Carcinogenesis, Vol. 23, No. 1, 81-86,
January 2002
© 2002 Oxford University Press
CANCER BIOLOGY |
Metallothionein 2A expression is associated with cell proliferation in breast cancer
1 Anatomy Department,
2 Microbiology Department and
3 Biochemistry Department, National University of Singapore, 4 Medical Drive, S117 597, Singapore and
4 Pathology Department, Singapore General Hospital, Outram Road, S169 608, Singapore
| Abstract |
|---|
|
|
|---|
Metallothioneins (MTs) belong to a family of cysteine-rich, metal-binding intracellular proteins, which have been linked with cell proliferation. In this study, expression levels of the 8 known MT-1 and MT-2 functional isoforms in human invasive ductal breast cancer specimens were determined by RTPCR. The expression profiles of the MT protein and MT-2A mRNA were further evaluated in 79 cases of human invasive ductal breast carcinoma by immunohistochemistry and in situ hybridization, and correlated with cancer cell proliferation (determined by Ki-67 nuclear antigen immunolabeling). MT-1A, MT-1E, MT-1F, MT-1G, MT-1H, MT-1X and MT-2A but not MT-1B, were detected in breast cancer tissue samples. The MT-2A mRNA transcript was the highest among all the isoforms detected. A positive correlation was observed between MT-2A mRNA and MT protein expression with Ki-67 labeling (P = 0.0003 and P < 0.0001, respectively) but not with apoptosis (P = 0.1244 and P = 0.8189, respectively). Co-localization of the MT protein and Ki-67 nuclear antigen in breast cancer cells was demonstrated by double immunofluorescence staining. There was also significantly higher MT protein and MT-2A mRNA expression in histological grade 3 tumors than in histological grade 1 and 2 tumors. The finding that MT 2A appears to be the main isoform associated with cell proliferation in invasive ductal breast cancer tissues, may have therapeutic implications.
Abbreviations: MT, metallothionein; IPS, intensity percentage score; KI,67 labeling index; RTPCR, reverse transcriptionpolymerase chain reaction
| Introduction |
|---|
|
|
|---|
Metallothioneins (MTs) are ubiquitous, low molecular mass metal-binding proteins. In humans, functional MT isoforms are encoded by 10 genes (14). The induction of the different MT isoforms has been shown to be dependent on the cell type and to be specifically regulated (5,6). Known functions of MTs include metalloregulatory roles in cell growth and differentiation (7,8). High levels of MT gene expression have been detected during the late stages of gestation and neonatal periods (9). Enhanced synthesis of MT in rapidly proliferating tissues appears to suggest its crucial role in normal and neoplastic cell growth (10). Recently, Abdel-Mageed and Agrawal demonstrated that down-regulation of metallothionein-2A induces growth arrest in the MCF7 human breast cancer cell line (11), suggesting the close involvement of MT-2A isoform in the proliferative activity of breast cancer cells. However, there is a lack of data on the role of the MT-2A mRNA isoform in clinical breast cancer tissue samples.
MT overexpression has been well documented in breast cancers by immunohistochemical analysis using the commercially available anti-MT E9 antibody which reacts with both MT-1 and MT-2 epitopes (1214). However, there are no readily available antibodies for distinguishing the highly homologous protein isoforms of MT. We have previously reported that MT-2A mRNA expression was the highest among 3 MT isoforms examined (MT-1E, MT-1F and MT-2A) in normal breast and cancer tissues (15). In this study, our aim was to analyze the expression of all functional MT-1 and MT-2 isoforms in breast cancer tissues and explore the relationship of MT-2A mRNA expression with cell proliferation and clinico-pathologic parameters.
| Materials and methods |
|---|
|
|
|---|
Sample collection
Seventy-nine invasive ductal breast cancer tissues were obtained at surgery. All the tissues were fixed in 10% formalin and embedded in paraffin. Among the 79 cases, a subset of fresh tissues from 51 patients were also snap-frozen, and stored in liquid nitrogen for RTPCR analysis of mRNA.
Immunohistochemistry
Immunohistochemical detection of MT proteins in formalin-fixed paraffin-embedded tissue sections was performed as described previously (15,16). Briefly, 5 µm sections were deparaffinized and rehydrated. Endogenous peroxidase was blocked by 0.5% hydrogen peroxide in methanol for 15 min. After incubation in normal horse serum for 1 h at room temperature, sections were incubated overnight at 4°C using a 1:600 dilution of the primary antibody E9 (Dako Corporation, Carpinteria, CA, USA). Visualization was achieved by the avidinbiotin-complex technique (ABC kit, Vector Laboratories, Burlingame, CA, USA) using diaminobenzidine (DAB) as substrate. The sections were then counterstained with methyl green. MT immunopositivity was expressed as intensity percentage score (IPS) (16), where IPS = staining intensity x percentage of immunopositive cells. Staining intensity was designated as weak staining: 1; moderate staining: 2; and strong staining: 3. The percentage of MT-positive cells was counted under a light microscope with a 40x objective. A total of 10 high-power fields were randomly chosen. For Ki-67 immunolabeling, antigen retrieval was facilitated by heating in citrate buffer (pH 6.0) for 20 min before quenching of endogenous peroxidase. After incubation in normal goat serum for 1 h, sections were then incubated for 2 h with rabbit polyclonal antibody (Dako) at 1:50 dilution. The rest of the steps were similar to the protocol for MT immunohistochemistry. Ki-67 staining was considered positive when the nuclei of tumor cells were stained prominently brown. The Ki-67 labeling index (KI) was calculated as a percentage of immunopositive cells. For both MT and Ki-67 immunolabeling, negative controls were included by omitting the primary antibody, and positive controls inserted by including a known positive with each batch.
Immunofluorescence staining
Immunofluorescence staining demonstrating the co-localization of the MT protein with Ki-67 antigen was performed on five paraffin-embedded tissue sections. The procedure was similar to that described for immunohistochemistry except that FITC-conjugated secondary anti-mouse antibody at a dilution of 1:200 (to detect the MT primary antibody) and Cy3-conjugated secondary anti-rabbit antibody at a dilution of 1:800 (for the detection of primary anti-Ki-67 antibody) were applied for 1 h at room temperature. After washing in PBS, the sections were mounted with fluorescence mounting media (DAKO). Stained sections were viewed and photographed using the LSM 510 Carl Zeiss confocal laser scanning microscope. Excitation wavelength for Cy3 was at 543 nm and for FITC at 488 nm.
RNA extraction
Briefly, total RNA was isolated using the RNeasy Mini kit (QIAGEN, Hilden, Germany) following the manufacturer's protocol. The concentration and purity of the extracted RNA were evaluated by spectrophotometric absorbance readings at 260 and 280 nm.
RTPCR analysis
RTPCR analysis was performed as previously described (15,17). Total RNA was reverse-transcribed using Superscript II RNase H- reverse transcriptase (Life Technologies, Gaithersburg, MD, USA). The cDNA products were aliquoted and kept in 20°C for PCR analysis. Each cDNA sample equivalent to about 80 ng of total RNA was then used for each PCR amplification. The specific primer pairs for individual MT isoforms were adapted from Mididoddi et al. (4). PCR conditions were optimized by adjusting the annealing temperature. A prior PCR cycle optimization was conducted to ensure that all the reactions remained in the linear region. Annealing temperatures and cycle numbers for the individual isoforms are listed in Table I
. A three-step cycle was used, i.e. denaturation at 95°C for 30 s, annealing at individual temperature for 30 s and elongation at 72°C for 30 s. The initial step was 95°C for 1 min, with a final elongation step of 72°C for 7 min. The resultant PCR products were electrophoresed in 1.6% agarose gels containing ethidium bromide together with DNA markers, visualized under UV, and analyzed by densitometric scanning (Bio-Rad model GS-700 Imaging Densitometer) using the Molecular Analyst Software (Bio-Rad Laboratories version 1.5). At least two independent PCRs were performed to control for variations between experiments. A `no-template' control in which water was added instead of RNA, and a `no-reverse transcriptase' control in which water replaced the enzyme were included for each PCR batch. For semi-quantitative analysis, mRNA of the housekeeping glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene was co-amplified using the amplimers described by Abdel-Mageed and Agrawal (11). The relative expression levels of each MT isoform compared with G3PDH gene expression were determined. Strict precautions were adopted to avoid contamination with `carryover' DNA. For verification of the specificity of the MT-2A isoform, representative PCR products were reconfirmed by digestion with restriction endonucleases BglI and EarI (New England BioLabs, Beverly, MA, USA).
|
In situ hybridization
In situ hybridization of MT-2A mRNA was performed as previously described (15) using HPLC-purified oligonucleotide probes labeled with digoxigenin by the DIG Oligonucleotide Tailing Kit (Boehringer Mannheim, Germany). Both antisense and sense probes corresponding to nucleotides 1528-1572 of MT-2A were used, viz, antisense oligo-DNA probe 5 2GTGGAAGTCGCGTTCTTTACATCTGGGAGCGGGGCTG TCCCAGCA 3 2) and sense oligo-DNA probe (5 2TGCTGGGACAGCCCCGCTCCCAGATGTAAAGAA CGCGACTTCCAC3 2). Five micron-thick paraffin sections were mounted on slides coated with 3-aminopropyltriethoxylsilane (Sigma, St Louis, MO, USA), dewaxed, and rehydrated. These sections were treated with 0.2 M hydrochloric acid (room temperature for 15 min) and 1 µg/ml of proteinase K (37°C for 15 min) before post-fixation with 4% paraformaldehyde in PBS (20 min) and immersing in 2 mg/ml glycine in PBS (15 min). After washing with PBST (0.1% Tween 20 in PBS), sections were pre-hybridized in hybridization solution (Dako) for 2 h (42°C). Hybridization was carried out with 11.5 µg/ml DIG-labeled oligo-DNA probes in the hybridization solution overnight at 42°C. After a series of washing steps with SSC/Tween 20 (1 x SSC: 0.15 M sodium chloride, 15 mM sodium citrate, pH 7.0), PBST, and maleic acid buffer (pH 7.5), sections were incubated with 10% blocking solution (Boehringer Mannheim, Germany) in maleic acid buffer for >1 h before treatment with 1:1500 DIGAP (alkaline phosphatase conjugated with sheep anti-digoxigenin Fab fragments, Digoxigenin Detection Kit, Boehringer Mannheim) in 5% blocking solution at 4°C overnight. After extensive washing, the signals were detected by enzyme-immunohistochemistry using NBT/BCIP (Boehringer Mannheim) as substrate. No counter-staining was carried out. Slides were mounted with aqua-mount medium. Controls were performed by omission of probe from the hybridization solution, use of sense probe, and treatment with RNase (100 µg/ml, 37°C, 1 h) before the post-fixation step.
TUNEL procedure
Apoptotic cells in paraffin sections were detected by the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP Nick End Labeling (TUNEL) method using the TdT-FragELTM DNA Fragmentation Detection kit (Oncogene Research Products, Cambridge, USA) and following the manufacturer's instructions. Briefly, slides were permeabilized in 20 µg/ml proteinase K after deparaffinization and rehydration. Endogenous peroxidase was inactivated by treating with 3% hydrogen peroxide. After equilibration, the sections were end-labeled with biotinylated dNTP by TdT for 2 h at 37°C, and labeled cells were detected using streptavidin-horseradish peroxidase conjugate. The chromogen substrate DAB reacts with the labeled sample to generate a brown-colored substrate at the site of DNA fragmentation. Finally, the sections were counterstained with methyl green. Positive and negative control slides supplied in the kit were included in each run. HL60 promyelocytic leukemia cells induced to undergo apoptosis with 0.5 µg/ml actinomycin D served as positive controls, while negative controls were untreated HL60 cells. The apoptotic index (AI) was expressed as the percentage of positive cancer cells.
Statistical analysis
The data were analyzed using the Graphpad Prism software package. The Student's t-test was performed to compare sample means and Pearson's correlation was used to analyze the relationship between variables.
| Results |
|---|
|
|
|---|
MT protein and MT mRNA isoform expression
The MT protein was immunohistochemically detected in all the 79 samples. Immunostaining was observed in cancer cells and in the few myoepithelial cells that were present in residual benign acini surrounding the tumor. Both cytoplasmic and/or nuclear staining of the cancer cells was observed with no preponderance of any staining pattern (Figure 1A and B
|
|
|
Relationship between MT expression and KI
The percentage of Ki-67 immunopositivity in the breast cancer tissues (Figure 1C and D
|
Relationship between MT expression and AI
The percentage of apoptotic cancer cells ranged from 0.16 to 9.77% with a mean of 1.24 ± 0.19%. However, there was no correlation between AI with MT protein (r = 0.03187, P = 0.8189) or with MT-2A mRNA expression (r = 0.2180, P = 0.1244).
MT expression and clinico-pathological parameters
The association between MT-2A gene transcript, MT protein expression and clinico-pathological factors is shown in Table II
and Table III
. A statistically significant difference between histological grade 1 or 2 tumors and grade 3 tumors was found both at MT-2A mRNA level (P = 0.022) and MT protein level (P < 0.001), with histological grade 3 tumors having higher MT expression levels. There were no other significant relationships observed with regard to the age of patients and lymph node status.
|
|
| Discussion |
|---|
|
|
|---|
Cell proliferation is a fundamental process integral to carcinogenesis. There are a multitude of factors known to regulate cell proliferation in breast cancer. Overexpression of c-erbB2 (HER-2/neu), a 185 kd surface membrane protein belonging to the tyrosine kinase family, is associated with the activation of signal transduction pathways, which initiate cell cycle traversal and differentiation (1820). Mutant p53 (21,22), P-glycoprotein (23), DNA-topoisomerase II-alpha (24), cathepsin D (25) and telomerase activity (26) have all been reported to be positively associated with cell proliferation in breast cancer. On the other hand, bcl-2 and BRCA1 immunoexpression have been observed to be inversely correlated with the rate of cell proliferation in breast cancer (22,27,28).
MT has also been implicated in cancer cell proliferation. MT overexpression has been linked with enhanced cell proliferation in squamous cell carcinoma of the esophagus (29), uterine cervical squamous tumor (30), ovarian cancer (31), breast cancer (32,33) and nasopharyngeal cancer (8). We found here a significant correlation of the Ki-67 index (a reliable and reproducible marker for cell proliferative activity) (34) with MT protein expression, thus supporting the role of MT in cell proliferation in breast cancer as well as in other reported tumors.
In this study, the MT-2A isoform was observed to be the main MT isoform in breast cancer tissues. The amounts of MT-2A mRNA correlated with Ki-67 immunolabeling, suggesting that MT-2A is the main MT isoform involved in cell proliferation. The results confirm at the tissue level, the observation of Abdel-Mageed and Agrawal that overexpression of MT-2A promoted cell proliferation in MCF7 breast cancer cells (11).
There are two possible mechanisms by which MT could influence cell proliferation. The MT protein could supply zinc ions to enzymes such as DNA and RNA polymerases, which are critical in cell replication processes (35). There is experimental evidence that zinc ions are transferred between MT and zinc proteins (36,37). Another possibility is that MT directly interacts with transcription factors involved in the intricate signaling mechanisms that stimulate cell proliferation. Abdel-Mageed and Agrawal found a direct interaction of MT with the p50 subunit of NF
B, which is a heterodimeric sequence-specific transcriptional activator (38). Tumor histological grade is determined by a combination of factors, including cell differentiation (represented by tubule formation), nuclear pleomorphism and mitotic activity (39). The significantly higher MT protein and MT-2A mRNA amounts in histological grade 3 tumors compared with those in histological grade 1 or 2 tumors also lend credence to the role of MT in cell proliferation and the progression of breast tumors.
Since MT possesses antioxidant properties that protect cells from free radical-induced apoptosis, its involvement in cancer cell apoptosis has also been suggested. Cai et al. (40) have reported an inverse relationship between MT and apoptosis in hepatocellular carcinoma, whereas Zhang and Takenaka (41) observed increased incidence of apoptosis with increasing immunoreactivity of MT in renal cell carcinoma. An inverse correlation between apoptosis and MT immunoreactivity in nasopharyngeal carcinoma has also been recently reported. (42). In the present study, we have demonstrated that MT expression both at MT protein and MT-2A mRNA levels, were not significantly related to apoptotic indices in invasive ductal breast cancer, suggesting that MT-2A is closely related to breast cancer cell proliferation rather than apoptosis.
There also appears to be a linkage between MT and the p53 tumor suppressor gene, an established tumor marker in breast cancer. Mutations of the p53 gene are known to result in loss of its tumor suppressing function (43), thus promoting tumorigenesis (44,45). Other than p53 inactivation via gene mutation, there is evidence that wildtype p53 may be functionally inactivated by viral products and endogenous cellular mechanisms (46). It has also been reported that MT is capable of modulating p53 transcriptional activity (47). ApoMT (metal-free MT) has the potential to remove zinc from p53 (48,49) and hence inactivate the p53 gene via modulation of the p53 protein conformation consequent to zinc chelation (50). This suggests that apo-MT could promote cell growth through induction of a p53-null state.
To our knowledge, this is the first report to demonstrate a significant correlation between MT-2A mRNA expression with cell proliferation in surgically excised breast cancers. Further investigation of the biochemical and cell biological mechanisms underlying the role(s) of the MT-2A isoform in breast cancer tumorigenesis and progression, would provide valuable information useful in the design of therapeutic strategies that target cell proliferation.
| Notes |
|---|
5 To whom correspondence should be addressed Email: antbaybh{at}nus.edu.sg
| Acknowledgments |
|---|
The authors thank the National Cancer Center (Singapore) for the collection of breast cancer tissues and Mr Wee-Ming Yeo for technical assistance. This work was supported by a grant from the National Medical Research Council (Singapore) (Grant 0244/97) and grant 0554/2001. R.J. was the recipient of a Research Scholarship from the National University of Singapore.
| References |
|---|
|
|
|---|
- Stennard,F.A., Holloway,A.F., Hamilton,J. and West,A.K. (1994) Characterisation of six additional human metallothionein genes. Biochim. Biophys. Acta, 1218, 357365.[Medline]
- Quaife,C.J., Findley,S.D., Erickson,J.C., Froelick,G.J., Kelly,E.J., Zambrowicz,B.P. and Palmiter,R.D. (1994) Induction of a new metallothionein isoform (MT-IV) occurs during differentiation of stratified squamous epithelia. Biochemistry, 33, 72507259.[Medline]
-
Palmiter,R.D., Findley,S.D., Whitmore,T.E. and Durnam,D.M. (1992) MT-III, a brain-specific member of the metallothionein gene family. Proc. Natl Acad. Sci. USA, 89, 63336337.
[Abstract/Free Full Text] - Mididoddi,S., McGuirt,J.P., Sens,M.A., Todd,J.H. and Sens,D.A. (1996) Isoform-specific expression of metallothionein mRNA in the developing and adult human kidney. Toxicol. Lett., 85, 727.
- Cavigelli,M., Kagi,J.H. and Hunziker,P.E. (1993) Cell- and inducer-specific accretion of human isometallothioneins. Biochem. J., 292, 551554.
-
Jahroudi,N., Foster,R., Price-Haughey,J., Beitel,G. and Gedamu,L. (1990) Cell-type specific and differential regulation of the human metallothionein genes. Correlation with DNA methylation and chromatin structure. J. Biol. Chem., 265, 65066511.
[Abstract/Free Full Text] - Kagi,J.H. and Schaffer,A. (1988) Biochemistry of metallothionein. Biochemistry, 27, 85098515.[Medline]
-
Jayasurya,A., Bay,B.H., Yap,W.M., Tan,N.G. and Tan,B.K.H. (2000) Proliferative potential in nasopharyngeal carcinoma: correlations with metallothionein expression and tissue zinc levels. Carcinogenesis, 21, 18091812.
[Abstract/Free Full Text] - Cherian,M.G., Templeton,D.M., Gallant,K.R. and Banerjee,D. (1987) Biosynthesis and metabolism of metallothionein in rat during perinatal development. Experientia Suppl., 52, 499505.[Medline]
-
Cherian,M.G., Huang,P.C., Klaassen,C.D., Liu,Y.P., Longfellow,D.G. and Waalkes,M.P. (1993) National Cancer Institute workshop on the possible roles of metallothionein in carcinogenesis. Cancer Res., 53, 922925.
[Free Full Text] - Abdel-Mageed,A. and Agrawal,K.C. (1997) Antisense down-regulation of metallothionein induces growth arrest and apoptosis in human breast carcinoma cells. Cancer Gene Ther., 4, 199207.[Web of Science][Medline]
- Schmid,K.W., Ellis,I.O., Gee,J.M. et al. (1993) Presence and possible significance of immunocytochemically demonstrable metallothionein over-expression in primary invasive ductal carcinoma of the breast. Virchows Arch. A, 422, 153159.
- Fresno,M., Wu,W., Rodriguez,J.M. and Nadji,M. (1993) Localization of metallothionein in breast carcinomas. An immunohistochemical study. Virchows Arch. A, 423, 215219.
- Goulding,H., Jasani,B., Pereira,H. et al. (1995) Metallothionein expression in human breast cancer. Br. J. Cancer, 72, 968972.[Web of Science][Medline]
- Jin,R., Bay,B.H., Chow,V.T.K., Tan,P.H. and Dheen,S.T. (2001) Significance of metallothionein expression in breast myoepithelial cells. Cell Tissue Res., 303, 221226.[Web of Science][Medline]
- Jin,R., Bay,B.H., Tan,P.H. and Tan,B.K.H. (1999) Metallothionein expression and zinc levels in invasive ductal breast carcinoma. Oncol. Rep., 61, 871875.
- Jin,R., Bay,B.H., Chow,V.T., Tan,P.H. and Lin,V.C. (2000) Metallothionein 1E mRNA is highly expressed in oestrogen receptor-negative human invasive ductal breast cancer. Br. J. Cancer, 83, 319323.[Web of Science][Medline]
- Hung,M.C. and Lau,Y.K. (1999) Basic science of HER-2/neu: a review. Semin Oncol., 26, 5159.
- Farabegoli,F., Ceccarelli,C., Santini,D., Baldini,N., Taffurelli,M., Marrano,D., Trere,D. and Derenzini,M. (1999) c-erbB-2 over-expression in amplified and non-amplified breast carcinoma samples. Int. J. Cancer, 84, 273277.[Web of Science][Medline]
- Pegram,M. and Slamon,D. (2000) Biological rationale for HER2/neu (c-erbB2) as a target for monoclonal antibody therapy. Sem. Oncol., 27, 1319.
- Kesari,A.L., Chellam,V.G., Nair,P.P., Ahmed,I., Madhavan,J., Thomas,P.A., Nair,M.K. and Pillai,M.R. (1997) p53 tumor suppressor protein and tissue proliferative fraction in infiltrating duct carcinoma. J. Surg. Oncol., 65, 159163.[Web of Science][Medline]
- Gorczyca,W., Markiewski,M., Kram,A., Tuziak,T. and Domagala,W. (1995) Immunohistochemical analysis of bcl-2 and p53 expression in breast carcinomas: their correlation with Ki-67 growth fraction. Virchows Arch. A, 426, 229233.
- Seymour,L., Bezwoda,W.R. and Dansey,R.D. (1995) P-glycoprotein immunostaining correlates with ER and with high Ki67 expression but fails to predict anthracycline resistance in patients with advanced breast cancer. Breast Cancer Res. Treat., 36, 6169.[Web of Science][Medline]
- Lynch,B.J., Guinee,D.G. and Holden,J.A. (1997) Human DNA topoisomerase II-alpha: a new marker of cell proliferation in invasive breast cancer. Hum. Pathol., 28, 11801188.[Web of Science][Medline]
- Ioachim,E., Kamina,S., Demou,A., Kontostolis,M., Lolis,D. and Agnantis,N.J. (1999) Immunohistochemical localization of metallothionein in human breast cancer in comparison with cathepsin D, stromelysin-1, CD44, extracellular matrix components, P53, Rb, C-erbB-2, EGFR, steroid receptor content and proliferation. Anticancer Res., 19, 21332139.[Web of Science][Medline]
- Mokbel,K., Parris,C.N., Ghilchik,M., Williams,G. and Newbold,R.F. (1999) The association between telomerase, histopathological parameters and KI-67 expression in breast cancer. Am. J. Surg., 178, 6972.[Web of Science][Medline]
-
Binder,C., Marx,D., Overhoff,R., Binder,L., Schauer,A. and Hiddemann,W. (1995) Bcl-2 protein expression in breast cancer in relation to established prognostic factors and other clinicopathological variables. Ann. Oncol., 6, 10051010.
[Abstract/Free Full Text] - Jarvis,E.M., Kirk,J.A. and Clarke,C.L. (1998) Loss of nuclear BRCA1 expression in breast cancers is associated with a highly proliferative tumor phenotype. Cancer Genet. Cytogenet., 101, 109115.[Web of Science][Medline]
- Hishikawa,Y., Koji,T., Dhar,D.K., Kinugasa,S., Yamaguchi,M. and Nagasue,N. (1999) Metallothionein expression correlates with metastatic and proliferative potential in squamous cell carcinoma of the oesophagus. Br. J. Cancer, 81, 712720.[Web of Science][Medline]
- McCluggage,W.G., Maxwell,P. and Bharucha,H. (1998) Immunohistochemical detection of metallothionein and MIB1 in uterine cervical squamous lesions. Int. J. Gynecol. Pathol., 17, 2935.[Web of Science][Medline]
- Tan,Y., Sinniah,R., Bay,B.H. and Singh,G. (1999) Metallothionein expression and nuclear size in benign, borderline and malignant serous ovarian tumors. J. Pathol., 189, 6065.[Web of Science][Medline]
- Meskel,H.H., Cherian,M.G., Martinez,V.J., Veinot,L.A. and Frei,J.V. (1993) Metallothionein as an epithelial proliferative marker for DNA flow cytometry. Mod. Pathol., 6, 344350.
- Oyama,T., Take,H., Hikino,T., Iino,Y. and Nakajima,T. (1996) Immunohistochemical expression of metallothionein in invasive breast cancer in relation to proliferative activity, histology and prognosis. Oncology, 53, 112117.[Web of Science][Medline]
-
Grogan,T.M., Lippman,S.M., Spier,C.M., Slymen,D.J., Rybski,J.A., Rangel,C.S., Richter,L.C. and Miller,T.P. (1988) Independent prognostic significance of a nuclear proliferation antigen in diffuse large cell lymphomas as determined by the monoclonal antibody Ki-67. Blood, 71, 11571160.
[Abstract/Free Full Text] -
Vallee,B.L. and Falchuk,K.H. (1993) The biochemical basis of zinc physiology. Physiol. Rev., 73, 79118.
[Free Full Text] -
Jacob,C., Maret,W. and Vallee,B.L. (1998) Control of zinc transfer between thionein, metallothionein and zinc proteins. Proc. Natl. Acad. Sci. USA, 95, 34893494.
[Abstract/Free Full Text] - Cano-Gauci,D.F. and Sarkar,B. (1996) Reversible zinc exchange between metallothionein and the estrogen receptor zinc finger. FEBS Lett., 386, 14.[Web of Science][Medline]
-
Abdel-Mageed,A.B. and Agrawal,K.C. (1998) Activation of nuclear factor kappa B: potential role in metallothionein-mediated mitogenic response. Cancer Res., 58, 23352338.
[Abstract/Free Full Text] - Elston,C.W. and Ellis,I.O. (1998) Assessment of histological grade. In Elston,C.L. and Ellis,I.O. (eds) Systemic Pathology. Volume 13, The Breast, 3rd edn. Churchill Livingstone, Edinburgh, pp. 365384.
- Cai,L., Wang,G.J., Xu,Z.L., Deng,D.X., Chakrabarti,S. and Cherian,M.G. (1998) Metallothionein and apoptosis in primary human hepatocellular carcinoma (HCC) from northern China. Anticancer Res., 18, 46674672.[Web of Science][Medline]
- Zhang,X.H. and Takenaka,I. (1998) Incidence of apoptosis and metallothionein expression in renal cell carcinoma. Br. J. Urol., 81, 913.[Web of Science][Medline]
- Jayasurya,A., Bay,B.H., Yap,W.M. and Tan,N.G. (2000) Correlation of metallothionein expression with apoptosis in nasopharyngeal carcinoma. Br. J. Cancer, 82, 11981203.[Web of Science][Medline]
-
Zhu,J., Zhang,S., Jiang,J. and Chen,X. (2000) Definition of the p53 functional domains necessary for inducing apoptosis. J. Biol. Chem., 275, 3992739934.
[Abstract/Free Full Text] - Dittmer,D., Pati,S., Zambetti,G., Chu,S., Teresky,A.K., Moore,M., Finlay,C. and Levine,A.J. (1993) Gain of function mutations in p53. Nat. Genet., 4, 4246.[Web of Science][Medline]
- Lin,J., Teresky,A.K. and Levine,A.J. (1995) Two critical hydrophobic amino acids in the N-terminal domain of the p53 protein are required for the gain of function phenotypes of human p53 mutants. Oncogene, 10, 23872390.[Web of Science][Medline]
-
Harris,C.C. (1996) Structure and function of the p53 tumor suppressor gene: clues for rational cancer therapeutic strategies. J. Natl Cancer Inst., 88, 14421455.
[Abstract/Free Full Text] - Meplan,C., Richard,M.J. and Hainaut,P. (2000) Metalloregulation of the tumor suppressor protein p53: zinc mediates the renaturation of p53 after exposure to metal chelators in vitro and in intact cells. Oncogene, 19, 52275236.[Web of Science][Medline]
-
Hainaut,P. and Milner,J.A. (1993) Structural role for metal ions in the `wild-type' conformation of the tumor suppressor protein p53. Cancer Res., 53, 17391742.
[Abstract/Free Full Text] - Jacob,C., Maret,W. and Vallee,B.L. (1998) Control of zinc transfer between thionein, metallothionein and zinc proteins. Proc. Natl Acad. Sci. USA, 95, 34893494.
- Verhaegh,G.W., Parat,M.O., Richard,M.J. and Hainaut,P. (1998) Modulation of p53 protein conformation and DNA-binding activity by intracellular chelation of zinc. Mol. Carcinog., 21, 205214.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
X. Chang, T. Jin, L. Chen, M. Nordberg, and L. Lei Metallothionein I Isoform mRNA Expression in Peripheral Lymphocytes as a Biomarker for Occupational Cadmium Exposure Experimental Biology and Medicine, June 1, 2009; 234(6): 666 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Murphy, T. Kimura, B. G. Sato, Y. Shi, and G. K. Andrews Metallothionein Induction by Hypoxia Involves Cooperative Interactions between Metal-Responsive Transcription Factor-1 and Hypoxia-Inducible Transcription Factor-1{alpha} Mol. Cancer Res., March 1, 2008; 6(3): 483 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Scibetta, S. Santangelo, J. Coleman, D. Hall, T. Chaplin, J. Copier, S. Catchpole, J. Burchell, and J. Taylor-Papadimitriou Functional Analysis of the Transcription Repressor PLU-1/JARID1B Mol. Cell. Biol., October 15, 2007; 27(20): 7220 - 7235. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-H. Bay, R. Jin, J. Huang, and P.-H. Tan Metallothionein as a prognostic biomarker in breast cancer. Experimental Biology and Medicine, October 1, 2006; 231(9): 1516 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gurel, D. A. Sens, S. Somji, S. H. Garrett, T. Weiland, and M. A. Sens Post-Transcriptional Regulation of Metallothionein Isoform 1 and 2 Expression in the Human Breast and the MCF-10A Cell Line Toxicol. Sci., June 1, 2005; 85(2): 906 - 915. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Kim, H.-Y. Sohn, S. Y. Yoon, J.-H. Oh, J. O. Yang, J. H. Kim, K. S. Song, S.-M. Rho, H. S. Yoo, Y. S. Kim, et al. Identification of Gastric Cancer-Related Genes Using a cDNA Microarray Containing Novel Expressed Sequence Tags Expressed in Gastric Cancer Cells Clin. Cancer Res., January 15, 2005; 11(2): 473 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. G. Jeong, C.-K. Youn, H.-J. Cho, S.-H. Kim, M.-H. Kim, H.-B. Kim, I.-Y. Chang, Y.-S. Lee, M.-H. Chung, and H. J. You Metallothionein-III Prevents {gamma}-Ray-induced 8-Oxoguanine Accumulation in Normal and hOGG1-depleted Cells J. Biol. Chem., August 13, 2004; 279(33): 34138 - 34149. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. A. HAROON, K. AMIN, P. LICHTLEN, B. SATO, N. T. HUYNH, Z. WANG, W. SCHAFFNER, and B. J. MURPHY Loss of metal transcription factor-1 suppresses tumor growth through enhanced matrix deposition FASEB J, August 1, 2004; 18(11): 1176 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-K. Tai, O. J.-K. Tan, V. T.-K. Chow, R. Jin, J. L. Jones, P.-H. Tan, A. Jayasurya, and B.-H. Bay Differential Expression of Metallothionein 1 and 2 Isoforms in Breast Cancer Lines with Different Invasive Potential: Identification of a Novel Nonsilent Metallothionein-1H Mutant Variant Am. J. Pathol., November 1, 2003; 163(5): 2009 - 2019. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lee, W. Woo, B. Wu, A. Kummer, H. Duminy, and Z. Xu Zinc Accumulation in N-Methyl-N-Nitrosourea-Induced Rat Mammary Tumors Is Accompanied by an Altered Expression of ZnT-1 and Metallothionein Experimental Biology and Medicine, June 1, 2003; 228(6): 689 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shimoda, W. E. Achanzar, W. Qu, T. Nagamine, H. Takagi, M. Mori, and M. P. Waalkes Metallothionein Is a Potential Negative Regulator of Apoptosis Toxicol. Sci., June 1, 2003; 73(2): 294 - 300. [Abstract] [Full Text] [PDF] |
||||
![]() |
J M M Tan, E P C Tock, and V T K Chow The novel human MOST-1 (C8orf17) gene exhibits tissue specific expression, maps to chromosome 8q24.2, and is overexpressed/amplified in high grade cancers of the breast and prostate Mol. Pathol., April 1, 2003; 56(2): 109 - 115. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












