Carcinogenesis, Vol. 23, No. 10, 1625-1630,
October 2002
© 2002 Oxford University Press
CANCER BIOLOGY |
The redox protein thioredoxin-1 regulates the constitutive and inducible expression of the estrogen metabolizing cytochromes P450 1B1 and 1A1 in MCF-7 human breast cancer cells
1 Arizona Cancer Center, University of Arizona, 1515 N. Campbell Avenue, Tucson, AZ 85724-5024, USA
| Abstract |
|---|
|
|
|---|
The oxidative metabolites of estrogen have been proposed to play an important role in the development of some human cancers. The two major pathways of estrogen metabolism, to the carcinogenic 4-hydroxyestradiol (4-OHE2) and to the non-carcinogenic 2-hydroxyestradiol (2-OHE2), are mediated by cytochromes P450 CYP1B1 and CYP1A1, respectively. The expression of CYP1A1 and CYP1B1 is regulated by the aromatic hydrocarbon receptor/Ah receptor nuclear translocator (AhR/ARNT) transcription factor complex. CYP1B1 expression is elevated in a wide range of human cancers but is not found in corresponding normal tissue. Thioredoxin-1 (Trx-1) is a small redox protein that is overexpressed in a number of human cancers. We report that the expression of CYP1B1 mRNA and protein is increased by Trx-1 transfection of MCF-7 human breast cancer cells and decreased by a redox inactive mutant Trx-1. The Trx-1 inhibitor PX-12 inhibits CYP1B1 gene expression. Trx-1 transfected MCF-7 cells show increased AhR/ARNT DNA binding activity that is not due to altered AhR or ARNT protein expression. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) induced expression of CYP1B1 in MCF-7 cells is increased by Trx-1. Trx-1 does not effect the basal expression of CYP1A1, but increases CYP1A1 mRNA in response to TCDD. The redox inactive mutant Trx-1 completely blocks the induction of both CYP1B1 and CYP1A1 by TCDD. Expression of CYP1A1 but not CYP1B1 has been linked to estrogen receptor (ER
) status. Trx-1 transfected MCF-7 cells have decreased ER
expression, which may account for the lack of CYP1A1 induction by Trx-1 in the absence of ligand. The results suggest that Trx-1 is involved in the constitutive expression of CYP1B1 and is required for the induction of CYP1B1 and CYP1A1 by TCDD in human MCF-7 breast cancer cells.
Abbreviations: AhR, aryl hydrocarbon receptor; ARNT, Ah receptor nuclear translocator; CYP1B1, cytochrome P450 1B1; CYP1A1, cytochrome P450 1A1; DRE, dioxin response element; E2, 17ß-estradiol; 4-OHE2, 4-hydroxyestradiol; 2-OH E2, 2-hydroxyestradiol; TCDD, 2,3,7,8-tetrachloro-dibenzo-p-dioxin; Trx-1, thioredoxin-1
| Introduction |
|---|
|
|
|---|
Estrogen acts as a growth factor to promote cancer cell growth by triggering estrogen receptor-mediated signal transduction resulting in increased DNA synthesis and cell proliferation (1). Estrogen metabolites formed by cytochrome P450s (CYPs) also play a role in the initiation and progression of cancer (2). CYP1B1 and CYP1A1 mediate the two major pathways of estrogen metabolism (3,4). CYP1B1 converts 17ß-estradiol (E2) to the carcinogenic 4-hydroxyestradiol (4-OHE2) that forms adducts with DNA and undergoes metabolic redox cycling to generate reactive oxygen species that can damage DNA, protein and lipids (57). The metabolic activation of estrogen by CYP1B1 is thought to play an important role in mammary tumorigenesis (2). CYP1A1 converts estrogen to the non-carcinogenic 2-hydroxyestradiol (2-OHE2) and may protect against estrogen-induced carcinogenesis (8).
CYP1B1 is expressed at a high frequency in a variety of human cancers including breast, colon, lung, esophagus, skin, lymphoma, brain and testicular cancers, without detectable CYP1B1 in the corresponding normal tissue (9). Therefore, CYP1B1 appears to be a tumor-specific CYP. In humans the conversion of E2 to 4-OHE2 by CYP1B1 predominates over the formation of 2-OHE2 by CYP1A1 in both benign and malignant mammary tumors (10). The level of CYP1B1 expression appears to be a critical determinant of the metabolism and toxicity of estrogen in mammary cells and a potential cancer biomarker (10).
The expression of CYP1B1 and CYP1A1 in normal and tumor tissue is regulated by several mechanisms. CYP1B1 and CYP1A1 gene transcription is activated by polycyclic aromatic hydrocarbons that act via the aryl hydrocarbon receptor (AhR) (11). 2,3,7,8-Tetrachloro-dibenzo-p-dioxin (TCDD, dioxin) is the most potent known AhR agonist (12). Upon ligand binding the AhR translocates to the nucleus where it forms a heterodimer with the Ah receptor nuclear translocator (ARNT or HIF-1ß) and activates transcription by binding to dioxin-responsive elements (DREs) located within the 5' promoter region of genes that include CYP1B1 and CYP1A1 (11). Despite the fact that CYP1B1 and CYP1A1 are both regulated by the AhR, studies examining their basal and inducible expression levels indicate that cell-type-specific expression patterns exist (13,14). The specific factors contributing to the differential expression of CYP1B1 and CYP1A1 are poorly understood.
Thioredoxins (Trxs) are a family of small redox proteins that share a highly conserved -Trp-Cys-Gly-Pro-Cys-Lys- active site (15). The active site cysteines of Trxs undergo reversible oxidation and reduction catalyzed by thioredoxin reductase, an enzyme that uses NADPH as its source of reducing equivalents (16,17). Reduced Trxs can, in turn, reduce oxidized cysteine residues on proteins to mediate a variety of different functions. Together, Trx and thioredoxin reductase constitute a major redox system found in all prokaryotic and eukaryotic cells.
Trx-1 is the most studied member of the mammalian thioredoxin family. Human Trx-1 is a 104 amino acid protein with a molecular weight of 12 kDa (18). Within the cell Trx-1 acts as a reducing co-factor (19), an antioxidant (20) and controls gene expression by selectively activating the DNA binding and transactivating activity of a number of redox sensitive transcription factors including NF-
B (21), p53 (22), AP-1 (23) and the glucocorticoid receptor (24), through the reduction of critical cysteine residues. Trx-1 is also secreted from cells by mechanism that does not involve the endoplasmic-reticulum Golgi secretory pathway and exogenous Trx-1 can stimulate the growth of a variety of normal and cancer cell lines (25,26). The redox activity of Trx-1 is essential for growth stimulation and a redox inactive mutant of Trx-1 where both active site cysteines were replaced with serines, fails to induce proliferation (27).
Trx-1 has been shown to play a role in a variety of human diseases including cancer. Cancer cells stably transfected with human Trx-1 exhibit increased cell growth and colony formation in soft agar (28). Overexpression of Trx-1 also protects cancer cells from spontaneous and drug-induced apoptosis (29). In contrast, cells stably transfected with a redox inactive mutant Trx-1 show decreased cell growth, decreased colony formation in soft agar and inhibited tumor formation in vivo (28). Cells expressing the redox inactive mutant Trx-1 are also more sensitive to spontaneous and drug-induced apoptosis (29). Clinically, Trx-1 is overexpressed by a number of human primary tumors (18,26,3033) where it is associated with increased cell proliferation, decreased apoptosis and decreased patient survival (30).
We identified CYP1B1 as a Trx-1-induced gene in MCF-7 human breast cancer cells using DNA microarray. Trx-1 transfection increased the basal expression level of CYP1B1 while the redox inactive Trx-1 decreased the expression. The constitutive expression of CYP1A1 was not affected by Trx-1, but the induction of both CYP1B1 and CYP1A1 by TCDD was markedly increased by Trx-1 and almost completely inhibited by a redox inactive mutant Trx-1. The studies suggest that Trx-1 contributes to the tumor-specific expression of CYP1B1 and is an essential factor for the cellular response to TCDD in human breast cancer cells.
| Materials and methods |
|---|
|
|
|---|
Cell culture
The cell lines used were wild-type MCF-7 human breast cancer cells (American Type Culture Collection, Rockville, MD) and MCF-7 clonal cell lines stably transfected with empty vector (MCF-7/neo), with Trx-1 (MCF-/Trx 9 and MCF-7/Trx 12) or with the redox inactive Cys32
Ser/Cys35
Ser (SerineBoth = SerB) mutant Trx-1 (MCF-7/SerB 4) (28). Cells were grown as a monolayer in Falcon T175cm flasks (Becton Dickinson, Franklin Lakes, NJ) in Dulbeccos modification of Eagles medium (DMEM, Cellgro, Herndon, VA) supplemented with 10% fetal bovine serum (FBS, Gemini Bio-Products, Woodland, CA) at 37°C in a humidified atomosphere plus 5% CO2. Transfected cell media also contained 200 µg ml-1 G418. PX-12 (1-methyl-propyl 2-imidazolozyl disulfide) was provided by Dr Lynn Kirkpatrick (ProlX Pharmaceuticals, Pittsburgh, PA) and TCDD was obtained from AccuStandard (New Haven, CT). Cells at 6070% confluence were treated with 10 µM PX-12 or 10 nM TCDD for 24 h.
DNA microarray analysis
Total RNA was isolated from MCF-7 cells using TRIzol reagent (Invitrogen, Carlsbad, CA). Poly A+ RNA was separated from 1 mg of total RNA using the Clontech Nucleotrap mRNA Kit (Palo Alto, CA). Cy3-dCTP and Cy5-dCTP labeled cDNA probes were synthesized from 4 µg of mRNA using Superscript RT II (Invitrogen) and an oligo-d(T) primer. The samples were combined and purified with Microcon 30 (Millipore, Bedford, MA) and Qiagen Nucleotide Removal Columns (Valencia, CA). cDNA clones (Research Genetics, Huntsville, AL) from 520 selected redox, apoptosis, and cell growth genes were printed at a minimum concentration of 50 ng per spot on DNA Ready Type 1 slides (Clontech) and fixed with UV irradiation (UV Stratalinker 1800, Stratagene, La Jolla, CA). The lyophilized Cy3 and Cy5 cDNA probes were resuspended in 15 µl of hybridization buffer [5x sodium saline citrate (0.75 M sodium chloride, 75 mM sodium citrate, pH 7.0), 0.2% sodium dodecyl sulfate (SDS), and 1 mg/ml Cot-1 DNA] and hybridized to the microarray slides at 55°C overnight. The slides were washed at room temperature, spun dry, and scanned for fluorescence using the ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified using QuantArray (Packard BioScience, Meriden, CT) and raw data was exported to Excel (Microsoft) where background subtraction and normalization were performed. Each experiment was repeated at least three times.
Northern analysis
mRNA, 2 µg, was separated by agarose/formaldehyde gel electrophoresis, transferred onto Magna Graph membrane (Osmonics, Westborough, MA), and UV crosslinked. Membranes were hybridized with radiolabeled cDNA probes specific for human CYP1B1, CYP1A1, ER
and GAPDH in ULTRAhyb buffer (Ambion, Austin, TX). Probes were labeled with [
-32P]dCTP (NEN, Boston, MA) using the Random Primers DNA Labeling System (Invitrogen). CYP1B1 mRNA was detected using a 420 bp fragment generated from sequence-specific primers 5' AACGTACCGGCCACTATC 3' and 5' GCTGGTCAGGTCCTTGTT 3'. CYP1A1 mRNA was detected using a 178 bp fragment generated from sequence-specific primers 5' GATGAGAACGCCAATGTC 3' and 5' ACCTGCCAATCACTGTGT 3'. ER
was detected using a 481 bp fragment generated from sequence-specific primers 5' GGCATGGAGCTGAACAGT 3' and 5' AATGAGCTGGCAGGAGTG 3'. A probe specific for GAPDH was used to normalize the total amount of mRNA loaded in each sample.
Western analysis
Cell pellets were resuspended in lysis buffer (50 mM HEPES pH 7.5, 0.05% NP-40, 0.5% sodium deoxycholate, 50 mM sodium chloride, 1 mM EDTA and 0.1 mM sodium orthovanadate), incubated on ice for 20 min, and spun at 14 000 g to collect whole cells lysates. Total cell lysate (20 µg) was run on NuPAGE 10% SDSPAGE gels (Invitrogen). Proteins were transferred to Poly Screen PVDF membranes (NEN) and blocked with 5% milk/Tris buffered saline (100 mM TrisHCl pH 7.5, 150 mM NaCl)/0.1% Tween 20. Primary antibodies used were rabbit polyclonal anti-human CYP1B1 (Gentest, Woburn, MA), mouse polyclonal anti-human Ah receptor antibody (Novus, Littleton, CO), goat polyclonal anti-human ARNT antibody (Santa Cruz Biotechnology, Santa Cruz, CA), and goat polyclonal anti-human actin antibody (Santa Cruz). The rabbit, mouse and goat secondary antibodies were conjugated to horseradish peroxidase.
Gel shift assay
Nuclear extracts were isolated using Nuclear and Cytoplasmic Extraction Reagents (Pierce, Rockford, IL). Nuclear protein (7.5 µg) was incubated with ~100 000 c.p.m. of a [
-32P]ATP (NEN) end-labeled radioactive probe containing two internal DREs from the human CYP1B1 gene (5'GCGCACGCAAAGCCCAGCTCCGCACGCAAA 3') -860 to -830. Deletion analysis of the CYP1B1 promoter has shown that maximum expression required elements in the -1022 to -835 nucleotide region (34,35). DNA binding reactions were carried out in a total volume of 20 µl buffer solution at a final concentration of 25 mM HEPES, 1 mM dithio-threitol (DTT), 150 mM KCl, 10% glycerol and 1 µg poly(dIdC). A 1 µg sample of unlabeled oligo nucleotide was used as a specific competitor. The reaction mixtures were incubated at room temperature for 20 min and separated on non-denaturing 6% polyacrylamide gels. The dried gels were then exposed to BIOMAX MS film (Kodak, Rochester, NY).
Microsome-mediated catechol estrogen assay
A direct product isolation assay for estrogen 2- and 4-hydroxylase activity (10,36) was used to quantify the rates of catechol estrogen formation in Trx-1 and SerB transfected MCF-7 cells. Microsomes were isolated by the centrifugation of whole cells lysates (prepared as described above) at 100 000 x g for 1 h at 4°C. The microsomes were resuspended in 0.25 M sucrose/10 mM EDTA, pH 7.5 and stored at -80°C. Microsomal protein (500 µg) from TCDD induced MCF-7/neo, MCF7-7/Trx9 and MCF-7/SerB4 cells was incubated with 5 mM NAPDH (Sigma, St Louis, MO), 5 µM E2 (Sigma), and 1.01.5 x 106 d.p.m. [3H]E2 (NEN) in a 0.1 M TrisHCl/HEPES buffer (pH 7.4) containing 5 mM ascorbic acid (Sigma). Reactions were carried out in a final volume of 500 µl at 30°C for 30 min. Neutral alumina (Fisher Scientific, Fair Lawn, NJ) was used to isolate the estrogen metabolites. The catechol estrogens were eluted with 0.2 N HCl and back extracted into ethyl acetate (Fisher Scientific). The products were then separated by thin-layer chromatography (Silica Gel 60 F254, EM Science, Gibbstown, NJ) and radioactivity in the 4-OHE2 and 2-OHE2 regions was measured. 4-OHE2 and 2-OHE2 reference standards were purchased from Steraloids (Wilton, NH). Product formation was reported as pmol/mg microsomal protein/min.
| Results |
|---|
|
|
|---|
CYP1B1 expression is increased in Trx-1 transfected cells
DNA microarray analysis of 520 known cancer-related genes with cDNA prepared from mRNA from MCF-7 human breast cancer cells stably transfected with human Trx-1 or the dominant negative redox inactive SerB showed altered expression of several genes. One of these genes was CYP1B1 whose expression was increased 2.7 ± 0.5-fold in MCF-7/Trx9 cells compared with MCF-7/neo cells (P < 0.05) and decreased 0.5 ± 0.1-fold in MCF/7SerB4 cells compared with MCF-7/neo cells (P < 0.05). The changes in CYP1B1 expression were confirmed by northern analysis and western analysis as an increase in CYP1B1 mRNA and protein in the Trx-1 transfected cells and a decrease in CYP1B1 mRNA in the SerB transfected cells (Figure 1
|
The Trx-1 inhibitor PX-12 reverses the effects of Trx-1 on CYP1B1 expression
Treatment of MCF-7/Trx9 cells with 10 µM PX-12, a Trx-1 inhibitor (37,38), for 24 h caused a 0.6 ± 0.03-fold decrease in CYP1B1 expression by DNA microarray (P < 0.05 compared with untreated MCF-7/Trx9 cells), which was confirmed by northern analysis (Figure 2
|
Trx-1 transfected cells show increased AhR/ARNT DNA binding
CYP1B1 gene transcription is regulated by the AhR/ARNT transcription factor complex (35). Gel shift assays were used to measure the DNA binding of the AhR/ARNT transcription factor complex to DREs found in the 5' promoter regions of the CYP1B1 and CYP1A1 genes (Figure 3
|
The expression of CYP1B1 and CYP1A1 in response to TCDD is altered by Trx-1
CYP1B1 and CYP1A1 both have several DREs in their 5' promoter regions that are binding sites for the AhR/ARNT transcription factor complex (35). TCDD is a potent exogenous ligand of the AhR and activates AhR/ARNT DNA binding activity (12). In the absence of TCDD, Trx-1 induced the expression of CYP1B1 but not CYP1A1 in MCF-7 cells (Figure 4
|
Estradiol 4-and 2-hydroxylation are increased by Trx-1
A catechol estrogen product isolation assay was utilized to determine if the changes in the expression of CYP1B1 and CYP1A1 with TCDD in the Trx-1 and SerB transfected cells translate into differences in estrogen metabolism. Microsomes prepared from MCF-7/Trx9 cells treated with TCDD show increased rates of E2 2- and 4-hydroxylation (1.40 ± 0.24 and 1.22 ± 0.19 pmol/mg protein/min, respectively) compared with microsomes from MCF-7/neo cells (0.50 ± 0.11 and 0.45 ± 0.03 pmol/mg protein/min, respectively). In contrast, microsomes from MCF-7/SerB4 cells showed decreased E2 2-and 4-hydroxylation (0.09 ± 0.03 and 0.17 ± 0.02 pmol/mg protein/min, respectively) (Figure 5
|
Trx-1 transfected MCF-7 cells show decreased estrogen receptor expression
The basal and inducible expression of CYP1A1 has been linked previously to the presence or absence of the ER
(39). To determine if a decrease in the expression of ER
as a result of increased Trx-1 could account for the lack of CYP1A1 basal expression the panel of MCF-7 cell lines was probed for ER
expression by northern blotting (Figure 6A
message levels compared with MCF-7/neo cells (P<0.05) (Figure 6B
mRNA was observed between MCF-7/neo and MCF-7/SerB4 cells.
|
| Discussion |
|---|
|
|
|---|
The studies show that Trx-1 plays an important role in the regulation CYP1B1 and CYP1A1 gene transcription. DNA microarray analysis of Trx-1 transfected MCF-7 breast cancer cells showed increased CYP1B1 expression. In contrast, MCF-7 cells transfected with a redox inactive Trx-1, which functions as a non-competitive inhibitor of thioredoxin reductase and is a dominant negative Trx-1 inhibitor (27), showed decreased CYP1B1 expression. The Trx-1 inhibitor PX-12 was able to reverse the effects of Trx-1 on CYP1B1 gene expression further implicating Trx-1 in the regulation of CYP1B1 gene transcription.
CYP1B1 plays a role in breast cancer etiology by converting endogenous estrogens to carcinogenic metabolites. CYP1B1 specifically hydroxylates E2 at the C-4 position to generate 4-OHE2 (3), a product that can damage DNA and undergo metabolic redox cycling to produce reactive oxygen species (6,7). CYP1B1 is selectively expressed by a variety of cancers including breast cancer and is absent in corresponding normal breast tissue (9). Trx-1 levels are increased in some human breast cancers (40). Our data suggests that increased Trx-1 may cause increased expression of CYP1B1 in tumor tissue. Therefore, tissues that show increased Trx-1 expression may have a higher risk of carcinogenesis from estrogen due to increased CYP1B1 activity.
Gel shift analysis showed an increase in AhR/ARNT DNA binding in MCF-7 cells transfected with Trx-1 that could explain the increase in CYP1B1 gene expression. Previous studies have shown that the AhR/ARNT transcription factor complex is redox sensitive and its DNA binding is increased in the presence of DTT and inhibited with diamide (41,42). Trx-1 may reduce critical cysteine residues necessary for the interaction of the AhR/ARNT complex with specific DNA response elements, as has been reported for other redox sensitive transcription factors such as NF-
B (21) and the glucocorticoid receptor (24). Trx-1 may also facilitate AhR ligand binding or the formation of the AhR/ARNT heterodimer by the reduction of key cysteine residues.
Although the AhR/ARNT transcription factor complex transcriptionally activates both CYP1B1 and CYP1A1, they are not always expressed at the same levels in tissues and cell culture, and differential basal and inducible expression suggests that factors in addition to the AhR/ARNT complex may mediate their expression (13,14). Our work shows that Trx-1 is one such factor that contributes to the differential expression of CYP1B1 and CYP1A1. The induction of CYP1B1 and CYP1A1 mRNA by TCDD was enhanced by Trx-1 in MCF-7 cells; however, in the absence of TCDD only CYP1B1 and not CYP1A1 expression was increased by Trx-1, despite increased AhR/ARNT DNA binding. The fact that CYP1B1 undergoes basal activation by the AhR more readily than CYP1A1 indicates that CYP1B1 may have a greater sensitivity to the redox activated AhR. The redox inactive mutant Trx-1 completely inhibited the induction of CYP1B1 and CYP1A1 by TCDD. This work suggests that Trx-1 is required for the induction of CYP1B1 and CYP1A1 following treatment with TCDD.
The oxidative metabolism of estrogen following TCDD exposure was markedly altered by Trx-1 transfection of MCF-7 cells with increased rates of both E2 2- and 4-hydroxylation compared to TCDD treated MCF-7/neo cells. In contrast, MCF-7 cells transfected with the redox inactive mutant Trx-1 showed almost no CYP1B1 and CYP1A1 induction in response to TCDD and had very low levels of E2 2- and 4-hydroxylation. Therefore, maximal induction of CYP1B1 and CYP1A1 enzyme activity by TCDD in MCF-7 cells requires the redox activity of Trx-1.
The activation of the AhR by an endogenous ligand in cells might contribute to the selective expression of CYP1B1, as well as the potential cross talk with other receptor pathways. CYP1A1 basal and inducible expression in some human breast cancer cells is enhanced by the expression of the ER
, whereas CYP1B1 expression appears to be ER
independent (39). Cell lines expressing high ER
mRNA show high CYP1A1 mRNA inducibility and enzyme activity (39). We found that Trx-1 transfected MCF-7 cells have decreased ER
expression. Thus, a decrease in ER
expression may account for the lack of CYP1A1 basal expression in Trx-1 transfected cells despite increased AhR/ARNT binding. Hayashi et al. (43) have reported that transient transfection of ZR-75-1 human mammary tumor cells with Trx-1 leads to increased ER transcriptional activity. The different effect of Trx-1 on the ER between with what we see may be due to differences in the cell lines, the use of stable versus transient transfection, or the fact that we have looked at ER
expression whereas Hayashi et al. (43) measured ER activity. A mechanism summarizing the possible effects of Trx-1 on CYP1B1 and CYP1A1 expression and activity is shown in Figure 7
.
|
In summary, we have shown that Trx-1 contributes to the tumor-specific expression of CYP1B1 and its redox activity is required for the induction of AhR dependent genes such as CYP1B1 and CYP1A1 by TCDD. These results could have important implications for carcinogenesis because of the role CYP1B1 plays in the metabolic activation of estrogen.
| Notes |
|---|
1 To whom correspondence should be addressed Email: gpowis{at}azcc.arizona.edu
| Acknowledgments |
|---|
Supported by NIH grants CA78277, CA17094 and CA90821.
| References |
|---|
|
|
|---|
- Feigelson,H.S. and Henderson,B.E. (1996) Estrogens and breast cancer. Carcinogenesis, 17, 22792284.
[Free Full Text] - Yager,J.D. (2000) Endogenous estrogens as carcinogens through metabolic activation. J. Natl Cancer Inst. Monographs, 27, 6773.
- Hayes,C.L., Spink,D.C., Spink,B.C., Cao,J.Q., Walker,N.J. and Sutter,T.R. (1996) 17ß-Estradiol hydroxylation catalyzed by human cytochrome P450 1B1. Proc. Natl Acad. Sci. USA, 93, 97769781.
[Abstract/Free Full Text] - Martucci,C.P. and Fishman,J. (1993) P450 enzymes of estrogen metabolism. Pharmacol. Ther., 57, 237257.[ISI][Medline]
- Liehr,J.G., Fang,W.F., Sirbasku,D.A. and Ari-Ulubelen,A. (1986) Carcinogenicity of catechol estrogens in Syrian hamsters. J. Steroid Biochem., 24, 353356.[ISI][Medline]
- Yager,J.D. and Liehr,J.G. (1996) Molecular mechanisms of estrogen carcinogenesis. Ann. Rev. Pharmacol. Toxicol., 36, 203232.[ISI][Medline]
- Zhu,B.T. and Conney,A.H. (1998) Functional role of estrogen metabolism in target cells: review and perspectives. Carcinogenesis, 15, 26372643.
[Abstract/Free Full Text] - Bradlow,H.L., Telang,N.T., Sepkovic,D.W. and Osborne,M.P. (1996) 2-Hydroxyestrone: the `good estrogen. J. Endocrinol., 150, S259S265.[Abstract]
- Murray,G.I., Taylor,M.C., McFadyen,M.C.E., McKay,J.A., Greenlee,W.F., Burke,M.D. and Melvin,W.T. (1997) Tumor-specific expression of cytochrome P450 1B1.Cancer Res., 57, 30263031.
[Abstract/Free Full Text] - Liehr,J.G. and Ricci,M.J. (1996) 4-Hydroxylation of estrogens as a marker of human mammary tumors. Proc. Natl Acad. Sci. USA, 93, 32943296.
[Abstract/Free Full Text] - Sogawa,K. and Fujii-Kuriyama,Y. (1997) Ah receptor, a novel ligand-activated transcription factor. J. Biochem., 122, 10751079.
[Abstract/Free Full Text] - Whitlock,J.P. Jr (1990) Genetic and molecular aspects of 2,3,7,8 tetrachlorodibenzo-p-dioxin action. Ann. Rev. Pharmacol. Toxicol., 30, 251277.[ISI][Medline]
- Kress,S. and Greenlee,W.F. (1997) Cell-specific regulation of human CYP1A1 and CYP1B1 genes. Cancer Res., 57, 12641269.
[Abstract/Free Full Text] - Spink,D.C., Spink,B.C., Cao,J.Q., DePasquale,J.A., Pentecost,B.T., Fasco,M.J., Li,Y. and Sutter,T.R. (1998) Differential expression of CYP1A1 and CYP1B1 in human breast epithelial cells and breast tumor cells. Carcinogenesis, 19, 291298.
[Abstract/Free Full Text] - Powis,G. and Montfort,W.R. (2001) Properties and biological activities of thioredoxins. Ann. Rev. Pharmacol. Toxicol., 41, 261295.[ISI][Medline]
- Luthman,M. and Holgren,A. (1982) Rat liver thioredoxin and thioredoxin reductase: purification and characterization. Biochemistry, 21, 66286633.[Medline]
- Powis,G., Oblong,J.E., Gasdaska,P.Y., Berggren,M., Hill,S. and Kirkpatrick,D.L. (1994) The thioredoxin/thioredoxin reductase redox system and control of cell growth. Oncol. Res., 6, 539544.[ISI][Medline]
- Gasdaska,P.Y., Oblong,J.E., Cotgreave,I.A. and Powis,G. (1994) The predicted amino acid sepuence of human thioredoxin is identical to that of the autocrine growth factor human adult T-cell derived factor (ADF): thioredoxin mRNA is elevated in some human tumors. Biochim. Biophys. Acta, 1218, 292296.[Medline]
- Laurent,T.C., Moore,E.C. and Reichard,P. (1964) Enzymatic synthesis of deoxyribonucleotides VI. Isolation and characterization of thioredoxin, the hydrogen donor from Escherichia coli B. J. Biol. Chem., 239, 34363444.
[Free Full Text] - Spector,A., Yan,G.Z., Huang,R.R.C., McDermott,M.J., Gascoyne,P.R.C. and Pigiet,V. (1988) The effect of H2O2 upon thioredoxin-enriched lens epithelial cells. J. Biol. Chem., 263, 498490.
[Abstract/Free Full Text] - Matthews,J.R., Wakasugi,N., Virelizier,J.L., Yodoi,J. and Hay,R.T. (1992) Thioredoxin regulates the DNA binding activity of NF-kappa B by reduction of a disulphide bond involving cysteine 62. Nucleic Acids Res., 20, 38213830.
[Abstract/Free Full Text] - Ueno,M., Masutani,H., Jun Arai,R., Yamauchi,A., Hirota,K., Sakai,T., Inamoto,T., Yamaoka,Y., Yodoi,J. and Nikaido,T. (2000) Thioredoxin-dependent redox regulation of p53-mediated p21 activation. J. Biol. Chem., 274, 3580935815.
[Abstract/Free Full Text] - Abate,C., Patel,L., Rauscher III,F.J. and Curran,T. (1990) Redox regulation of fos and jun DNA-binding activity in vitro. Science, 249, 11571161.
[Abstract/Free Full Text] - Makino,Y., Yoshikawa,N., Okamoto,K., Hirota,K., Yodoi,J., Makino,I. and Tanaka,H. (1999) Direct association with thioredoxin allows redox regulation of glucocorticoid receptor function. J. Biol. Chem., 274, 31823188.
[Abstract/Free Full Text] - Rubartelli,A., Bajetto,A., Allavena,G., Wollman,E. and Sitia,R. (1992) Secretion of thioredoxin by normal and neoplastic cells through a leaderless secretory pathway. J. Biol. Chem., 267, 2416124164.
[Abstract/Free Full Text] - Berggren,M., Gallegos,A., Gasdaska,J.R., Gasdaska,P.Y., Warneke,J. and Powis,G. (1996) Thioredoxin and thioredoxin reductase gene expression in human tumors and cell lines and the effects of serum stimulation and hypoxia. Anticancer Res., 16, 34593466.[ISI][Medline]
- Oblong,J.E., Berggren,M., Gasdaska,P.Y. and Powis,G. (1994) Site-directed mutagenesis of active site cysteines in human thioredoxin produces competitive inhibitors of human thioredoxin reductase and elimination of mitogenic properties of thioredoxin. J. Biol. Chem., 269, 1171411720.
[Abstract/Free Full Text] - Gallegos,A., Gasdaska,J.R., Taylor,C.W., Paine-Murrieta,G.D., Goodman,D., Gasdaska,P.Y., Berggren,M., Briehl,M.M. and Powis,G. (1996) Tranfection with human thioredoxin increases cell proliferation and a dominant-negative mutant thioredoxin reverses the transformed phenotype of human breast cancer cells. Cancer Res., 56, 57655770.
[Abstract/Free Full Text] - Baker,A., Payne,C.M., Briehl,M.M. and Powis,G. (1997) Thioredoxin, a gene found overexpressed in human cancer, inhibits apoptosis in vitro and in vivo. Cancer Res., 57, 51625167.
[Abstract/Free Full Text] - Grogan,T.M., Fenoglio-Prieser,C., Zehab,R. et al. (2000) Thioredoxin, a putative oncogene product, is overexpressed in gastric carcinoma and associated with increased proliferation and increased cell survival. Hum. Pathol., 31, 475481.[ISI][Medline]
- Fujii,S., Nanbu,Y., Nonogaki,H., Konishi,I., Mori,T., Masutani,H. and Yodoi,J. (1991) Coexpression of adult T-cell leukemia-derived factor, a thioredoxin homologue and human papillovirus DNA in neoplastic cervical spuamous epithelium. Cancer, 68, 15831591.[ISI][Medline]
- Nakamura,H., Masutani,H., Tagaya,Y., Yamauchi,A., Inamoto,T., Nanbu,Y., Fujii,S., Ozawa,K. and Yodoi,J. (1992) Expression and growth-promoting effect of adult T-cell leukemia-derived factor. A human thioredoxin homologue in hepatocellular carcinoma. Cancer, 69, 20912097.[ISI][Medline]
- Nakamura,H., Bai,J., Nishinaka,Y., Ueda,S., Sasada,T., Ohshio,G., Imamura,M., Takabayashi,A., Yamaoka,Y. and Yodoi,J. (2000) Expression of thioredoxin and glutaredoxin, redox-regulating proteins, in pancreatic cancer. Cancer Detect. Prev., 24, 5360.[ISI][Medline]
- Wo,Y.P., Stewart,J. and Greenlee,W.F. (1997) Functional analysis of the promoter for the human CYP1B1 gene. J. Biol. Chem., 272, 2670226707.
[Abstract/Free Full Text] - Murray,G.I., Melvin,W.T., Greenlee,W.F. and Burke,M.D. (2001) Regulation, function and tissue-specific expression of cytochrome P450 CYP1B1. Annu. Rev. Pharmacol. Toxicol., 41, 297316.[ISI][Medline]
- Hersey,R.M., Williams,K.I.H. and Weisz,J. (1981) Catechol estrogen formation by brain tissue: characterization of a direct product isolation assay for estrogen-2- and 4-hydroxylase activity and its application to studies of 2- and 4-hydroxyestradiol formation by rabbit hypothalamus. Endocrinology, 109, 19121920.[Abstract]
- Oblong,J.E., Chantler,E.L., Gallegos,A., Kirkpatrick,D.L., Chen,T., Marshall,N. and Powis,G. (1994) Reversible inhibition of human thioredoxin reductase activity by cytotoxic alkyl 2-imidazolyl disulfide analogues. Cancer Chemother. Pharmacol., 34, 434438.[ISI][Medline]
- Powis,G., Kirkpatrick,D.L., Angulo,M., Gasdaska,J.R., Powell,M.B., Salmon,S.E. and Montfort,W.R. (1996) Thioredoxin redox signalling: a novel target for anticancer drug developement. Anticancer Drugs, 7, 121126.[Medline]
- Angus,W.G.R., Larsen,M.C. and Jefcoate,C.R. (1999) Expression of CYP1A1 and CYP1B1 depends on cell-specific factors in human breast cancer cell lines: role of estrogen receptor status. Carcinogenesis, 20, 947955.
[Abstract/Free Full Text] - Matsutani,Y., Yamauchi,A., Takahashi,R. et al. (2001) Inverse correlation of thioredoxin expression with estrogen receptor- and p53-dependent tumor growth in breast cancer tissues. Clin. Cancer Res., 7, 34303436.
[Abstract/Free Full Text] - Ireland,R.C., Li,S. and Dougherty,J.J. (1995) The DNA binding of purified Ah receptor heterdimer is regulated by redox conditions. Arch. Biochem. Biophys., 319, 470480.[ISI][Medline]
- Xu,C., Siu,C. and Pasco,D.S. (1998) DNA binding activity of the aryl hydrocarbon receptor is sensitive to redox changes in intact cells. Arch. Biochem. Biophys., 358, 149156.[ISI][Medline]
- Hayashi,S., Hajiro-Nakanishi,K., Makino,Y., Eguchi,H., Yodoi,J. and Tanaka,H. (1997) Functional modulation of estrogen receptor by redox state with reference to thioredoxin as a mediator. Nucleic Acids Res., 25, 403540.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






