Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by El-Naggar, A. K.
Right arrow Articles by Lozano, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by El-Naggar, A. K.
Right arrow Articles by Lozano, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 22, No. 5, 729-735, May 2001
© 2001 Oxford University Press


CARCINOGENESIS

p73 gene alterations and expression in primary oral and laryngeal squamous carcinomas

Adel K. El-Naggar1,5, Syeling Lai1, Gary L. Clayman2, Betsy Mims3, Scott M. Lippman4, Madelene Coombes1, Mario A. Luna1 and Guillermina Lozano3

1 Department of Pathology,
2 Department of Head and Neck Surgery,
3 Department of Molecular Genetics and
4 Department of Clinical Cancer Prevention, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77030, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
p73, a recently identified gene, maps to chromosome region 1p36.3, which is frequently deleted in a variety of solid tumors. Although the gene shares sequence and functional homologies with p53, its suppressor function has not been proven. We investigated for the first time the genetic and expression status of the p73 gene and analyzed its flanking microsatellite loci on chromosome 1p36.3 in 67 primary oral and laryngeal squamous cell carcinomas to determine their association with these tumors. Our results reveal two missense mutations at codons 469 and 477 and a silent mutation at codon 349 in the C-terminal domain. Site-directed mutagenesis of p73 cDNA with these mutations and a p21 transactivation assay failed to show any significant functional consequences of these mutations. Microsatellite analysis of the flanking loci of p73 in region 1p36 showed overall alterations (loss of heterozygosity and instability) frequency of 39%, 16% at the proximal marker and 46% at the distal markers. Of the 21 cases for which we did protein expression analyses, 11 tumors had a >2-fold variation compared with matching histologically normal mucosa. Our study shows that: (i) intragenic alterations in this gene are rare and lack functional significance; (ii) its variable expression argues against a tumor suppressor function; (iii) this gene plays a minor role in head and neck squamous carcinoma; (iv) a distal site to this gene on 1p36 may harbor another suppressor gene.

Abbreviations: HNSC, head and neck squamous carcinoma; LOH, loss of heterozygosity; PBS, phosphate-buffered saline; RT–PCR, reverse transcription–polymerase chain reaction; SSCP, single strand conformation polymorphism.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
More than ~40 000 new cases of head and neck squamous carcinoma (HNSC) were diagnosed in the USA in 1999 (13). While advances in the diagnosis and management of this cancer have been achieved in the last three decades, ~50% of patients succumb to their disease (4). Efforts to improve our understanding of the underlying genetic abnormalities associated with the development and progression of these tumors are necessary for the development of new diagnostic and biological markers for better management. Although several new biomarkers have been investigated for their potential role in assessing HNSC, none has been validated for clinical application (57). We and others, using molecular techniques, have shown frequent alterations at certain chromosomal regions and in tumor suppressor genes, including p53, in HNSC (814). Recently, two new p53-related genes, p63 and p73, have been identified and found to be associated with tumorigenesis of certain malignant neoplasms (1520). Given their structural homology and the incidence of p53 gene alterations in cancers, a complementary role for these genes is hypothesized (20).

The p73 gene maps to chromosome 1p36.3, a region frequently deleted in several solid tumors (15,18,19,21), and has recently been localized to <6 Mb (2224) within this region. p73 shares significant functional and structural homology, including 29% sequence identity at the N-terminal transactivation site, 38% at the tetramerization site and 63% at the DNA-binding domains, with the p53 gene (16,17,2528). The gene transcribes at least six alternatively spliced mRNA variants (designated {alpha}, ß, {gamma}, {delta}, {varepsilon} and {phi}) and encodes multiple polypeptide products (29,30). The {alpha} form is composed of 636 residues, while the ß form contains only 499 residues and lacks exon 13, resulting in a frameshift and truncation of the oligomerization C-terminal domain (15). Both the {alpha} and ß variants form heterodimers and bind to the canonical p53-responsive elements and mutant p53 protein, suggesting a cooperative interaction between these variants (15,31,32). The {gamma} and {delta} variants splice out exons 11 and 11–13, respectively, and neither interact with p53 (29). Recently, two additional splice variants, {varepsilon} and {phi}, were identified; the {varepsilon} isoform is generated by splicing out exons 11 and 12 while {phi} is identical to the {gamma} isoform. Both of these new isoforms have been found to share homology in the transactivation, DNA-binding and oligemerization domains with p53 (30).

As with p53, p73 splice variants activate transcription of the p21 gene, induce growth inhibition and apoptosis and stimulate MDM2 gene expression (15,3032). Unlike p53, however, p73 is neither activated nor induced by actinomycin D or UV-induced DNA damage and may interact with p53-binding viral oncoproteins through a different mechanism (28,3336). These characteristics, together with the inconsistent imprinting, rare mutations and variable expression, contraindicate a suppressor role for this gene (25,27,28,31,3547). This study represents a first analysis of the genetic and expression status of the p73 gene and flanking loci on chromosome 1p36.3 in primary HNSC. Our objectives were to determine the frequency of molecular alterations and their association with squamous tumorigenesis at the oral and laryngeal sites.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Sixty-seven untreated primary squamous carcinomas and matching normal mucosa samples from equal numbers of patients were freshly obtained by the frozen section unit of the Department of Pathology at the University of Texas M.D. Anderson Cancer Center between 1993 and 1996. Tissue samples from each specimen were immediately frozen and kept at –80°C until used. Both normal mucosa and carcinoma specimens were verified to contain squamous epithelium and >80% of tumor cells by frozen section review. Normal mucosa samples were selected from the mucosa region within the resected specimen that was furthest from the tumor.

DNA extraction
Frozen tissue specimens were ground and incubated for 3 h in lysis buffer (1% SDS, 0.1 M NaC1, 50 mM EDTA, pH 8.0, 200 µg/µl proteinase K). DNA was then purified using standard procedures of phenol/chloroform extraction followed by ethanol precipitation (12).

RNA extraction
RNA was isolated using the ultraspec RNA isolation system (Biotex Laboratories Inc.) according to the manufacturer's instructions. RNA dissolved in DEPC/H2O was treated with RNase-free DNase I (BRL Life Science) at a concentration of 0.1 U/µl to eliminate DNA contamination. To assess the integrity of the extracted RNA, 2% agarose gel electophresis with 6% formaldehyde was carried out.

PCR amplification
Two-hundred nanograms of genomic DNA were amplified with primers for exons 3–14 of the p73 gene (Table IGo). The PCR mixture contained 1x PCR buffer (Perkin-Elmer Cetus), 1 µM primer, 200 µM dNTP, 2.5 U Taq polymerase (Promega), 5% dimethylsulfoxide and 200 ng template. To ensure PCR specificity, a touchdown method with the following conditions was used: one cycle at 95°C for 5 min; 20 cycles (23 cycles for exon 6) at 94°C for 1 min, 56°C for 1 min and 72°C for 1 min; 15 cycles at 94°C for 1 min, 52°C for 1 min and 72°C for 1 min. The final elongation step was performed at 72°C for 5 min. The primer sequences and annealing temperatures are listed in Table IGo.


View this table:
[in this window]
[in a new window]
 
Table I. Primer sequences for SSCP analysis
 
Microsatellite analysis
Four microsatellite markers (D1S243, D1S165, CRTM and FGR; Research Genetics) flanking the p73 locus on 1p36.3 were used. The chromosomal location of marker DlS243 is proximal to p73 at ~9 kb and marker DlS165, which was previously selected for its proximal location to the gene, is now, along with markers FGR and CRTM, are distal to the p73. These locations are based on data from the University of Southampton, UK web site. For standard PCR aliquots of DNA were mixed with primers for each locus. One primer was end-labeled with {gamma}-32P and T4 polynucleotide kinase. Sequencing stop buffer was added to the reaction and the PCR products were denatured at 94°C for 3 min, quick chilled on ice and loaded on a 7% acrylamide–urea sequencing gel containing 32% (v/v) formamide. Electrophoresis was performed at 80 W for 3–4 h depending on fragment size. The gels were dried and exposed to Hyperfilm MP (Amersham) at –80°C with an intensifying screen.

Single strand conformation polymorphism (SSCP) analysis and sequencing
All samples were screened for mutation at exons 3–14 by SSCP analysis. Five microliters of the PCR product were denatured by heating at 95°C for 5 min in 5 µl of sequencing stop solution (US Biochemical). The mixture was placed on a 10% non-denaturing acrylamide gel as previously described (12) and the gel stained with a silver staining kit (Pierce). Samples with a band shift on SSCP analysis were subsequently sequenced; 20 µl of PCR product from each specimen was purified using a Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions. Purified DNA was eluted into 10 µl of EB buffer (Qiagen) and 10 µl of rhodamine was added to the mixture. A cycle sequencing reaction was conducted using an ABI Prism Big Dye Terminator Cycle Sequencing kit with a GeneAmp PCR System 9600 (Perkin-Elmer). The reaction mixture was purified by ethanol precipitation and the sequencing reaction solution was separated using an ABI Prism 310 automatic sequencer (Perkin-Elmer).

Reverse transcription–polymerase chain reaction (RT–PCR)
Five micrograms of total RNA was reverse transcribed to cDNA in 20 µl of reaction solution using Superscript II RNase H Reverse Transcriptase (Gibco Life Technologies) according to the manufacturer's instructions. An aliquot of 2 µl of cDNA was used for PCR amplification with primers 9F and 10R in the same buffer as used for genomic DNA amplification. Primers for IL-1{alpha} (DL151 and DL152) were used as controls (Perkin-Elmer). After denaturation PCR amplification was conducted for 20 cycles at an annealing temperature of 60°C followed by 15 cycles at an annealing temperature of 57°C. Ten microliters of PCR products were electrophoresed in a 2% agarose gel: the product sizes for p73 and IL-1{alpha} were 210 and 422 bp, respectively. The relative p73 expression levels were standardized using the IL-1 value for each sample.

Protein extraction
Twenty-one sets of matched frozen histologically normal and tumor tissue specimens were homogenized, sonicated for 15 s twice in 500 µl of lysis buffer [1x phosphate-buffered saline (PBS), 1% Nonidet-p40, 0.5% sodium deoxycholate, 0.1% SDS and 0.1 mg/ml phenylmethylsulfonyl fluoride] and placed on ice for 30 min. The lysate was centrifuged at 13 000 r.p.m. at 4°C for 15 min, the supernatant collected (450 µl) and the protein concentration for each sample determined by spectrophotometry (Pharmacia) and using a DC protein assay kit (Bio-Rad). For each specimen protein was extracted twice and loaded separately on a western gel.

Immunoblotting
One hundred micrograms of total protein was size fractionated on a 10% (w/v) SDS–polyacrylamide gel. The distal part of the gel was excised for silver staining to confirm equal loading. The protein was then transferred to a nitrocellulose membrane (Hybond-N; Amersham International) by electroblotting (Bio-Rad). The membrane was blocked with PBS containing 10% non-fat milk for 1 h at room temperature. The primary p73 polyclonal IgG antibody (Santa Cruz Biotechnology) was diluted in PBS containing 1% non-fat milk and incubated with the membrane for 1 h at 4°C. Membranes were washed twice in PBS with 0.1% Tween-20 at room temperature for 1 h. After washing the membranes were incubated with diluted horseradish peroxidase-conjugated rabbit anti-goat antibody. A kaleidoscope prestained standard was used as a size marker (Bio-Rad). Protein bands were visualized with an enhanced chemiluminescence system (ECL; Amersham) according to the manufacturer's instructions.

Band intensity was measured with a Personal Densitometer SI, Dimension 466V (Molecular Dynamics) and the protein level was expressed as the intensity ratio of tumor to normal bands.

Site-directed mutagenesis of p73 cDNA and p21 transactivation
Site-directed mutagenesis was conducted in a plasmid (pcDNA3) containing wild-type p73 cDNA (a gift from Sanofi Recherche) following a previously published protocol (44). The selection primer was pcDNA3-PvuI (CTTCGGTCCTCCGG*TCGTTGTCAGAAGTAAGTTGG). Mutagenic primers were mu349p73 (GGTGTGAAGAAGCGGCGGCAC*GGAGACGAGGACACG), mu469p73 (CGAGATGAGCAGCAGA*CACAGCGCCCA GTCCATGG) and mu477p73 (GTCCATGGTCTG*GGGGTCCCACT GCACTCCGCCACC). The p73 wild-type as well as mutant plasmids containing either one of the two missense or the silent mutations was transfected into H1299 together with a p21 luciferase and RSV-ß gal reporter plasmid. The cells were harvested for ß-galactosidase and luciferase assays 24 h after transfection. ß-Galactosidase activity was measured to monitor and normalize for transfection efficiency. Each experiment was performed in triplicate.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
General characteristics
The cohort consisted of 67 patients with primary laryngeal or oral HNSC. There were 52 men and 15 women, who ranged in age from 27 to 85 years (median 61 years). The tumor sites were categorized as 38 oral and 29 laryngeal. Histologically, 20 tumors were poorly, 33 were moderately and 14 were well differentiated. There were three stage I, 38 stage II, 14 stage III and seven stage IV tumors; in five patient's staging could not be ascertained. Flow cytometric DNA analysis showed 28 (50.9%) aneuploid and 27 (49.1%) diploid tumors. Fifty-two tumors were suitable for S phase analysis; the proliferative activity in these tumors ranged from 4 to 31%, with a mean of 11%.

Table IIGo presents the clinical/pathological information on patients with p73 and chromosome 1p36.3 region alterations (25 cases). Of the 59 samples that were informative for microsatellite markers, 23 (39%) showed loss of heterozygosity (LOH) (Table IIGo and Figure 1Go) at the 1p36.3 locus. The incidence of LOH at the proximal marker (D1S243) was 16% and at the distal markers D1S165, CRTM and FGR were 31, 27 and 33%, respectively. SSCP analysis revealed aberrant bands in three cases; at exon 9 in case 3, at exon 12 in both histologically normal mucosa and matching tumor samples in case 34 (Figure 2Go) and at exon 12 in case 64 (Figure 2Go). Sequence analysis of the forward and reverse strands revealed an AGC->AGA (Ser->Arg) transversion mutation at codon 469 (GCT->TCT) in both normal mucosa and tumor specimen 34 (Figure 3Go); sequencing of constitutional DNA extracted from lymphocytes of each case failed to show any alterations. Sequence analysis of exon 12 in case 64 showed a TCG->TGG (Ser->Trp) mutation at codon 477 (data not shown). A CAT->CAC (His->His) silent mutation at codon 349 of exon 9 was also identified (case 3). In only one case were both mutation at p73 and LOH at 1p36.3 found (case 64). No homozygous deletions were identified.


View this table:
[in this window]
[in a new window]
 
Table II. Clinico-pathological and flow cytometric information on oral and laryngeal carcinomas of cases with p73 gene and/or chromosome 1p36.3 region microsatellite alterations
 


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1. Microsatellite analysis of markers flanking the p73 gene on chromosome 1p36. Examples of loss of heterozygosity in tumor samples are noted in cases 7 (D1S243), 39 (CRTM), 12 (FGR) and 67 (D1S165). An illustration of microsatellite instability is shown in cases 5 (CRTM) and 22 (FGR). Simultaneous LOH and instability are demonstrated in cases 24 and 25 (D1S165).

 


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 2. A PCR-based SSCP of p73 exons. Case 36 represents no changes in both normal and tumor samples. In case 3 the tumor sample shows a loss of the major band of exon 9. In case 34 additional bands for exon 12 in both normal and tumor samples are shown. Case 64 shows an extra band for exon 12 in the tumor sample only.

 


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 3. Sequence analysis in cases with abnormal SSCP bands. Case 34 (top four panels) shows an AGC->AGA alteration at codon 469 in both normal mucosa (N) and tumor samples (T); lymphocytes (L) from the same individual showed retention of the wild-type sequence (panel 4). Sequencing of the reverse strand of the tumor (T) sample confirmed the GCT->TCT transversion mutation (panel 3). In case 3 a silent mutation at codon 349 constituting a CAT->CAC substitution is illustrated in a tumor (T) sample as opposed to normal tissue (N).

 
Transient transfection assays using the p21 promoter to measure activity of the wild-type and mutant p73 plasmids failed to show significant differences in luciferase activity. Results are presented as fold increase over control cells transfected with the control vector pcDNA3 (Figure 4Go). Expression with the silent mutation (32.7-fold above background) as well as with the two transverse mutations (57.6- and 46.2-fold) did not show noticeable elevations in luciferase level as compared with that with wild-type p73 (40.9-fold).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. Wild-type p73 and three p73 mutants transactivate p21 in H1299 cells. The CMV-HA:p73 expression plasmid with or without mutations was transfected into H1299 cells together with p21 luciferase and RSV-ß gal reporter plasmids. Results are depicted graphically as fold increase over control cells transfected with the control vector pcDNA3. The results plotted here are from one experiment performed in triplicate. Error bars indicate the standard deviations.

 
Of the 21 cases for which we carried out protein analyses by western blotting, five (23.8%) had a >=2-fold increase and six (28.5%) had a >=2-fold decrease in tumor protein in comparison with matching histologically normal mucosa. The other 10 samples showed minor differences within 2-fold (Figure 5Go) (38). High quality RNA for RT–PCR analysis was obtained from only 12 tumors. p73 expression showed minor differences between normal and tumor samples. The ratio of p73 band intensity to the internal control IL-1 fell within the range 0.86- to 1.1-fold. Only two cases were analyzed for both protein and RNA expression and these showed concordant results.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5. Immunoblot analysis of p73 protein level in HNSC cases. An increased protein level is noted in tumors 44 and 45 and a low level is seen in case 16 in comparison with the normal mucosal counterpart.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The p73 gene has been considered a candidate tumor suppressor gene because of: (i) its location in a region on chromosome 1p36.3 frequently deleted in certain tumors; (ii) its structural and functional homology with p53; (iii) its imprinting status; (iv) its reduced expression in some tumors. However, its infrequent mutation, biallelic expression and overexpression in other tumor types contraindicate this hypothesis (2,4,11,3538,4142,44,48,49). Because of these variable results the role of the p73 gene in tumorigenesis and its relationship with other members of the p53 family have remained unsettled. Unlike p53 and p61, p73 has not been investigated in HNSC.

Our study shows infrequent mutations of the p73 gene in HNSC, as previously reported in studies of different solid tumors (15,16,26,4044,48). For the first time, however, we have identified two missense and one silent mutation in the coding region of the p73 gene in adult solid tumors other than neuroblastoma. One of these mutations comprised a C->A transversion mutation at codon 469 in both histologically normal mucosa and tumor specimens. Analysis of the DNA extracted from peripheral blood lymphocytes of this patient showed no alteration, excluding a germline origin and supporting a mucosal field effect in this case. A C->G transversion mutation at codon 477 in another case and a silent mutation at codon 349 in a third case were also identified. Both missense mutations were located in the C-terminal domain of the gene. The silent mutation was in close proximity to the previously reported mutations in neuroblastoma and other tumors (41,42,52). This region has recently been shown to possess a transactivation function, which appears to be markedly impaired by naturally occurring mutant forms in neuroblastoma (52). However, a p21 transactivation assay of the three mutants in our study failed to show a significant difference in expression from wild-type p73.

While western blotting results showed variable expression levels in a subset of tumors, our RNA expression analysis of a limited number of cases failed to show similar differences. Only two cases were tested for both protein and RNA expression and both showed concordant results. In our study a low level of p73 expression in some tumors was noted, which is in agreement with a recent study of esophageal squamous cell carcinoma, (41), a tumor with a histogenesis similar to that of HNSC. We also observed overexpression in a few cases, supporting earlier results from different tumor subtypes (15,26,39,43,5254). Along with infrequent mutations of p73 in HNSC and other tumors, these results suggest that an organ- and/or tissue-specific epigenetic or post-transcriptional modification may play a role in the regulation of p73 in a subset of HNSC. This view may be supported by evidence for a restricted and tissue-specific expression pattern of the mouse KET gene (16,28,53), a closely related partner of human p73. We, however, contend that the relatively high frequency of alterations at distal markers in the chromosome 1p36.3 region suggest the presence of a putative suppressor gene that may be relevant to HNSC. In conclusion, our study shows infrequent molecular alterations of the p73 gene in HNSC and that the gene plays a minor role in a subset of these tumors (5560).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6. An illustration of p73 gene expression analysis by RT–PCR. The relative expression of p73 was determined using IL-1 as the internal standard. The intensity ratio of p73 to IL-1 is increased in tumor cases 18–20 and 34 but decreased in 29, 39 and 45 in comparison with the matching normal sample. The ratio range is from 0.86 to 1.1. C1, control IL-1; C2, case 18 normal p73 cDNA as size reference.

 

    Notes
 
5 To whom correspondence should be addressed at: Department of Pathology, Box 85, The University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030, USA Email: anaggar{at}notes.mdacc.tmc.edu Back


    Acknowledgments
 
The authors are grateful to Sue M.Martinez for secretarial assistance. This study was supported in part by Oral Cancer Center of Excellence Grant 1P50D1190601, the M.D. Anderson Tobacco Settlement Research Initiatives Program and the Kenneth D.Müller Professorship (A.E.N.).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. DeVesa,S.S., Blot,W.J., Stone,B.J., Miller,B.A., Tarone,R.E. and Fraumeni,J.F. (1995) Recent cancer trends in the United States. J. Natl Cancer Inst., 87, 175–182.[Abstract/Free Full Text]
  2. Parker,S.L., Tong,T., Bolden,S. and Wingo,P. (1997) Cancer statistics. CA Cancer J. Clin., 47, 5–27.[Web of Science][Medline]
  3. Landis,S.H., Murray,T., Bolden,S. and Wingo,P.A. (1999) Cancer Statistics. CA Cancer J. Clin., 48, 8–31.
  4. Snow,G.B. (1989) Evaluation and staging of patients with head and neck cancer. In Myers E.N. and Suen,J.Y. (eds), Cancer of Head and Neck, 2nd Edn. Churchill Livingstone, New York, NY, pp. 17–38.
  5. Beckhardt,R.N., Kiyokawa,N., Xi,L., Lie,T.-J., Hung,M.C., El-Naggar,A.K., Zhang,H.-Z. and Clayman,G.L. (1995) HER-2/neu oncogene characterization in head and neck squamous cell carcinoma. Arch. Otolaryngol. Head Neck Surg., 121, 1265–1270.
  6. Klijanienko,J., El-Naggar,A.K., de Brand,F., Rodriquez-Peralto,J.-L., Rodriquez,R., Itzhaki,M., Russo,A., Janot,F., Luboinski,B. and Cvitkovic,E. (1995) Tumor vascularization, mitotic index, histopathologic grade and DNA ploidy in the assessment of 114 head and neck squamous cell carcinoma. Cancer, 75, 1649–1656.[Web of Science][Medline]
  7. Jin,Y.-T., Kayser,S., Kemp,B.L., Ordonez,N.G., Tucker,S.L., Clayman,G.L., Goepfert,H., Luna,M.A., Batsakis,J.G. and El-Naggar,A.K. (1998) The prognostic significance of the biomarkers p21WAF1/CIP1, p53, and bcl-2 in laryngeal squamous cell carcinoma. Cancer, 82, 2159–2165.[Web of Science][Medline]
  8. Ah-See,K.W., Cooke,T.G., Pickford,I.R., Soutar,D. and Balmain,A. (1994) An allelotype of squamous carcinoma of the head and neck using microsatellite marker. Cancer Res., 54, 1617–1621.[Abstract/Free Full Text]
  9. Califano,C.J., van der Riet,P., Westra,W., Nawroz,H., Clayman,G., Piantadosi,S., Corio,R., Lee,D., Greeberg,B., Kock,W. and Sidransky,D. (1996) Genetic progression model of head and neck cancer: implications for field cancerization. Cancer Res., 56, 2488–2492.[Abstract/Free Full Text]
  10. El-Naggar,A.K., Hurr,K., Batsakis,J.G., Luna,M.A., Goepfert,H. and Huff,V. (1995) Sequential loss of heterozygosity at microsatellite motifs in preinvasive and invasive head and neck squamous carcinoma. Cancer Res., 5, 2656–2659.
  11. Nawroz,H., van der Riet,P., Hruban,R.H., Koch,W., Ruppert,J.M. and Sidransky,D. (1994) Allelotype of head and neck squamous cell carcinoma. Cancer Res., 54, 1152–1155.[Abstract/Free Full Text]
  12. El-Naggar,A.K., Lai,S., Luna,M.A., Zhou,X.D., Weber,R.S., Goepfert,H. and Batsakis,J.G. (1995) Sequential p53 mutation analysis of pre-invasive and invasive head and neck squamous cell carcinoma. Int. J. Cancer, 64, 196–201.[Web of Science][Medline]
  13. Brennan,J.A., Boyle,J.O., Koch,W.M., Goodman,S.N., Hruban,R.H., Eby,Y.J., Cough,M.J., Forastiere,A.A. and Sidransky,D. (1995) Association between cigarette smoking and mutation of the p53 gene in squamous-cell carcinoma of the head and neck. N. Engl. J. Med., 332, 712–717.[Abstract/Free Full Text]
  14. Field,J.K., Zoumpourlis,V., Spandidos,D.A. and Jones,A.S. (1994) p53 expression and mutations in squamous cell carcinoma of the head and neck: expression correlates with the patients' use of tobacco and alcohol. Cancer Detect. Prev., 18, 197–208.[Web of Science][Medline]
  15. Kaghad,M., Bonnet,H., Yang,A., Creancier,L., Biscan,J.C., Valent,A., Minty,A., Chalon,P., Lelias,J.M., Dumont,X., Ferrara,P., McKeon,F. and Caput,D. (1997) Monallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell, 90, 809–819.[Web of Science][Medline]
  16. Osada,M., Ohba,M., Kawahara,C., Ishioka,C., Kanamaru,R., Katoh,I., Ikawa,Y., Nimura,Y., Nakagawara,A., Obinato,M. and Ikawa,S. (1998) Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nature Med., 4, 839–843.[Web of Science][Medline]
  17. Trink,B., Okami,K., Wu,L., Sriuranpong,V., Jen,J. and Sidransky,D. (1998) A new human p53 homologue. Nature Med., 4, 747–748.[Web of Science][Medline]
  18. Kaelin,W.G (1998) Another p53 Doppelgánger? Science, 281, 57–58.[Free Full Text]
  19. Mori,N., Morosetti,R., Spira,S., Lee,S., Ben-Yehuda,D., Schiller,G., Landolfi,R., Mizoguchi,H. and Koeffler,H.P. (1998) Chromosome band 1p36 contains a putative tumor suppressor gene important in the evolution of chronic myelocytic leukemia. Blood, 92, 3405–3409.[Abstract/Free Full Text]
  20. Levrero,M., DeLaurenzi,V., Costanzo,A., Sabatini,S. and Gong,J. (2000) The p53/p63/p73 family of transcription factors: overlapping and distinct functions. J. Cell Sci., 113, 1661–1670.[Abstract]
  21. White,P.S., Maris,J.M., Sulman,E.P., Jensen,S.J., Kyemba,S.M., Beltinger,C.P., Allen,C., Kramer,D.L., Biegel,J.A. and Brodeur,G.M. (1997) Molecular analysis of the region of distal 1p commonly deleted in neuroblastoma. Eur. J. Cancer, 33, 1957–1961.
  22. Cunsolo,C.L., Casciano,I., Banelli,B., Tonini,G.P. and Romani,M. (1998) Refined chromosomal localization of the putative tumor suppressor gene TP73. Cytogenet. Cell Genet., 82, 199–201.[Web of Science][Medline]
  23. Onyango,P., Lubyova,B., Gardellin,P., Kurzbauer,R. and Weith,A. (1998) Molecular cloning and expression analysis of five novel genes in chromosome 1p36. Genomics, 50, 187–198.[Web of Science][Medline]
  24. Vance,J.M., Matise,T.C., Wooster,R., Schutte,B.C., Bruns,G.A.P., vanRoy,N., Brodeur,G.M., Tao,Y.X., Gregory,S., Weith,A., Vaudin,M. and White,P. (1997) Report and abstracts of the Third International Workshop on Human Chromosome 1 Mapping 1997. Cytogenet. Cell Genet., 78, 153–182.
  25. Dickman,S. (1997) First p53 relative may be a new tumor suppressor. Science, 277, 1605.[Free Full Text]
  26. Kaelin,W.G. (1999) The emerging p53 gene family. J. Natl Cancer Inst., 91, 594–598.[Abstract/Free Full Text]
  27. Oren,M. (1997) Lonely no more: p53 finds its kin in a tumor suppressor haven. Cell, 90, 829–832.[Web of Science][Medline]
  28. Prives,C. and Hall,P.A. (1999) The p53 pathway. J. Pathol., 187, 112–126.[Web of Science][Medline]
  29. Zaika,A.I., Kovalev,S., Marchenko,N.D. and Moll,U.M. (1999) Overexpression of the wild type p73 gene in breast cancer tissues and cell lines. Cancer Res., 59, 3257–3263.[Abstract/Free Full Text]
  30. DeLaurenzi,V., Costanzo,A., Barcaroli,D., Terrinoni,A., Falco,M., Annicchiarico-Petruzzelli,M., Levrero,M. and Melino,G. (1998) Two new p73 splice variants, gamma and delta, with different transcriptional activity. J. Exp. Med., 188, 1763–1768.[Abstract/Free Full Text]
  31. Di Como,C.J., Gaiddon,C. and Prives,C. (1999) p73 function is inhibited by tumor-derived p53 mutants in mammalian cells. Mol. Cell. Biol., 19, 1438–1449.[Abstract/Free Full Text]
  32. Zeng,X., Chen,L., Jost,C.A., Maya,R., Keller,D., Wang,X., Kaelin,W.G., Oren,M., Chen,J. and Lu,H. (1999) MDM2 suppresses p73 function without promoting p73 degradation. Mol. Cell. Biol., 19, 3257–3266.[Abstract/Free Full Text]
  33. Jost,C.A., Marin,M.C. and Kaelin,W.G (1997) p73 is a human p53-related protein that can induce apoptosis. Nature, 389, 191–194.[Medline]
  34. Takahashi,H., Ichimiya,S., Nimura,Y., Watanable,M., Furusato,M., Wakui,S., Yatani,R., Aizawa,S. and Nakagawara,A. (1998) Mutation, allelotyping and transcription analysis of the p73 gene in prostatic carcinoma. Cancer Res., 58, 2076–2077.[Abstract/Free Full Text]
  35. Marin,M.C., Jost,C.A., DeCaprio,J.A., Caput,D. and Kaelin,W.G.Jr (1998) Viral oncoproteins discriminate between p53 and the p53 homolog p73. Mol. Cell. Biol., 18, 6316–6324.[Abstract/Free Full Text]
  36. Prabhu,N., Somasundaran,K., Satyamoorthy,K., Herlyn,M. and El Deiry, W.S. (1998) P73 beta, unlike p53, suppress growth and induces apoptosis of human papillomavirus E6 expressing cancer cells. Int. J. Oncol., 13, 5–9.[Web of Science][Medline]
  37. Roth,J., Konig,C., Wienzek,S., Weigel,S., Ristea,S. and Dobbelstein,M. (1998) Inactivation of p53 but not p73 by adenovirus type 5 E1B 55-kilodalton and E4 34-kilodalton oncoptoteins. J. Virol., 72, 8510–8516.[Abstract/Free Full Text]
  38. Steegenga,W.T., Shvarts,A., Riteco,N., Bos,J.L. and Jochemsen,A.G. (1999) Distinct regulation of p53 and p73 activity by adenovirus E1A, E1B and E4orf6 proteins. Mol. Cell. Biol., 19, 3885–3894.[Abstract/Free Full Text]
  39. Chi,S.-G., Chang,S.-G., Lee,S.-J., Lee,C.-H., Kim,J.L. and Park,J.-H. (1999) Elevated and biallelic expression of p73 is associated with progression of human bladder cancer. Cancer Res., 59, 2791–2793.[Abstract/Free Full Text]
  40. Kovalev,S., Marchenko,N., Swendeman,S., La Quaglia,M. and Moll,U.M. (1998) Expression level, allelic origin and mutation analysis of the p73 gene in neuroblastoma tumors and cell lines. Cell Growth Differ., 9, 897–903.[Abstract]
  41. Nimura,Y., Mihara,M., Ichimiya,S., Sakiyama,S., Seki,N., Ohira,M., Nomura,N., Fujimori,M., Adachi,W., Amano,J., He,M., Ping,Y.-M. and Nakagawara,A. (1998) P73, a gene related to p53, is not mutated in esophageal carcinomas. Int. J. Cancer, 78, 437–440.[Web of Science][Medline]
  42. Tsao,H., Zhang,X., Majewski,P. and Haluska,F.G. (1999) Mutational and expression analysis of the p73 gene in melanoma cell lines. Cancer Res., 59, 172–174.[Abstract/Free Full Text]
  43. Yokomizo,A., Mai,M., Bostwick,D.G., Tindall,D.J., Qian,J., Cheng,L., Jenkins,R.B., Smith,D.I. and Liu,W. (1999) Mutation and expression analysis of the p73 gene in prostate cancer. Prostate, 39, 94–100.[Web of Science][Medline]
  44. Zaika,A.I., Sovalev,S., Marchenko,N.D. and Moll,U.M. (1999) Overexpression of the wild type p73 gene in breast cancer tissues and cell lines. Cancer Res., 59, 3257–3263.
  45. Cai,Y.C., Yang,G.-Y., Nie,Y., Wang,L.-D., Zhao,X., Song,Y.-L., Seri,D.N., Liao,J., Xing,E.P. and Yang,C.S. (2000) Molecular alterations of p73 in human esophageal squamous cell carcinomas: loss of heterozygosity occurs frequently; loss of imprinting and elevation of p73 expression may be related to defective p53. Carcinogenesis, 21, 683–689.[Abstract/Free Full Text]
  46. Deng,W.P. and Nickoloff,J.A. (1992) Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal. Biochem., 200, 81–88.[Web of Science][Medline]
  47. Banelli,B., Casciano,I. and Romani,M. (2000) Methylation silencing of the p73 gene in neuroblastoma. Oncogene, 19, 4553–4556.[Web of Science][Medline]
  48. Perri,P., Praml,C., Savelyeva,L., Pillmann,A. and Schwab,M. (1999) Fine mapping of distal 1p loci reveals tp73 at DIS468. Cytogenet. Cell Genet., 84, 111–114.[Web of Science][Medline]
  49. Ichimiya,S., Nimura,Y., Kageyama,H., Takada,N., Sunahara,M., Shishikura,T., Nakamura,Y., Sakiyama,S., Seki,N., Ohira,M., Kaneko,Y., McKeon,F., Caput,D. and Nakagawara,A. (1999) p73 at chromosome 1p36.3 is lost in advanced stage neuroblastoma but its mutation is infrequent. Oncogene, 18, 1061–1066.[Web of Science][Medline]
  50. Mai,M., Huang,H., Reed,C., Qian,C., Smith,J.S., Alderete,B., Jenkins,R., Smith,D.I. and Liu,W. (1998) Genomic organization and mutation analysis of p73 in oligodendrogliomas with chromosome 1p-arm deletions. Genomics, 51, 359–363.[Web of Science][Medline]
  51. Mai,M., Yokomizo,A., Qian,C., Yang,P., Tindall,D.J., Smith,D.I. and Liu,W. (1998) Activation of p73 silent allele in lung cancer. Cancer Res., 58, 2347–2349.[Abstract/Free Full Text]
  52. Takada,N., Ozaki,T., Ichimiga,S., Todo,S. and Nakagawara,A. (1999) Identification of a transactivation activity in the COOH-terminal region of p73 which is impaired in the naturally occurring mutants found in human neuroblastomas. Cancer Res., 59, 2810–2814.[Abstract/Free Full Text]
  53. Nomoto,S., Haruki,N., Kondo,M., Konishi,H., Takahashi,T., Takahashi,T. and Takahashi,T. (1998) Search for mutations and examination of allelic expression imbalance of the p73 gene at 1p36.33 in human lung cancers. Cancer Res., 58, 1380–1383.[Abstract/Free Full Text]
  54. Sunahara,M., Ichimiya,S., Nimura,Y., Takada,N., Sakiyama,S., Sato,Y., Todo,S., Adachi,W., Amano,J. and Nakagawara,A. (1998) Mutational analysis of the p73 gene localized at chromosome 1p36.3 in colorectal carcinoma. Int. J. Oncol., 13, 319–323.[Web of Science][Medline]
  55. Mai,M., Qian,C., Yokomizo,A., Tindall,D.J., Bostwick,D., Polychronakos,C., Smith,D.I. and Liu,W. (1998) Loss of imprinting and allele switching of p73 in renal cell carcinoma. Oncogene, 17, 1739–1741.[Web of Science][Medline]
  56. Yokomizo,A., Mai,M., Tindall,D.J., Cheng,L., Bostwick,D.G., Naito,S., Smith,D.I. and Liu,W. (1999) Overexpression of the wild type p73 gene in human bladder cancer. Oncogene, 18, 1629–1633.[Web of Science][Medline]
  57. Senoo,M., Seki,N., Ohira,M., Sugano,S., Watanable,M., Inuzuka,S., Okamoto,T., Tachibana,M., Tanaka,T., Shinkai,Y. and Kato,H. (1998) A second p53-related protein, p74L, with high homology to p73. Biochem. Biophys. Res. Commun., 248, 603–307.[Web of Science][Medline]
  58. Kong,X.-T., Valentine,V.A., Rowe,S.T., Valentine,M.B., Ragsdale,S.T., Jones,B.G., Wilkinson,D.A., Brodeur,G.M., Cohn,S.L. and Look,A.T. (1999) Lack of homozygously inactivated p73 in single-copy MYCN primary neuroblastomas and cell lines. Neoplasia, 1, 80–89.[Medline]
  59. El-Naggar,A.K., Lai,S., Clayman,G., Lee,J.K., Luna,M.A., Goepfert,H. and Batsakis,J.G. (1997) Methylation: a major mechanism of p16/CDKN2 gene inactivation in head and neck squamous carcinoma. Am. J. Pathol., 151, 1767–1774.[Abstract]
  60. Herman,J.G., Merlo,A., Mao,L., Lapidus,R.G., Issa,J.P.J., Davidson,N.E., Sidransky,D. and Baylin,S.B. (1995) Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res., 55, 4525–4530.[Abstract/Free Full Text]
Received August 25, 2000; revised October 31, 2000; accepted November 9, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
W. H. Toh, S. Kyo, and K. Sabapathy
Relief of p53-mediated Telomerase Suppression by p73
J. Biol. Chem., April 29, 2005; 280(17): 17329 - 17338.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by El-Naggar, A. K.
Right arrow Articles by Lozano, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by El-Naggar, A. K.
Right arrow Articles by Lozano, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?