesis. Genes Dev., 10, 2055–2066.[Abstract/Free Full Text]
  25. Ramel,C., Cederberg,H., Magnusson,J., Vogel,E., Natarajan,A.T., Mullender,L.H., Nivard,J.M., Parry,J.M., Leyson,A., Comendador,M.A., Sierra,L.M., Ferreiro,J.A. and Consuegra,S. (1996) Somatic recombination, gene amplification and cancer. Mutat. Res., 353, 85–107.[Web of Science][Medline]
  26. Mekeel,K.L., Tang,W., Kachnic,L.A., Luo,C.M., DeFrank,J.S. and Powell,S.N. (1997) Inactivation of p53 results in high rates of homologous recombination. Oncogene, 14, 1847–1857.[Web of Science][Medline]
  27. Tang,W., Willers,H. and Powell,S.N. (1999) p53 directly enhances rejoining of DNA double-strand breaks with cohesive ends in gamma-irradiated mouse fibroblasts. Cancer Res., 59, 2562–5.[Abstract/Free Full Text]
  28. Willers,H., McCarthy,E.E., Wu,B., Wunsch,H., Tang,W., Taghian,D.G., Xia,F. and Powell,S.N. (2000) Dissociation of p53-mediated suppression of homologous recombination from G1/S cell cycle checkpoint control. Oncogene, 19, 632–639.[Web of Science][Medline]
  29. Aubrecht,J., Secretan,M.B., Bishop,A.J. and Schiestl,R.H. (1999) Involvement of p53 in X-ray induced intrachromosomal recombination in mice. Carcinogenesis, 20, 2229–2236.[Abstract/Free Full Text]
  30. Galli,A. and Schiestl,R.H. (1998) Effects of DNA double-strand and single-strand breaks on intrachromosomal recombination events in cell-cycle-arrested yeast cells. Genetics, 149, 1235–1250.[Abstract/Free Full Text]
  31. Zakut-Houri,R., Oren,M., Bienz,B., Lavie,V., Hazum,S. and Givol,D. (1983) A single gene and a pseudogene for the cellular tumour antigen p53. Nature, 306, 594–597.[Medline]
  32. Gupta,P.K., Sahota,A., Boyadjiev,S.A., Bye,S., Shao,C., O'Neill,J.P., Hunter,T.C., Albertini,R.J., Stambrook,P.J. and Tischfield,J.A. (1997) High frequency in vivo loss of heterozygosity is primarily a consequence of mitotic recombination. Cancer Res., 57, 1188–1193.[Abstract/Free Full Text]
  33. James,C.D., Carlbom,E., Nordenskjold,M., Collins,V.P. and Cavenee,W.K. (1989) Mitotic recombination of chromosome 17 in astrocytomas. Proc. Natl Acad. Sci. USA, 86, 2858–2862.[Abstract/Free Full Text]
  34. Weinberg,R.A. (1991) Tumor suppressor genes. Science, 254, 1138–1146.[Abstract/Free Full Text]
  35. Davis,L.M., Caspary,W.J., Sakallah,S.A., Maronpot,R., Wiseman,R., Barrett,J.C., Elliott,R. and Hozier,J.C. (1994) Loss of heterozygosity in spontaneous and chemically induced tumors of the B6C3F1 mouse. Carcinogenesis, 15, 1637–1645.[Abstract/Free Full Text]
  36. Van Meyel,D.J., Sanchez-Sweatman,O.H., Kerkvliet,N., Stitt,L., Ramsay,D.A., Khokha,R., Chambers,A.F. and Cairncross,J.G. (1998) Genetic background influences timing, morphology and dissemination of lymphomas in p53-deficient mice. Int. J. Oncol., 13, 917–922.[Web of Science][Medline]
  37. Harvey,M., McArthur,M.J., Montgomery,C.A.,Jr, Bradley,A. and Donehower,L.A. (1993) Genetic background alters the spectrum of tumors that develop in p53-deficient mice. FASEB J., 7, 938–943.[Abstract]
  38. Donehower,L.A., Harvey,M., Vogel,H., McArthur,M.J., Montgomery,C.A.,Jr, Park,S.H., Thompson,T., Ford,R.J. and Bradley,A. (1995) Effects of genetic background on tumorigenesis in p53-deficient mice. Mol. Carcinog., 14, 16–22.[Web of Science][Medline]
  39. Mao,J.H., Lindsay,K.A., Balmain,A. and Wheldon,T.E. (1998) Stochastic modelling of tumorigenesis in p53 deficient mice. Br. J. Cancer, 77, 243–252.[Web of Science][Medline]
  40. The Jackson Laboratory (1999) Mouse Genome Informatics Resource. The Jackson Laboratory, Bar Harbor, ME (http://www.informatics.jax.org/).
Received March 8, 2000; revised September 13, 2000; accepted September 25, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Toxicol PatholHome page
J. M. Cullen, D. L. Brown, G. E. Kissling, J. F. Foley, J. Rizzo, P. L. Marion, V. I. Parron, and J. E. French
Aflatoxin B1 and/or Hepatitis B Virus Induced Tumor Spectrum in a Genetically Engineered Hepatitis B Virus Expression and Trp53 Haploinsufficient Mouse Model System for Hepatocarcinogenesis
Toxicol Pathol, April 1, 2009; 37(3): 333 - 342.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Yoon and R. C. Smart
C/EBP{alpha} Is a DNA Damage-Inducible p53-Regulated Mediator of the G1 Checkpoint in Keratinocytes
Mol. Cell. Biol., December 15, 2004; 24(24): 10650 - 10660.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. E. Hulla, J. E. French, and J. K. Dunnick
Chromosome 11 Loss from Thymic Lymphomas Induced in Heterozygous Trp53 Mice by Phenolphthalein
Toxicol. Sci., April 1, 2001; 60(2): 264 - 270.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hulla, J. E.
Right arrow Articles by Dunnick, J. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hulla, J. E.
Right arrow Articles by Dunnick, J. K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?