Carcinogenesis, Vol. 22, No. 11, 1801-1807,
November 2001
© 2001 Oxford University Press
MOLECULAR EPIDEMIOLOGY AND CANCER PREVENTION |
Cyclin D1 (CCND1) genotype is associated with tumour grade in sporadic pituitary adenomas
Centre for Cell and Molecular Medicine, School of Postgraduate Medicine, Keele University, North Staffordshire Hospital, Stoke-on-Trent ST4 7QB,
1 Department of Endocrinology, St Bartholomew's Hospital, London,
2 Department of Endocrinology, Radcliffe Infirmary, Oxford OX2 6HE, UK,
3 Department of Endocrinology, University Medical Centre, Ljubljana, Republic of Slovenia and
4 Department of Pathology, Location JNI, Dijkizigt ziekenhuis/E.M.C.R., Postbus 2040, 3000 CA Rotterdam, The Netherlands
| Abstract |
|---|
|
|
|---|
The cyclin D1 (CCND1) gene contains a frequent A/G polymorphism within the splice donor region of exon 4/intron 4. CCND1 genotype is associated with clinical outcome in a number of malignancies although prognostic significance varies with tumour type. We examined CCND1 allele frequencies and genotype distribution in 294 patients with sporadic pituitary adenomas of various histologies. CCND1 allele frequencies and distribution of genotypes were similar in the 294 cases compared with previously reported control populations. Analysis according to tumour subtype showed no statistical difference in allele frequencies compared with controls. However, CCND1 genotype distribution in the somatotrophinomas showed a significant difference compared with normal controls (P = 0.008). We next examined CCND1 allele frequencies and genotype distribution across the tumour grades. Within the total tumour cohort the CCND1 allele frequencies showed a significant inverse relationship across the tumour grades (P = 0.005). The CCND1 A allele progressively increased from grade 1 (0.37) through to grade 4 (0.62) tumours, whilst the CCND1 G allele frequency progressively decreased from grade 1 (0.63) through to grade 4 (0.38) tumours. Trend analysis of CCND1 genotypes showed a significant progressive increase in AA frequency from grade 1 (15%) through to grade 4 (46%) tumours (P = 0.005). The CCND1 GG genotype progressively decreased from grade 1 (41%) through to grade 4 (23%) tumours (P = 0.204). No statistical significance was observed between CCND1 AG genotype and tumour grades. While the functional significance of the observed segregation of the CCND1 A/G polymorphism and tumour grade is unclear, our data suggest that CCND1 allele frequencies and genotype distributions show significant differences between tumour grades in sporadic pituitary adenomas. Since CCND1 genotype may be determined by analysis of peripheral blood samples it may provide a useful predictive marker for those tumours likely to show invasive behaviour. This may be clinically useful in indicating which tumours should receive adjunctive treatment (e.g. radiotherapy) immediately after surgical resection.
| Introduction |
|---|
|
|
|---|
The paradigm for initiation and progression of tumours is best described in colorectal cancer (1) and a similar multi-step aetiology has been proposed for endocrine tumours (2,3). Since sporadic pituitary tumours are predominantly monoclonal in origin (4), genetic alterations to a single cell may offer a growth advantage over surrounding cells allowing for tumour development and expansion. Consequently, genes that influence cell cycle control may be critical.
Aberrations in both oncogenes (57) and tumour suppressor genes (TSG) (8) at the G1S cell cycle checkpoint have been shown to be frequent events in a number of malignancies. The proto-oncogene cyclin D1 (CCND1) is one of the most frequently amplified genes in human neoplasia (7,9), where inappropriate expression of its protein product may lead to unregulated cellular proliferation. In addition to amplification, another principal mechanism leading to inappropriate cyclin D1 expression is cytogenetic inversion as described in parathyroid tumours (10). Overexpression of cyclin D1 protein is associated with a lower rate and/or interval to recurrence rate in breast (11), bladder (12) and non-small cell lung cancer (5). Conversely in squamous cell carcinoma of the head and neck overexpression of cyclin D1 is associated with a decrease in disease free interval (13).
The use of current routine histological criteria cannot determine those pituitary tumours that are destined to show progression. However, our own previous studies (14,15) have shown an association between loss of heterozygosity at a number of loci and transition to an invasive phenotype. In addition Hibberts et al. (16) have shown frequent overexpression of cyclin D1 in non-invasive tumours suggesting this as an early event in pituitary tumourigenesis.
Recent reports have identified a significant association between CCND1 genotype and patient outcome (17,18). We therefore exploited the frequent A/G polymorphism, at nucleotide 870, within the exon 4/intron 4 splice region of the CCND1 gene (17) to determine the influence of CCND1 alleles and genotype distribution in sporadic pituitary tumours.
| Materials and methods |
|---|
|
|
|---|
Peripheral blood samples were obtained from 294 unrelated European Caucasian patients with sporadic pituitary tumours. Patient details were obtained retrospectively and tumours were defined as non-invasive or invasive on the basis of CT and/or MRI reports prior to DNA analysis and graded according to published criteria (14,15). Grade 1 tumours were microadenomas and grade 2 tumours consisted of enclosed macroadenomas with or without suprasellar extension. Both grade 1 and 2 tumours were defined as non-invasive. Grade 3 tumours were locally invasive with evidence of bony destruction and tumour within the sphenoid and/or cavernous sinus. Grade 4 tumours demonstrate CNS/extracranial spread with or without distant metastases. Grade 3 and 4 tumours were considered to be invasive. Subtype classification was based on typical clinical phenotype and hormonal measurements. Of the 294 patient cases, 72 tumours were classified as grade 1, 100 as grade 2, 109 as grade 3 and 13 as grade 4 (Table I
|
Within the 294 patient cases 54 had evidence of a recurrent tumour. The recurrent tumours comprised 37 non-functional adenomas (grade 1, 12; grade 2, 17; grade 3, 8), 8 somatotrophinomas (grade 1, 1; grade 2, 4; grade 3, 3), 4 corticotrophinomas (grade 1, 3; grade 3, 1) and 5 prolactinomas (grade 2, 3; grade 3, 2).
Determination of CCND1 genotype
Peripheral blood samples were collected in EDTA and genomic DNA extracted from leukocytes using commercially available reagents (Nucleon 1; Scotlab, Strathclyde, UK). CCND1 genotype was identified using PCR amplification encompassing nucleotide 870 (A/G polymorphic site) at the exon 4/intron 4 splice region (17) using gene specific oligonucleotides (sense, GCAGTGCAAGGCCTGAACCT; antisense, GGGACATCACCCTCACTTAC). PCR reactions were carried out in 25 µl volumes with 1.5 mM MgCl2, 200 µM each dATP, dGTP, dTTP and dCTP, 2 pmol each primer, 200 ng template DNA and 1 U Taq DNA polymerase. PCR was carried out for 27 cycles. PCR product (5 µl) was digested with 3 U ScrfI (New England Biolabs, Herts, UK) for 3 h at 37°C. Digested products were run on 8% non-denaturing polyacrylamide gels, fixed and visualized by silver staining as previously described (15,16). CCND1 genotype was assigned after visualization of 113 (CCND1 AA), 91 (CCND1 GG) or 113 and 91 bp (CCND1 AG) fragments (Figure 1
).
|
Sequence analysis of CCND1 A/G polymorphism
The CCND1 genotype was confirmed by direct sequence analysis of nucleotide 870 within the intron 4/exon 4 splice in 24 randomly selected cases comprising eight of each (AA, AG and GG) genotype. The CCND1 A/G polymorphism, and the surrounding region, was subjected to PCR amplification using the gene specific oligonucleotides and conditions as described above. PCR amplicons were subjected to cycle sequencing reactions according to the manufacturer's protocol (BigDyeTM Terminator Cycle Sequencing; PE Applied Biosystems, Warrington, UK) using both sense and antisense PCR oligonucleotides. Cycle sequencing products were subjected to capillary electrophoresis using an automatic sequencer (ABI Prism 310 Genetic Analyser; PE Applied Biosystems). Sequencing data were analysed using Sequencing Analysis V3.0 (ABI Prism; PE Applied Biosystems).
Statistical analysis
All statistical analyses were performed using the Stata statistical package (version 5, Stata Corp., TX, USA). The Chi-squared test was used to assess homogeneity between groups (e.g. cases and controls). The Armitage trend test was used to examine the relationship between CCND1 allele frequencies and genotype distribution with tumour grade. This test is used to identify an increase or decrease in proportions over ordered categories, as distinct from the chi-squared test, which is used to determine if non-ordered categories differ in proportions. Significance was taken at the 5% level.
For those cases where peripheral bloods were available from patients with evidence of recurrence association between genotype and time to recurrence were examined by Cox's proportional hazards regression and represented graphically using Kaplan Meier analysis.
| Results |
|---|
|
|
|---|
Normal control population
Three studies (1719) have reported the CCND1 allele frequencies of separate European Caucasian control populations. Since statistical analysis showed no significant difference between the CCND1 allele frequencies or genotype distribution in these three populations (n = 414) we have used the combined allele frequencies (A = 0.43, G = 0.57) and genotype distribution (AA = 18%, AG = 50%, GG = 32%) from these reports in our present study.
Association of CCND1 allele frequencies and genotype distribution in sporadic pituitary tumours
We first assessed allele frequencies and genotype distribution in 294 cases previously reported with sporadic pituitary tumours (1416,20,21). Figure 1A
shows representative examples of the three CCND1 genotypes. Table I
summarizes CCND1 allele frequencies and genotype distribution in all cases examined together with previously reported controls (1719). Assignment of CCND1 genotype by restriction enzyme digest was confirmed in 24 randomly selected cases by direct sequence analysis (Figure 1B
). As further confirmation of correct genotype assignment, we assessed CCND1 genotype distribution of the total patient cohort using the HardyWeinberg equation. No significant difference between observed and expected genotypes (P = 0.16) was observed. We next compared CCND1 allele frequency and genotype distribution in the total patient cohort compared with normal controls, no significant difference in CCND1 allele frequencies or genotype distribution between the total patient cohort and normal controls was observed (P = 0.8).
Association of CCND1 allele frequencies and genotype distribution with tumour subtype
There was no significant difference in CCND1 allele frequencies between individual tumour subtypes and normal controls (P = 0.50.8) (Table I
). In addition, with one exception (somatotrophinomas), CCND1 genotype distribution showed no significant difference between individual tumour subtypes and normal controls. CCND1 genotype distribution within the somatotrophinoma cohort showed a significant difference (
2 [2df] = 9.6; P = 0.008) compared with normal controls.
Association of CCND1 allele frequencies and genotype distribution with tumour grade
The relative proportions of each tumour grade varied within individual tumour subtypes, however, since tumour grades (14) could be assigned to ordered categories; we used Armitage trend analysis to calculate significance within patient cases. Within the total tumour cohort analysis of CCND1 allele frequencies showed a highly significant (P = 0.005) reciprocal change in the CCND1 A and G allele frequencies across the tumour grades (Figure 2A
). The CCND1 A allele frequency significantly increased from grade 1 (0.37) through to grade 4 (0.62) tumours. Conversely, the CCND1 G allele frequency decreased from grade 1 (0.63) through to grade 4 (0.38) tumours (Figure 2A
and Table I
). Using trend analysis, we next analysed CCND1 genotype distributions across the tumour grades. Our analysis showed a significant progressive increase in CCND1 AA genotype distribution from grade 1 (15%) through to grade 4 (46%) tumours (AA versus GG + AG; P = 0.005). Conversely, CCND1 GG genotype distribution progressively decreased from grade 1 (41%) through to grade 4 (23%), although the decrease was not statistically significant (GG versus AA + AG; P = 0.204) (Figure 2B
; Table I
). No association was observed between CCND1 AG genotype and tumour grade (Figure 2B
).
|
Influence of grade 4 adenomas on statistical analysis
Since the grade 4 tumours represented a considerably smaller number of tumours than those comprising the other grades, we further confirmed the conclusions reached by Armitage trend analysis by excluding this group from the analysis. Trend analysis of the total tumour cohort across grades 1, 2 and 3 showed a significant inverse relationship (P = 0.011) between the CCND1 A and G alleles (increasing and decreasing, respectively). A similar analysis of genotype distribution showed a significant increase in the CCND1 AA genotype frequency with increasing tumour grade (P = 0.015).
Association of CCND1 genotype distribution and allele frequencies with tumour grade within a subtype
To investigate the possibility that the observed changes in genotype distribution might segregate with a particular tumour subtype we analysed CCND1 genotype distribution across the grades within each tumour subtype. Genotype distribution in prolactinomas (Figure 3A
; Table II
) showed a progressive increase in CCND1 AA from grade 1 (11%) through to grade 4 (66%) (P = 0.061), whilst the CCND1 GG genotype progressively decreased from grade 1 (43%) through to grade 4 (0%) (P = 0.112). Similar analysis of CCND1 allele frequencies showed a significant inverse relationship between CCND1 A and G alleles across the tumour grades in the prolactinomas cohort (P = 0.007).
|
|
Though the same trend of increasing frequency of the CCND1 A allele and decreasing frequency of the CCND1 G allele with increasing tumour grade was also observed in the somatotrophinomas and corticotrophinomas (Figure 3B
Association of CCND1 genotype distribution with time to recurrence
Within the total cohort 54 patients had been treated for recurrent disease. No significant association between genotype and time to recurrence was found (AA versus AG + GG, P = 0.108; GG versus AG + AA, P = 0.662) (Figure 4
).
|
| Discussion |
|---|
|
|
|---|
Numerous studies have suggested that overexpression of cyclin D1 protein and/or amplification/rearrangement of this locus is important in different tumour types (6,10,12,13,16,19,22,23). In addition, the influence of the A/G polymorphism within the exon 4/intron 4 splice region of CCND1 has been shown to be significantly associated with susceptibility and outcome in squamous cell carcinoma of the head and neck (SSCHN) (18) and non-small cell lung cancer (NSCLC) (5). In our present study, we have examined CCND1 allele frequencies and genotype distributions in a large cohort of patients with sporadic pituitary adenomas.
In agreement with other studies, we found no significant difference in the frequency of CCND1 alleles (17) or the distribution of genotypes between the total tumour cohort and previously reported control populations (17,19). However, allele frequencies showed a highly significant reciprocal relationship, where the CCND1 A allele frequency progressively increased and CCND1 G allele frequency decreased with increasing tumour grade. Since these data suggest that CCND1 alleles may influence or reflect the biological behaviour of these tumours, and as such could be important as a prognostic indicator, we then analysed CCND1 genotype distribution. With the exception of the somatotrophinomas subtype, no difference in CCND1 genotype distribution was observed compared with the normal control population. However, in the somatotrophinomas this difference in genotype distribution may simply reflect tumour grade proportions within this tumour subtype. We therefore analysed the association between CCND1 genotype and tumour grade. Across the total tumour cohort we observed a progressive increase in the CCND1 AA and decrease in the CCND1 GG genotype distributions from grade 1 through to grade 4 adenomas. Since there was no significant association of the CCND1 AG genotype and tumour grade, these data suggest that the influence of CCND1 A and G alleles as CCND1 AA or GG are associated with, or influence pituitary tumour progression. In a recent study, Matthias et al. (18) demonstrated a significant correlation between the homozygous CCND1 GG genotype and poor patient prognosis in SCCHN. However, a study of NSCLC (17) has shown tumours of a lower rate of recurrence to be associated with the CCND1 GG genotype. The conflicting data between these two studies suggest that the influence of CCND1 polymorphism is perhaps dependent on tumour type.
The underlying mechanism by which CCND1 genotypes are associated with pituitary tumour grade is not clear. CCND1 mRNA is alternatively spliced to form two transcripts a and b. Transcript b has no C-terminal PEST rich region (destruction box), suggesting that the half-life of this protein may be longer. Splicing of CCND1 mRNA appears to be influenced by the exon 4/intron 4 A/G polymorphism. Since tissues heterozygous for the polymorphism have increased expression of transcript b from the CCND1 A allele (17), it would be expected that tissues with a homozygous CCND1 AA genotype would favour expression of transcript b compared with the homozygous CCND1 GG genotype.
In a previous study, we showed inappropriate immunohistochemical expression (IHC) of cyclin D1 that was associated with the non-functional tumour subtype, but not with tumour grade or an observed allelic imbalance (16). Since peripheral blood from these tumours was included in the present investigation, it allowed us to examine the association between genotype and expression; however, no association was seen (data not shown). Recent data from McKay et al. (19), in this case of colorectal tumours, also found that CCND1 genotype was not related to inappropriate expression of cyclin D1 as determined by IHC.
In common with other tumour types, the growth of pituitary tumours is thought to reflect a biological continuum where low-grade tumours would, if left untreated, progress toward a higher grade. Therefore our findings of an association between tumour grade and allele frequencies/genotype distribution are not readily explainable. One possible explanation that might account for our findings and perhaps reconcile this apparent paradox may be as follows. The CCND1 AA genotype may simply reflect or be associated with a tumour that is biologically more aggressive and faster growing. Thus, at the point of tumour initiation allele frequencies and genotype distribution within a total tumour cohort will be similar to that seen in a normal population. However, subsequent growth rate may be influenced by the individual tumour CCND1 genotype. If this is the case, then the faster growing or more aggressive tumours would most likely be associated with the CCND1 A allele and the CCND1 AA genotype. However, no association was found between CCND1 genotype and time to recurrence. This may perhaps not be surprising since, to our knowledge, no association between tumour grade and time to recurrence have been described.
In conclusion, our data show that CCND1 allele frequencies and genotype distribution show significant differences according to tumour grade in sporadic pituitary adenomas and may therefore have prognostic significance. Since CCND1 genotype may be directly determined by analysis of a peripheral blood sample, its identification may provide a useful predictive marker for the clinical management of sporadic pituitary tumours.
| Notes |
|---|
5 To whom correspondence should be addressed w.e.farrell{at}keele.ac.uk
| Acknowledgments |
|---|
We are grateful to the Medical Research Council for financial support.
| References |
|---|
|
|
|---|
- Fearon,E.R. and Vogelstein,B. (1990) A genetic model for colorectal tumourigenesis. Cell, 61, 759767.[Web of Science][Medline]
- Thakker,R.V. (1993) The molecular genetics of the multiple endocrine neoplasia syndrome. Clin. Endocrinol., 38, 114.[Medline]
- Melmed,S. (1994) Pituitary neoplasia. In Gagel,R.F. (ed.) Multiple Endocrine Neoplasia. Endocrinol. Metab. Clin. North Am., 23, 8192.
- Alexander,J.M., Biller,B.M.K., Bikkal,H., Zervas,N.T., Arnold,A. and Klibanski,A. (1990) Clinically non-functioning pituitary tumours are monoclonal in origin. J. Clin. Invest., 86, 336340.
- Betticher,D., Heighway,J., Haselton,P.S., Altermatt,H.J., Ryder,W.D.J., Cerny,T. and Thatcher,N. (1996) Prognostic significance of CCND1 (cyclin D1) overexpression in primary resected non-small cell lung cancer. Br. J. Cancer, 73, 294300.[Web of Science][Medline]
- Palmero,I. and Peters,G. (1996) Perturbation of cell cycle regulators in human cancer. Cancer Surv., 27, 351367.[Web of Science][Medline]
- Sherr,C.J. (1995) D type cyclins. Trends Biochem. Sci., 20, 187190.[Web of Science][Medline]
- Farrell,W.E. and Clayton,R.N. (1998) Molecular genetics of pituitary tumour. Trends Endocrinol. Metab., 9, 2026.[Medline]
- Motokura,T., Bloom,T., Kim,H.G., Juppner,H., Ruderman,J.V., Kronenberg,H.M. and Arnold,A. (1991) A novel cyclin encoded by a bcl-1 linked candidate oncogene. Nature, 350, 512515.[Medline]
- Rosenberg,C.L., Kim,H.G., Show,T.B., Kronenberg,H.M. and Arnold,A. (1991) Rearrangement and overexpression of D11S287E, a candidate oncogene on chromosome 11q13 in benign parathyroid tumours. Oncogene, 6, 449453.[Web of Science][Medline]
- Gillet,C., Smith,P., Gregory,W., Richards,M., Millis,R., Peters,G. and Barnes,D. (1996) Cyclin D1 and prognosis in human breast cancer. Int. J. Cancer, 69, 9299.[Web of Science][Medline]
- Bringuier,P.P., Tammy,E., Schruuring,E. and Schalken,J. (1996) Expression of cyclin D1 and EMS1 in bladder tumours, relationship with chromosome 11q13 amplification. Int. J. Cancer, 69, 9299.
-
Michalides,R., van Veelan,N., Hart,A., Loftus,B., Wientjens,E. and Balm,A. (1995) Overexpression of cyclin D1 correlates with recurrence in a group of forty-seven operable squamous cell carcinomas of the head and neck. Cancer Res., 55, 975978.
[Abstract/Free Full Text] - Boggild,M.D., Jenkinson,S., Pistorello,M., Boscaro,M., Scanarini,M., McTernan,P., Perrett,C.W., Thakker,R.V. and Clayton,R.N. (1994) Molecular genetic studies of sporadic pituitary tumours. J. Clin. Endocrinol. Metab., 78, 387392.[Abstract]
-
Bates,A.S., Farrell,W.E., Bicknell,E.J., McNicol,A.M., Talbot,A.J., Broome,J.C., Perrett,C.W., Thakker,R.V. and Clayton,R.N. (1997) Allelic deletion in pituitary adenomas reflects aggressive biological activity and has potential value as a prognostic marker. J. Clin. Endocrinol. Metab., 82, 818824.
[Abstract/Free Full Text] -
Hibberts,N.A., Simpson,D.J., Bicknell,J.E., Broome,J.C., Hoban,P.R., Clayton,R.N. and Farrell,W.E. (1999) Analysis of cyclin D1 (CCND1) allelic imbalance and overexpression in sporadic human pituitary tumors. Clin. Cancer Res., 5, 21332139.
[Abstract/Free Full Text] - Betticher,D., Thatcher,N., Altermatt,H.J., Hoban,P., Ryder,W.D. and Heighway,J. (1995) Alternate splicing produces a novel cyclin D1 transcript. Oncogene, 11, 10051011.[Web of Science][Medline]
-
Matthias,C., Branigan,K., Jahnke,V., Leder,K., Haas,J., Heighway,J., Jones,P.W., Strange,R.C., Fryer,A.A. and Hoban,P.R. (1998) Polymorphism in the cyclin D1 gene is associated with prognosis in patients with squamous cell carcinoma of the head and neck. Clin. Cancer Res., 4, 24112418.
[Abstract/Free Full Text] - McKay,J.A., Douglas,J.J., Ross,V.G., Curran,S., Murray,G.I., Cassidy,J. and Mcleod,H.L. (2000) Cyclin D1 protein expression and gene polymorphism in colorectal cancer. Int. J. Cancer, 88, 7781.[Web of Science][Medline]
-
Farrell,W.E., Simpson,D.J., Bicknell,E.J., Talbot,A.J., Bates,A.S. and Clayton,R.N. (1997) Chromosome 9p deletions in invasive and non-invasive non-functional pituitary adenomas. The deleted region involves markers outside of the MTS1 and MTS2 genes. Cancer Res., 57, 27032709.
[Abstract/Free Full Text] - Simpson,D.J., Bicknell,J.E., McNicol,A.M., Clayton,R.N. and Farrell,W.E. (1999) Hypermethylation of the p16/CDKN2A/MTS1 gene and loss of protein expression is associated with non-functioning adenomas but not somatotrophinomas. Genes Chromosom. Cancer, 24, 328336.[Web of Science][Medline]
-
Jares,P., Ferndanez,P.L., Campo,E., Nadal,A., Bosch,F., Aiza,G., Nayach,I., Traserra,J. and Cardesa,A. (1994) Cyclin D1 gene amplification correlates with messenger RNA overexpression and tumour progression in human laryngeal carcinomas. Cancer Res., 55, 48134817.
[Abstract/Free Full Text] - Callender,T., El-Nagger,A.K., Lee,M.S., Frankenthaler,R., Luna,M.A. and Batsakis,J.G. (1994) PRAD-1 (CCND1)/cyclin D1 oncogene amplification in head and neck squamous cell carcinoma. Cancer, 74, 152158.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
I. De Martino, R. Visone, A. Wierinckx, D. Palmieri, A. Ferraro, P. Cappabianca, G. Chiappetta, F. Forzati, G. Lombardi, A. Colao, et al. HMGA Proteins Up-regulate CCNB2 Gene in Mouse and Human Pituitary Adenomas Cancer Res., March 1, 2009; 69(5): 1844 - 1850. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Quereda and M. Malumbres Cell cycle control of pituitary development and disease J. Mol. Endocrinol., February 1, 2009; 42(2): 75 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pabalan, B. Bapat, L. Sung, H. Jarjanazi, O. Francisco-Pabalan, and H. Ozcelik Cyclin D1 Pro241Pro (CCND1-G870A) Polymorphism Is Associated with Increased Cancer Risk in Human Populations: A Meta-Analysis Cancer Epidemiol. Biomarkers Prev., October 1, 2008; 17(10): 2773 - 2781. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gurlek, N. Karavitaki, O. Ansorge, and J. A H Wass What are the markers of aggressiveness in prolactinomas? Changes in cell biology, extracellular matrix components, angiogenesis and genetics Eur. J. Endocrinol., February 1, 2007; 156(2): 143 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Qiuling, Z. Yuxin, Z. Suhua, X. Cheng, L. Shuguang, and H. Fengsheng Cyclin D1 gene polymorphism and susceptibility to lung cancer in a Chinese population Carcinogenesis, September 1, 2003; 24(9): 1499 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
J W Ironside Best Practice No 172: Pituitary gland pathology J. Clin. Pathol., August 1, 2003; 56(8): 561 - 568. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









