Carcinogenesis, Vol. 23, No. 3, 463-467,
March 2002
© 2002 Oxford University Press
CARCINOGENESIS |
Effects of genetic background on prostate and taste bud carcinogenesis due to SV40 T antigen expression under probasin gene promoter control
First Department of Pathology, Nagoya City University Medical School, Nagoya City, Japan
| Abstract |
|---|
|
|
|---|
The incidence of prostate carcinomas in AfricanAmerican men is greater than in white men, indicating genetic factors are involved in risk of this neoplasia. Recently, we have developed a transgenic rat model of prostate cancer, featuring development of malignancies within 15 weeks of age at very high incidence. Male transgenic rats with a SpragueDawley genetic background were mated with wild-type females of F344, Wistar and ACI strains. F1 male transgenic hybrids with female Wistar and ACI rats had significantly lowered incidences of prostate carcinomas. However, the serum level of testosterone, and expression of the transgene, probasin, and the androgen receptor did not correlate with the strain variation in tumor development. Furthermore, immunohistochemical analysis of the SV40 Tag and the androgen receptor also did not reveal any differences between the strains. The transgenic rats additionally developed taste bud neuroblastomas at 100% incidence and this was suppressed in F1 male transgenic offspring with the ACI, but not the other strains. These results clearly show that genetic background influences prostate carcinogenesis and taste bud tumorigenesis in rats and that the present transgenic rats could provide a good model to identify specific factors.
Abbreviations: DMBA, 3,2'-dimethyl-4-aminobiphenyl; PCR, polymerase chain reaction; PIN, prostatic intraepithelial neoplasia; SD, SpragueDawley.
| Introduction |
|---|
|
|
|---|
The age-adjusted incidence of prostate carcinomas in AfricanAmerican men is ~50% greater than in white men (1). The associated death is also higher after adjustment for age and stage (2) and epidemiological observations have led to the hypothesis that prostate carcinoma in AfricanAmerican men is more biologically aggressive than in white men, due to genetic differences (3,4). Subtypes of the disease are linked to familial clustering and there is also a hereditary form, supporting the conclusion that genetic events may be involved in prostate cancer pathogenesis (5,6).
Linkage mapping of quantitative traits, such as blood pressure and glucose levels, with cancer susceptibility is important issue in order to isolate responsible genes. However, linkage analysis using human families faces a major problem because sufficient samples are not available because of small family sizes. In this sense, linkage analysis using laboratory animal models offers a great advantage for the mapping of genetic loci controlling a quantitative trait (quantitative trait loci) (711). We can thus use an appropriate number of animals to obtain statistically significant results. Recently, many genetic markers for rats have been isolated for this purpose (12,13). As a first step, investigation of strain differences for interesting phenotypes is necessary.
Several mouse transgenic models of prostate cancer have already been established, which may contribute to analyze molecular, cellular and physiological events in prostate carcinogenesis (14). However, rats have advantages, their larger size, for example, allowing adequate materials to be obtained. Furthermore, several rat prostate models using chemical carcinogens have been established (15,16), and data for hormone effects and modifying agents have accumulated (1726). The problem is that these models are labor intensive and require long periods to induce tumors, which are usually microscopic and not suitable for molecular biological analysis. Therefore, we have established a rat transgenic prostate cancer model using the probasin gene promoter and the SV40 T antigen gene (27). The transgenic rats also develop taste bud neuroblastomas (28).
In the present study, we investigated effects of genetic background on prostate and taste bud tumorigenesis using the probasin-SV40 Tag transgenic rat model system. Results obtained within an experimental period of 10 weeks clearly showed the presence of genetic factors modifying prostate and taste bud carcinogenesis.
| Materials and methods |
|---|
|
|
|---|
The rat probasin gene promoter region (-426 to +33) (29) was obtained by polymerase chain reaction using the primers GGAATTCAGCTTCCACAAGTGCATTTA and CATGCCATGGAGCTCTGTAGGTATCTGGAC, with addition of restriction endonuclease recognition sites of EcoRI and NcoI, respectively. The SV40 Tag gene in pBluescriptII KS(-) (VG042, pBS-SVT) was obtained from the Health Science Research Resource Bank (Osaka, Japan). The PCR products for the rat probasin gene promoter region and the SV40 Tag gene in pBluescriptII KS(-) were digested with EcoRI and NcoI and then ligated, resulting in a pBS-Probain-SVT plasmid. To prepare a linear transgene and remove plasmid sequences for microinjection, the plasmid was digested with EcoRI and BamHI, purified by agarose gel electrophoresis and recovered using a QIA quick gel extraction kit (QIAGEN, Tokyo, Japan).
Generation of transgenic rats was performed by DNX Transgenic Science (Princeton, NJ). DNA isolation from rat tails, and the PCR-base screening assay were performed as described previously (30). Sequences of the PCR primers were 5'-GTCAGCAGTAGCCTCATCAT-3' and 5'-GGTTGATTGCTACTGCTTCG-3'. Heterologous transgenic males were routinely obtained by mating heterologous transgenic males with wild type SpragueDawley rats (Clea, Tokyo, Japan).
For the present experiment, heterologous transgenic males with the SpragueDawley (SD) rats background were mated with wild type female F344, ACI, and Wistar rats (Clea), and F1 male transgenic rats were obtained with SD plus F344, ACI and Wistar as the genetic haplotype background. These were maintained until 15 weeks of age, and killed. Prostates were removed and weighed and half of each ventral lobe was immediately frozen in liquid nitrogen for RNA extraction. The remainder of the prostate was fixed in 10% buffered formalin for histological examination, then routinely processed for embedding in paraffin. Neoplastic lesions of the prostate were classified as prostatic intraepithelial neoplasia (PIN) and adenocarcinoma. PIN lesions were divided into three grades according to the glandular structure; I, similar to normal glands or slightly papillary; II, moderate papillary proliferation; III, severe papillary proliferation with occasional luminal bridging. The tongues of the transgenic rats were also removed and slices taken through the papilla circumvallata for examination of tumor cells in the taste buds. Five µm thick sections were cut and stained with H&E. The tongue tumors were divided into four stages, histologically: pTis, tumor cells within taste buds or epithelium, with no invasion of stroma; pT1, tumor cells invading the stroma but not the muscle layer; pT2, tumor cells penetrating up to upper half the muscle layer; pT3, tumor cells invading through the upper half of the muscle layer.
Immunohistochemical analyses of SV40 Tag, and androgen receptor were performed using mouse anti-SV40 large T antigen monoclonal antibody (Pharmingen, CA), and rabbit polyclonal anti-androgen receptor antibody (Affinity Bioreagents, CO). Binding was visualized with a Vectastain Elite ABC kit (Vector Lab., CA) and light hematoxylin counter-staining was conducted to facilitate microscopic examination. Photographs were taken with a digital camera (DP11, Olympus, Tokyo, Japan) and printed out using a digital printer (Pictrography 3000, Fujifilm, Tokyo, Japan).
Testosterone levels in serum were analyzed using a radioimmunoassay by a commercial laboratory (SRL, Tokyo, Japan). Total RNA extraction was performed according to the manufacturer's instructions using ISOGEN (Wako, Tokyo, Japan). One microgram of RNA after DNase treatment was converted to cDNA with avian myoblastosis virus reverse transcriptase (Takara, Otus, Japan) in 20 µl of reaction mixture. For quantitation, aliquots of 2 µl of cDNA samples were subjected to quantitative PCR in 20 µl reactions using FastStart DNA Master SYBR Green I and a Light Cycler apparatus (Roche Diagnostics, Mannheim, Germany). Primers used were: for SV40 Tag, 5'-GTCAGCAGTAGCCTCATCAT-3' and 5'-GGTTGATTGCTACTGCTTCG-3'; for probasin, 5'-TTAAAATCGTGGGAAGGAGA-3' and 5'-AAAATAATCAAACAGCAATA-3'; for the androgen-receptor, 5'-GACTATTACTTCCCACCCCAG-3' and 5'-ACATTTCCGGAGACGACACGA-3'. Initial denaturation at 95°C for 10 min was followed by 40 cycles with denaturation at 95°C for 15 s, annealing at 45°C for SV40 Tag and probasin, and at 52°C for androgen-receptor, for 5 s, and elongation at 72°C for 30 s. The fluorescence intensity of the double-strand specific SYBR Green I, reflecting the amount of formed PCR-product, was monitored at the end of each elongation step. Cyclophilin mRNA levels were used to normalize the sample cDNA content. Five samples for each strain were analyzed.
| Results |
|---|
|
|
|---|
Histological examination of the ventral prostate revealed the original transgenic rats having a pure SD background to develop adenocarcinomas at high incidence (80%), whereas F1 transgenic rats with a Wistar background demonstrated only prostate intraepithelial neoplasia (PIN), and did not have apparent carcinomas. In the ACI case, the frequency of prostate cancer was also lower, while the F344 genetic background did not affect transgenic prostate carcinogenesis (Table I
|
|
|
|
Staging of the taste bud tumors revealed that ACI hybrids had less neoplastic progression. Four out of six did not have tumors, although SV40 positive cells were observed in the taste buds (Table III
|
|
| Discussion |
|---|
|
|
|---|
Strain differences in cancer susceptibility have been investigated in several organs and used for linkage analysis to identify responsive loci and genes. Regarding prostate carcinogenesis, we previously investigated susceptibility to 3,2'-dimethyl-4-aminobiphenyl (DMAB) in five different rat strains in our laboratory (31). Carcinomas were respectively found in 46, 50, 5, 0, and 0% of F344, ACI, Lewis, CD and Wistar strain animals treated with DMAB. The tumor yield correlated well with DMBA-DNA adduct formation except in the Wistar rat case, indicating some linkage between susceptibility and metabolism of DMAB (31). This is not likely to be of direct importance for the present case, however, the transgenic rats developing androgen-dependent prostate carcinomas at very high incidence within a short period (within 15 weeks old) (27). With chemical carcinogen induction of prostate cancer in animal models malignant lesions usually take over 1 year to develop. In the present study, F1 hybrids with Wistar transgenic rats did not demonstrate prostate carcinomas, and F1 hybrids with SD and ACI had only small numbers, although both hybrids had PIN III at high incidence. Variation in testosterone levels and expression of the transgene, probasin, and androgen-receptors did not explain the results. Immunohistochemical analysis furthermore showed nuclear expression of the transgene and androgen-receptors to be uniform in prostate tumor cells in all cases, suggesting that both Wistar and ACI strains feature suppressive genetic factors for progression to prostate carcinomas from high grade PIN. In fact, the resistance of Wistar rats to DMAB-induced prostate carcinogenesis, could not be explained simply in terms of carcinogen-adducts (31). While the prostate tumors are androgen-dependent and the serum testosterone levels of SD x F344 rats were found to be considerably lower than those in the SD strain, the incidences of adenocarcinomas did not vary, again suggesting independent genetic factors. Since the number of animals used in this study was relatively small, although statistical analysis showed significant differences, another experiment should clearly be conducted to confirm the results.
Our transgenic rats develop taste bud neuroblastomas in the tongue (28), small round cell carcinomas histologically, with neuroendocrine characteristics immunohistochemically. In the present study, development of this type of tumor was completely absent in over half of the animals with an ACI haplotype genetic background. The presence of SV40 Tag positive cells even in histologically normal-appearing taste buds indicated transgene expression, but clonal expansion or cell proliferation appeared inhibited. In F1 hybrids with Wistar rats in which the prostate carcinoma development was suppressed, however, no effects were observed in the tongue. Thus, different genetic factors may be operating in the two sites.
For production of transgenic rats, the SD strain was used because it is very suitable for this purpose. However, SD animals are closed colony rats, which could be problematic because of heterogeneity of microsatellite markers. We are therefore now conducting backcrosses of the transgenic rats to the inbred F344 strain. The aim is that a transgenic rat model of prostate carcinomas with the inbred F344 genetic background could provide a superior tool for linkage analysis to identify modifier genes for prostate neoplasia.
| Notes |
|---|
1 Makoto Asamoto, Kawasumi 1, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan Email: masamoto{at}med.nagoya-cu.ac.jp
| Acknowledgments |
|---|
This study was supported by research grants from CREST (Core Research for Evolutional Science and Technology) of the Japan Science and Technology Corporation (JST), the Ministry of Health, Labour and Welfare of Japan, the Ministry of Education, Culture, Sports, Science and Technology of Japan, and the Society for Promotion of Toxicologic Pathology, Nagoya. We thank Dr Malcolm A.Moore for his kind linguistic advice during preparation of the manuscript.
| References |
|---|
|
|
|---|
- Parker,S.L., Davis,K.J., Wingo,P.A., Ries,L.A. and Heath,C.W., Jr. (1998) Cancer statistics by race and ethnicity. CA Cancer J. Clin., 48, 3148.[Abstract]
-
Robbins,A.S., Whittemore,A.S. and Van Den Eeden,S.K. (1998) Race, prostate cancer survival, and membership in a large health maintenance organization. J. Natl Cancer Inst., 90, 986990.
[Abstract/Free Full Text] - Kalapurakal,J.A., Jacob,A.N., Kim,P.Y., Najjar,D.D., Hsieh,Y.C., Ginsberg,P., Daskal,I., Asbell,S.O. and Kandpal,R.P. (1999) Racial differences in prostate cancer related to loss of heterozygosity on chromosome 8p1223. Int J. Radiat. Oncol. Biol. Phys., 45, 835840.[ISI][Medline]
- Cooney,K.A. (1998) Hereditary prostate cancer in AfricanAmerican families. Semin. Urol. Oncol., 16, 202206.[Medline]
- Narod,S. (1999) Genetic epidemiology of prostate cancer. Biochim. Biophys. Acta, 1423, F113.[Medline]
- Ekman,P. (1999) Genetic and environmental factors in prostate cancer genesis: identifying high-risk cohorts. Eur. Urol., 35, 362369.[ISI][Medline]
- Sasaki,N., Hayashizaki,Y., Muramatsu,M. et al. (1994) The gene responsible for LEC hepatitis, located on rat chromosome 16, is the homolog to the human Wilson disease gene. Biochem. Biophys. Res. Commun., 202, 512518.[ISI][Medline]
-
Pascale,R.M., Simile,M.M., DeMiglio,M.R., Muroni,M.R., Gaspa, L., Dragani,T.A. and Feo,F. (1996) The BN rat strain carries dominant hepatocarcinogen resistance loci. Carcinogenesis, 17, 17651768.
[Abstract/Free Full Text] - Kamoto,T., Mori,S., Murai,T., Yamada,Y., Makino,S., Yoshida,O. and Hiai,H. (1997) Quantitative trait loci associated with promoting effects of sodium L-ascorbate on two-stage bladder carcinogenesis in rats. Jpn. J. Cancer Res., 88, 633638.[ISI][Medline]
- Yamada,S., Shima,H., Toyota,M. et al. (1998) Linkage mapping of the Bra, Brb and Brg genes for rat protein phosphatase 2A 55 kDa B-regulatory subunit isotypes. Jpn. J. Cancer Res., 89, 10141019.[ISI][Medline]
-
Oyabu,A., Higo,K., Ye,C., Amo,H. et al. (1999) Genetic mapping of the thymoma susceptible locus, Tsr1, in BUF/Mna rats. J. Natl Cancer Inst., 91, 279282.
[Free Full Text] - Kitada,K., Voigt,B., Kondo,Y. and Serikawa,T. (2000) An integrated rat genome map based on genetic and cytogenetic data. Exp. Anim., 49, 119126.[ISI][Medline]
-
Yoshida,Y., Ushijima,T., Yamashita,S., Imai,K., Sugimura,T. and Nagao,M. (1999) Development of the arbitrarily primed-representational difference analysis method and chromosomal mapping of isolated high throughput rat genetic markers. Proc. Natl Acad. Sci. USA, 96, 610615.
[Abstract/Free Full Text] - Sharma,P. and Schreiber-Agus,N. (1999) Mouse models of prostate cancer. Oncogene, 18, 53495355.[ISI][Medline]
- Shirai,T., Takahashi,S., Cui,L., Futakuchi,M., Kato,K., Tamano,S. and Imaida,K. (2000) Experimental prostate carcinogenesis rodent models. Mutat Res., 462, 219226.[ISI][Medline]
- Lucia,M.S., Bostwick,D.G., Bosland,M. et al. (1998) Workgroup I: Rodent models of prostate cancer. Prostate, 36, 4955.[ISI][Medline]
- Shirai,T., Iwasaki,S., Masui,T., Mori,T., Kato,T. and Ito,N. (1993) Enhancing effect of cadmium on rat ventral prostate carcinogenesis induced by 3,2'-dimethyl-4-aminobiphenyl. Jpn. J. Cancer Res., 84, 10231030.[ISI][Medline]
- Shirai,T., Imaida,K., Masui,T., Iwasaki,S., Mori,T., Kato,T. and Ito,N. (1994) Effects of testosterone, dihydrotestosterone and estrogen on 3,2'-dimethyl-4-aminobiphenyl-induced rat prostate carcinogenesis. Int. J. Cancer, 57, 224228.[ISI][Medline]
- Shirai,T., Sano,M., Imaida,K., Takahashi,S., Mori,T. and Ito,N. (1994) Duration dependent induction of invasive prostatic carcinomas with pharmacological dose of testosterone propionate in rats pretreated with 3,2'-dimethyl-4-aminobiphenyl and development of androgen-independent carcinomas after castration. Cancer Lett., 83, 11116.
- Shirai,T., Tamano,S., Sano,M., Imaida,K., Hagiwara,A., Futakuchi,M., Takahashi,S. and Hirose,M. (1995) Site-specific effects of testosterone propionate on the prostate of rat pretreated with 3,2'-dimethyl-4-aminobiphenyl: dose-dependent induction of invasive carcinomas. Jpn. J. Cancer Res., 86, 645648.[ISI][Medline]
- Kawabe,M., Shibata,M.A., Sano,M., Takesada,Y., Tamano,S., Ito,N. and Shirai,T. (1997) Decrease of prostaglandin E2 and 5-bromo-2'-deoxyuridine labeling but not prostate tumor development by indomethacin treatment of rats given 3,2'-dimethyl-4-aminobiphenyl and testosterone propionate. Jpn. J. Cancer Res., 88, 350355.[ISI][Medline]
- Miyata,E., Kawabe,M., Sano,M., Takesada,Y., Takahashi,S. and Shirai,T. (1997) Effects of tamoxifen, an antiestrogen, on rat prostate carcinogenesis by 3,2'-dimethyl-4-aminobiphenyl and testosterone do not support an estrogen role in testosterone promotion. Prostate, 31, 913.[ISI][Medline]
- Cui,L., Mori,T., Takahashi,S., Imaida,K., Akagi,K., Yada,H., Yaono,M. and Shirai,T. (1998) Slight promotion effects of intermittent administration of testosterone propionate and/or diethylstilbestrol on 3,2'-dimethyl-4-aminobiphenyl-initiated rat prostate carcinogenesis. Cancer Lett., 122, 195199.[ISI][Medline]
- Tsukamoto,S., Akaza,H., Onozawa,M., Shirai,T. and Ideyama,Y. (1998) A five-alpha reductase inhibitor or an antiandrogen prevents the progression of microscopic prostate carcinoma to macroscopic carcinoma in rats. Cancer, 82, 531537.[ISI][Medline]
- Condon,M.S., Kaplan,L.A., Crivello,J.F., Horton,L. and Bosland,M.C. (1999) Multiple pathways of prostate carcinogenesis analyzed by using cultured cells isolated from rats treated with N-methyl-N-nitrosourea and testosterone. Mol. Carcinog., 25, 179186.[ISI][Medline]
-
McCormick,D.L., Rao,K.V., Steele,V.E., Lubet,R.A., Kelloff,G.J. and Bosland,M.C. (1999) Chemoprevention of rat prostate carcinogenesis by 9-cis-retinoic acid. Cancer Res., 59, 521524.
[Abstract/Free Full Text] -
Asamoto,M., Hokaiwado,N., Cho,Y.-M., Takahashi,S., Ikeda,Y., Imaida,K. and Shirai,T. (2001) Prostate carcinomas developing in transgenic rats with SV40 T antigen expression under probasin promoter control are strictly androgen dependent. Cancer Res., 61, 46934700.
[Abstract/Free Full Text] - Asamoto,M., Hokaiwado,N., Cho,Y.-M., Ikeda,Y., Takahashi,S. and Shirai,T. (2001) Metastasizing neuroblastomas from taste buds in rats transgenic for the simian virus 40 large T antigen under control of the probasin gene promoter. Toxicol. Pathol., 29, 363368.[ISI][Medline]
- Greenberg,N.M., DeMayo,F.J., Sheppard,P.C. et al. (1994) The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol. Endocrinol., 8, 230239.[Abstract]
-
Asamoto,M., Ochiya,T., Toriyama-Baba,H., Ota,T., Sekiya,T., Terada,M. and Tsuda,H. (2000) Transgenic rats carrying human c-Ha-ras proto-oncogenes are highly susceptible to N-methyl-N-nitrosourea mammary carcinogenesis. Carcinogenesis, 21, 243249.
[Abstract/Free Full Text] -
Shirai,T., Nakamura,A., Fukushima,S., Yamamoto,A., Tada,M. and Ito,N. (1990) Different carcinogenic responses in a variety of organs, including the prostate, of five different rat strains given 3,2'-dimethyl-4-aminobiphenyl. Carcinogenesis, 11, 793797.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
N. Hokaiwado, F. Takeshita, A. Naiki-Ito, M. Asamoto, T. Ochiya, and T. Shirai Glutathione S-transferase Pi mediates proliferation of androgen-independent prostate cancer cells Carcinogenesis, June 1, 2008; 29(6): 1134 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Varghese, S. D. Rabkin, G. P. Nielsen, U. MacGarvey, R. Liu, and R. L. Martuza Systemic Therapy of Spontaneous Prostate Cancer in Transgenic Mice with Oncolytic Herpes Simplex Viruses Cancer Res., October 1, 2007; 67(19): 9371 - 9379. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zeng, M. Yokohira, K. Saoo, H. Takeuchi, Y. Chen, K. Yamakawa, Y. Matsuda, Y. Kakehi, and K. Imaida Inhibition of prostate carcinogenesis in probasin/SV40 T antigen transgenic rats by raloxifene, an antiestrogen with anti-androgen action, but not nimesulide, a selective cyclooxygenase-2 inhibitor Carcinogenesis, June 1, 2005; 26(6): 1109 - 1116. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




