Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Basham, V. M.
Right arrow Articles by Dunning, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Basham, V. M.
Right arrow Articles by Dunning, A. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 22, No. 11, 1797-1800, November 2001
© 2001 Oxford University Press


MOLECULAR EPIDEMIOLOGY AND CANCER PREVENTION

Polymorphisms in CYP1A1 and smoking: no association with breast cancer risk

Victoria M. Basham1, Paul D.P. Pharoah1,4, Catherine.S. Healey1, Robert N. Luben2, Nicholas E. Day2, Douglas F. Easton3, Bruce A.J. Ponder1 and Alison M. Dunning1

1 CRC Human Cancer Genetics Group, Department of Oncology,
2 EPIC and
3 CRC Genetic Epidemiology Group, University of Cambridge, Strangeways Research Laboratory, Worts Causeway, Cambridge CB1 8RN, UK


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Several studies have investigated polymorphisms in CYP1A1 and breast cancer risk with inconsistent results. We have carried out a population based case–control study of the Thr461Asn and Ile462Val polymorphisms in CYP1A1 to clarify their importance in determining breast cancer susceptibility. A total of 1873 cases and 712 controls were genotyped for Thr461Asn and 1948 cases and 1355 controls were genotyped for Ile462Val. We have also investigated a putative interaction between smoking and CYP1A1 genotype and breast cancer risk using a case only study design. The genotype distribution of Thr461Asp in controls was close to that expected under Hardy–Weinberg equilibrium (HWE). We detected no significant differences in genotype frequencies between breast cancer cases and controls (P = 0.68). Compared with the Thr/Thr homozygotes there was no significant risk for either the Thr/Asp heterozygote [OR = 1.1 (95% CI 0.8–1.4)] or the Asp/Asp homozygote [OR = 0.4 (0.02–6.1)]. The genotype distribution of Ile462Val in controls was also close to that expected under HWE with no significant differences between breast cancer cases and the controls (P = 0.44). No significant risk was found for either the Ile/Val heterozygote [OR = 0.8 (0.6–1.1)] or the Val/Val homozygote [OR = 2.7 (0.3–24)] compared with the Ile/Ile homozygotes. Furthermore, subgroup analyses revealed no effect of age or menopausal status on genotypic risks, and we found no evidence for an interaction between genotype and smoking habit or alcohol consumption and susceptibility to breast cancer. We combined our data for the Ile462Val polymorphism with those from four other published studies, but even with >5000 subjects, none of the genotype-associated risks achieved statistical significance, and there was no consistent pattern to the risks associated with increasing Val allele dosage [Ile/Val OR = 0.9 (0.7–1.1), Val/Val OR = 2.3 (0.4–12), and Val carrier OR = 1.0 (0.9–1.1)].

Abbreviations: B[a]P: benzo[a]pyrene; CEs: catecholestrogens; HWE:Hardy—Weinberg equilibrium; PAHs: polycyclic aromatic hydrocarbons; TCDD: 2,3,7,8-tetrachlorodibenzo-p-dioxin


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
CYP1A1 is a candidate gene for low penetrance breast cancer susceptibility because it plays an important role in the metabolism of carcinogens such as the polycyclic aromatic hydrocarbons (PAHs), as well as in the oxidative metabolism of oestrogens. PAHs are known human carcinogens and have been found to cause mammary tumours in rodents. They are ubiquitous in the urban environment, present in tobacco smoke, and have a high capacity for DNA adduct formation. Ingested PAHs, primarily in the forms of benzo[a]pyrene (B[a]P) and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), are stored in adipose tissue such as the breast. CYP1A1 is a phase I carcinogen metabolism enzyme, which can add a hydroxyl group to such compounds. Phase II enzymes can subsequently add an oxygen atom to the hydroxyl group turning the carcinogenic compound into a water soluble derivative which can be excreted from the body. The balance of activating enzymes (such as CYP1A1) to detoxifying enzymes governs the proportion of PAHs that become DNA binding carcinogens. Polymorphic variation in CYP1A1 activity could therefore modify breast cancer susceptibility.

Increased lifetime exposure to endogenous and exogenous oestrogens have been implicated as a risk factor for breast cancer. The effects of increased oestrogen exposure have usually been assumed to be mediated through the oestrogen receptor. There is now increasing evidence that by-products of oestrogen metabolism in the body may themselves be genotoxic. Oxidative metabolism initially converts oestrogens to catecholestrogens (CEs) and further biotransformation of CEs forms quinones which can, in turn, form either stable or depurinating DNA adducts, resulting in carcinogenesis (1). CYP1A1 can convert oestradiol to 2-hydroxyestradiol, the initial step in this pathway, and so polymorphic variation in CYP1A1 activity could also modify breast cancer susceptibility through this mechanism.

Three common polymorphisms in CYP1A1 that have been reported in Caucasian populations: a c–t substitution in the 3' non coding region; a c–a substitution in exon 7 which results in an amino acid change (Thr461Asn); and an a–g substitution in exon 7 which also results in an amino acid change (Ile462Val). These polymorphisms may also be designated CYP1A1*2A, CYP1A1*4, and CYP1A1*2B/2C respectively according to one nomenclature (http://www.imm.ki.se/CYPalleles/cyp1a1.htm), but other authors have used a different system of numbering (2). It has been shown that CYP1A1 activity is more easily induced in lymphocytes that carry a Val allele (3), and a recent study has shown that both the Thr461Asp and the Ile462Val polymorphism alter the enzyme kinetics properties to produce both the diol metabolites from B[a]P and diol epoxide 2 from benzo[a]pyrene-7,8-dihydrodiol (4), although an earlier study suggested that Ile462Val does not appear to affect enzymatic activity (5).

There have been four published studies investigating CYP1A1 polymorphic variants and breast cancer susceptibility (6–9). All four studies investigated the role of the Ile462Val polymorphism in breast cancer susceptibility, but none found a statistically significant association (reviewed in Table 4Go). However, the power of these studies to detect moderate risks was limited by study size; the largest study included data on >1000 subjects in total. Three studies have investigated the MspI RFLP in the 3' non-coding region of the gene (7–9). Only one of these reported a significant increase in risk associated, which was limited to African-American women that were homozygous for the rare variant (9). One study has investigated the Thr461Asp polymorphism, and again, no significant association was reported (7).


View this table:
[in this window]
[in a new window]
 
Table IV. Summary of published data on CYP1A1 Ile462Val and breast cancer risk
 
The evidence linking smoking to breast cancer is inconclusive. Nevertheless, two studies have investigated a putative interaction between smoking, CYP1A1 genotype and breast cancer risk. Neither study had found an overall increase in breast cancer risk with the variant genotypes, but both reported interactions with smoking. Ambrosone et al. found a significant increase in breast cancer risk in `light' smokers who carried the Val462 allele (OR = 5.2), but no such increase in heavy smokers (OR = 0.9) (6). In contrast, Ishibe et al. found no difference in risk in either light or heavy smokers (8). They did, however, find an increased risk for carriers of the Val462 allele that was restricted to women that had started smoking before 18 years of age.

The aim of this study was to clarify the importance of CYP1A1 in breast cancer susceptibility in the British, East Anglian population, using a case–control study design. We restricted our analysis to the two polymorphisms that alter the amino-acid sequence of the protein since the functional relevance of these would be most amenable to direct testing.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Study subjects
Breast cancer cases were ascertained through the East Anglian Cancer Registry as part of the Anglian Breast Cancer Study (10). Patients eligible for the study were those diagnosed below age 55 years since 1991 and still alive in 1996 (prevalent cases), together with all those under 65 years diagnosed between 1996 and 1999 (incident cases). Seventy-two per cent of eligible cases completed an epidemiological questionnaire and provided a blood sample for DNA analysis. The median age of diagnosis of the prevalent cases was 48 years and that of the incident cases 52 years. Women taking part in the study tended to be those with less advanced disease: 49% were stage I, 46% stage II, 3% stage III and 2% stage IV. The equivalent proportion for all eligible cases were 46%, 45%, 5% and 2%. Sixty-seven per cent of all cases were pre-menopausal.

Female controls were randomly selected from the UK part of the European Prospective Investigation of Cancer (EPIC), a prospective study of diet and cancer being carried out in the same population from which the cases have been drawn (11). The whole EPIC cohort comprises 25 000 individuals resident in Norfolk (East Anglia), aged 45–74 years. The controls were slightly older than the cases (median age 57). The ethnic background of both cases and controls was similar (99.0% of cases and 99.4% of controls being white Anglo-Saxon) and we have found no evidence for population stratification in the controls (12).

Genotyping
All samples were genotyped using the ABI PRISM® 7700 Sequence Detection System (PE Biosystems, US). For the Thr461Asn genotyping, PCR amplification was carried out on 20 ng DNA using 1x TaqMan® universal PCR master mix, 300 nM forward (GTGATTATCTTTGGCATGGGC) and reverse (GCCAGGAACAGAAAGACCTCC) primers, 150 nM of the VIC labelled probe (detecting Asn) (CGGGCAATGGTCTCACCGATAC) and 50 nM of the FAM labelled probe (detecting Thr) (GGGCAATGTTCTCACCGATACA) in a 15 ml reaction. Amplification conditions on an MJ Tetrad thermal cycler (GRI, UK) were as follows: 1 cycle of 50°C for 2 min, followed by 1 cycle of 95°C for 10 min and finally 30 cycles of 95°C for 15 s and 60°C for 1 min.

For Ile462Val PCR was carried out using the same conditions but with 300 nM forward (GCATGGGCAAGCGGAA) and reverse (GCCAGGAAGAGAAAGACCTCC) primers, 150 nM of the FAM labelled probe (detecting Ile) (TCGGTGAGACCATTGCCCG) and 100 nM of the TET labelled probe (detecting Val) (CGGTGAGACCGTTGCCCGC) in a 25 ml reaction. The polymorphic base is shown underlined.

Genotypes were determined using the Allelic Discrimination Sequence Detection Software (PE Biosystems, US). Eight each of no-template controls, common homozygote and rare homozygote templates were included in each 96 well plate. The Thr- and Asp461 templates were generated by cloning a heterozygote using the TA cloning kit (Invitrogen, Netherlands) according to manufacturers instructions. The Ile and Val462 templates were made by annealing appropriate oligonucleotides (SGS DNA, Sweden). TaqMan® primers and probes were designed using the Primer Express® Oligo Design Software v1.0 (PE Biosystems).

After initial genotyping of the Ile462Val polymorphism, we noted that there appeared to be an excess of rare homozygotes and the genotype distribution in the controls deviated from HWE. We therefore checked the genotype of all the rare homozygotes by direct sequencing. It was found that the genotype of some individuals that were heterozygous Ile462Val had been mis-classified as Val462 homozygotes if they were also heterozygous for Thr461Asp, and so we also checked the Ile462Val genotypes for all the Thr461Asp heterozygotes. The error was presumably due to inhibition of the binding of the Ile462 probe to the Ile allele by the presence of the Asn461 allele. Conversely, presence of the Val462 allele did not seem to affect binding of the Thr461 probe in the Thr461Asp assay.

Sequencing
Sequencing was carried out using Big-Dye Terminators on the ABI Prism 377 (PE Biosystems) according to manufacturers instructions. Forward (GGAGCTCCACTCACTTGACA) and reverse (AGGCATGCTTCATGGTTAGC) primers were used for the initial amplification across codons 461 and 462.

Statistics
Allele and genotype frequencies in cases and controls were compared by {chi}2 tests. The genotypic specific risks were estimated as odds ratios and associated 95% confidence limits by unconditional logistic regression.

Potential interactions between smoking, CYP1A1 genotype and breast cancer risk were assessed using a case-only study design (13,14). The case-only approach does not estimate main effects, but seeks to identify interactions between two `exposures' that are important in disease aetiology. Here one exposure is genotype, the other smoking. In the absence of interaction, the risks associated with each exposure on its own combine in a multiplicative manner. Departures from multiplicativity are measured by the interaction odds ratio which is obtained from the case only 2 x 2 cross tabulation of genotype (+/–) and risk factor (+/–). In the absence of interaction, the interaction odds ratio is expected to be unity. The case-only approach has two major advantages over the case–control study for identification of interactions: firstly statistical power is increased, and secondly differential ascertainment of risk factors between cases and controls, which may cause bias, is avoided (15). The smoking habit of the cases was categorized as never, >10 pack years, 10–19 pack years, and 20 pack years or greater. The smoking–genotype interaction odds ratios and associated 95% CI for each smoking habit category using never smoker as the referent group was calculated from the appropriate 2 x 2 table (see Table IIIGo).


View this table:
[in this window]
[in a new window]
 
Table III. CYP1A1 genotype frequencies in cases by smoking habit
 
We obtained estimates of the genotypic risks using pooled data from published studies by calculating the Mantel–Haenzel odds ratio, treating each study as a separate stratum.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The genotype frequencies for both prevalent and incident cases were similar for both the Thr461Asp polymorphism ({chi}2 =3.0, 2df, P = 0.22) and for the Ile462Val polymorphism ({chi}2 = 0.15, 2df, P = 0.93). We have therefore combined the data for the two case series in subsequent analyses.

The genotype distribution of Thr461Asp in controls was very close to that expected under Hardy–Weinberg equilibrium (Table IGo). We detected no significant differences between breast cancer cases and controls in either allele frequencies ({chi}2 =0.02, 1df, P = 0.90) or genotype distributions ({chi}2 = 0.17, 2df, P = 0.68). Table IGo also shows the genotype-specific relative risks of breast cancer as estimated by the odds ratio (OR). No significant risk was found for either the Thr/Asp heterozygote [OR = 1.1 (95% CI 0.8–1.4)] or the Asp/Asp homozygote [OR = 0.4 (0.02–6.1)]. Subgroup analyses revealed no effect of age or menopausal status on genotypic risks.


View this table:
[in this window]
[in a new window]
 
Table I. Genotype frequencies in cases and controls and breast cancer risks associated with the CYP1A1 Thr461Asp and Ile462Val polymorphisms
 
The Ile462Val genotype distribution in controls was also close to that expected under Hardy–Weinberg equilibrium (Table IIGo) and again no significant differences were observed between breast cancer cases and the controls (allele frequency {chi}2 = 1.02, 1df, P = 0.31) (genotype frequency {chi}2 = 0.60, 2df, P = 0.44). No significant risk was found for either the Ile/Val heterozygote [OR = 0.8 (0.6–1.1)] or the Val/Val homozygote [OR = 2.7 (0.3–24)], and there was no effect of age or menopausal status on genotypic risks.


View this table:
[in this window]
[in a new window]
 
Table II. Breast cancer risk associated with the combined CYP1A1 Thr461Asp and Ile462Val genotypes (haplotypes)
 
Table IIGo shows the odds ratios associated with the combined genotypes (haplotypes) of both polymorphisms. Although there is a suggestion that carriers of both rare alleles may be protected from breast cancer, such carriers are very rare and this result is not statistically significant.

Table IIIGo shows the CYP1A1 genotype frequencies in cases by smoking habit. No interaction odds ratio differed significantly from unity and thus we found no evidence for an interaction. Furthermore we found no interaction between genotype and alcohol consumption (results not shown).

We have pooled our Ile462Val data with those of the previous four studies in a meta-analysis (Table IVGo), but even with >5000 subjects, none of the genotype-associated risks achieved statistical significance, and there was no consistent pattern to the risks associated with increasing Val allele dosage [Ile/Val OR = 0.9 (0.7–1.1), Val/Val OR = 2.3 (0.4–12), and Val carrier OR = 1.0 (0.9–1.1)].


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We have found no evidence for an association between CYP1A1 genotype and breast cancer risk for either the Thr461Asp or the Ile462Val polymorphisms. Even when we combined our data for the Ile462Val polymorphism with those from four other published studies no significant association emerged. There was an elevated risk of breast cancer associated with women who were homozygous for the Val allele, but despite the fact that this estimate was based on over 5000 study subjects the result was not statistically significant. Much larger studies will be required to confirm a modest increase in breast cancer risk associated with this genotype. Nevertheless, given the point estimate for the risk found in the combined analysis, we can conclude that the at-risk genotype group (Val/val homozygotes) is too rare in Caucasian populations (~0.25%) to have a major public health role. The gene would account for just 0.2% of the familial breast cancer risk with a population attributable fraction of 0.3%.

We found no conclusive evidence for an interaction between CYP1A1 genotype and smoking habit and susceptibility to breast cancer. A slight increase in risk, that was of borderline statistical significance, in moderate smokers (10–19 pack years) who also carry the valine allele of the Ile462Val polymorphism was not apparent in heavy smokers (20+ pack years), in whom the valine allele was protective. This is similar to the effect reported by Ambrosome et al., but does not seem to be biologically plausible, and is inconsistent with the data reported by Ishibe et al.

In interpreting these results some of the possible limitations of the study need to be considered. Our controls were not individually matched for ethnic group, but given the high proportion of both cases and controls that were white Anglo-Saxon and the absence of evidence for stratification in the controls (12), it seems unlikely that population stratification would have any effect on the results. Indeed, population stratification would be expected to result in bias away from the null, whereas we have reported a null result. A second potential source of bias to be considered is survival bias which may affect genotype frequencies in the prevalent cases if genotype were associated with differential survival. However, we found no evidence for a difference in genotype frequency between the two case series, and again, the effect would be predicted to be a bias away from the null. Finally, the possibility that other polymorphic variants in CYP1A1, either within the gene or in the regulatory region, are important determinants of breast cancer susceptibility cannot be excluded, because the extent of linkage disequilibrium across the whole region is not known.


    Notes
 
4 To whom correspondence should be addressed Email: paul1{at}srl.cam.ac.uk Back


    Acknowledgments
 
This work was funded by a programme grant from the Cancer Research Campaign (CRC). PP is a Senior Clinical Research Fellow and BAJP is a Gibb Fellow of the CRC. EPIC is funded by grants from the Medical Research Council, and the CRC. We thank Julian Lipscombe, Karen Redman and the East Anglian Cancer Registry for their help in recruiting the cases, all the staff at EPIC for recruiting the controls, Simon MacBride for assistance in designing the TAQMAN assays, and Paul Russell for help in making the artificial template controls.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Cavalieri,E.L., Stack,D.E., Devanesan,P.D., et al. (1997) Molecular origin of cancer: catechol estrogen-3,4-quinones as endogenous tumor initiators. Proc. Natl Acad. Sci. USA, 94, 10937–10942.[Abstract/Free Full Text]
  2. Garte,S. and Crosti,F. (1999) Chapter 2. A nomenclature system for metabolic gene polymorphisms. IARC Sci. Publ., 148, 5–12.
  3. Crofts,F., Taioli,E., Trachman,J., Cosma,G.N., Currie,D., Toniolo,P. and Garte,S.J. (1994) Functional significance of different human CYP1A1 genotypes. Carcinogenesis, 15, 2961–2963.[Abstract/Free Full Text]
  4. Schwarz,D., Kisselev,P., Cascorbi,I., Schunck,W.H. and Roots,I. (2001) Differential metabolism of benzo[a]pyrene and benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 variants. Carcinogenesis, 22, 453–9.[Abstract/Free Full Text]
  5. Zhang,Z.Y., Fasco,M.J., Huang,L., Guengerich,F.P. and Kaminsky,L.S. (1996) Characterization of purified human recombinant cytochrome P4501A1- Ile462 and -Val462: assessment of a role for the rare allele in carcinogenesis. Cancer Res., 56, 3926–3933.[Abstract/Free Full Text]
  6. Ambrosone,C.B., Freudenheim J.L., Graham S., et al. (1995) Cytochrome P4501A1 and glutathione S-transferase (M1) polymorphisms and postmenopausal breast cancer risk. Cancer Res., 55, 3483–3485.[Abstract/Free Full Text]
  7. Bailey,L.R., Roodi,N., Verrier,C.S., Yee,C.J., Dupont,W.D. and Parl,F.F. (1998) Breast cancer and CYPIA1, GSTM1 and GSTT1 polymorphisms: evidence of a lack of association in Caucasians and African Americans. Cancer Res., 58, 65–70.[Abstract/Free Full Text]
  8. Ishibe,N., Hankinson,S.E., Colditz,G.A., Spiegelman,D., Willett,W.C., Speizer,F.E., Kelsey,K.T. and Hunter,D.J. (1998) Cigarette smoking, cytochrome P450 1A1 polymorphisms and breast cancer risk in the Nurses' Health Study. Cancer Res., 58, 667–671.[Abstract/Free Full Text]
  9. Taioli,E., Trachman J., Chen,X., Toniolo,P. and Garte,S.J. (1995) A CYP1A1 restriction fragment length polymorphism is associated with breast cancer in African-American women. Cancer Res., 55, 3757–3758.[Abstract/Free Full Text]
  10. Pharoah,P.D.P., Lipscombe,J.M., Redman,K., Easton,D.F., Ponder,B.A.J. and Day,N.E. (2000) Familial predisposition to breast cancer in a British population: implications for prevention. Eur. J. Cancer, 36, 773–779.
  11. Day,N., Oakes,S., Luben,R., Khaw,K.T., Bingham,S., Welch,A. and Wareham,N. (1999) EPIC-Norfolk: study design and characteristics of the cohort. European Prospective Investigation of Cancer. Br. J. Cancer, 80 Suppl. 1, 95–103.
  12. Goode,E.L., Dunning,A.M., Healey,C.S., et al. (2001) Assessment of population stratification in a large population-based cohort. 10th Annual Meeting of the International Genetic Epidemiology Society, Garmisch Patenkirchen, Germany.
  13. Begg,C.B. and Zhang,Z.F. (1994) Statistical analysis of molecular epidemiology studies employing case- series. Cancer Epidemiol. Biomarkers Prev., 3, 173–175.[Abstract]
  14. Piegorsch,W.W., Weinberg,C.R. and Taylor,J.A. (1994) Non-hierarchical logistic models and case-only designs for assessing susceptibility in population-based case-control studies. Stat. Med., 13, 153–162.[Web of Science][Medline]
  15. Khoury,M.J. (1997) Genetic epidemiology. In Rothman,K. and Greenland,S. (eds.) Modern Epidemiology, 2nd edn. Lippincott-Raven, Philadelphia, Vol. 1998.
Received May 10, 2001; revised July 17, 2001; accepted July 18, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nicotine Tob ResHome page
X. Chen and K. J. Woodcroft
Polymorphisms in metabolic genes CYP1A1 and GSTM1 and changes in maternal smoking during pregnancy
Nicotine Tob Res, March 1, 2009; 11(3): 225 - 233.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
P. D. Terry and M. Goodman
Is the Association between Cigarette Smoking and Breast Cancer Modified by Genotype? A Review of Epidemiologic Studies and Meta-analysis.
Cancer Epidemiol. Biomarkers Prev., April 1, 2006; 15(4): 602 - 611.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
L. F. Masson, L. Sharp, S. C. Cotton, and J. Little
Cytochrome P-450 1A1 Gene Polymorphisms and Risk of Breast Cancer: A HuGE Review
Am. J. Epidemiol., May 15, 2005; 161(10): 901 - 915.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
H. S. Kok, N. C. Onland-Moret, K. M. van Asselt, C. H. van Gils, Y. T. van der Schouw, D. E. Grobbee, and P. H.M. Peeters
No association of estrogen receptor {alpha} and cytochrome P450c17{alpha} polymorphisms with age at menopause in a Dutch cohort
Hum. Reprod., February 1, 2005; 20(2): 536 - 542.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Zhu, M. R. Spitz, C. I. Amos, J. Lin, M. B. Schabath, and X. Wu
An Evolutionary Perspective on Single-Nucleotide Polymorphism Screening in Molecular Cancer Epidemiology
Cancer Res., March 15, 2004; 64(6): 2251 - 2257.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
P. D. Terry and T. E. Rohan
Cigarette Smoking and the Risk of Breast Cancer in Women: A Review of the Literature
Cancer Epidemiol. Biomarkers Prev., October 1, 2002; 11(10): 953 - 971.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. L. Goode, A. M. Dunning, B. Kuschel, C. S. Healey, N. E. Day, B. A. J. Ponder, D. F. Easton, and P. P. D. Pharoah
Effect of Germ-Line Genetic Variation on Breast Cancer Survival in a Population-based Study
Cancer Res., June 1, 2002; 62(11): 3052 - 3057.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Basham, V. M.
Right arrow Articles by Dunning, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Basham, V. M.
Right arrow Articles by Dunning, A. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?