Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Peitsaro, P.
Right arrow Articles by Syrjänen, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peitsaro, P.
Right arrow Articles by Syrjänen, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 23, No. 6, 1057-1064, June 2002
© 2002 Oxford University Press


CARCINOGENESIS

Single copy heterozygote integration of HPV 33 in chromosomal band 5p14 is found in an epithelial cell clone with selective growth advantage

Panu Peitsaro1, Sakari Hietanen1,2, Bo Johansson1, Taina Lakkala3 and Stina Syrjänen1,4

1 Department of Oral Pathology and Oral Radiology and Medicity Research Laboratory, Faculty of Medicine, University of Turku, Finland,
2 Department of Obstetrics and Gynecology, Turku University Hospital, Turku, Finland and
3 Department of Medical Genetics, Faculty of Medicine, University of Turku, Finland


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Infection with human papillomavirus (HPV) of specific high-risk type triggers a series of events in target cells, which will eventually lead to development of genital neoplasia. The integration of high-risk HPV DNA into the cell genome has been regarded as a crucial event in tumor progression. With respect to different HPV types, the knowledge of HPV integrated loci is still limited. We have now determined the genomic variation and chromosomal location of HPV 33 DNA in the cell line UT-DEC-1, established from a vaginal mild dysplasia lesion. The viral sequence of the cell line was determined, and a variant of the prototype HPV 33 strain was identified, showing nucleotide substitutions resulting in amino acid changes in the E2, L2 and E4 open reading frames. In late passage UT-DEC-1 cells, a deletion of more than half of the 3' part of E1 and major parts of the E2 and E4 genes provided evidence for integration. The flanking sequences of the integration site were completely homologous to published sequences from chromosomal band 5p14, and remained unchanged in all subclones established from late passage cells. There were no chromosomal deletions or gross rearrangements at the integration site, and only a single heterozygotic copy of HPV 33 was detected. The karyotype of late passage cells showed only minor changes compared with early passage cells. During passaging of the cell line, there were progressive changes towards a malignant phenotype, and in parallel to this, the cells carrying episomal HPV 33 of the early passages was completely superseded by cells containing the integrated virus. Thus, our results show that this single copy heterozygote integration of HPV 33 into chromosome band 5p14 appears to be associated with emergence of cells escaping senescence, and with growth advantage compared with cells carrying episomal virus.

Abbreviations: APOT, amplification of papillomavirus oncogene transcripts; E, early region of HPV genome; HPV, human papillomavirus; L, late region of HPV genome; ORF, open reading frame; VAIN I, vaginal intraepithelial neoplasia; M-FISH, multicolor fluorescent in situ hybridization.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Human papillomaviruses (HPVs) comprise at least 100 different virus types, of which roughly 30 are associated with lesions of the anogenital tract (1). Infection with high-risk types of HPV is a well-established risk factor for the development of cervical carcinoma, which is the second most common form of cancer among women worldwide. Benign and low-grade intraepithelial lesions contain mostly the viral sequences only as episomes (13). However, viral DNA integrated into host genome is found in nearly all cases of cervical carcinoma, their metastasis and derivative cell lines (48). Cells carrying integrated viral DNA grow better in vitro, and integration has been correlated with poor prognosis (9,10).

The integration of HPV sequences into the host genome might occur randomly or with a preference in or near fragile sites or oncogenes (1115). A consequence of integration is the disruption of the episomal form and more or less extensive deletions in the HPV E1/E2 region. Thus, a repressor function of the E2 protein is eliminated, resulting in an elevated transcription of the E6 and E7 oncogenes. Continuous expression of the E6 and E7 oncoproteins is most probably required for maintenance of the malignant state (1618). These oncogenic proteins interfere with the normal cell cycle, by binding and inactivating the p53 and Rb tumor suppressor proteins, respectively (1924).

In this study, we used the HPV 33-positive cell line UT-DEC-1, derived from a vaginal intraepithelial neoplasia (VAIN I) lesion (25), as a model system to further clarify the role of HPV integration in cancer progression. The HPV 33 prototype was originally cloned from an invasive cervical carcinoma, and belongs to the group of high-risk HPV types (26). This HPV type has been found in 4–10% of cervical carcinomas and its precursors, most strikingly, in 50% of tonsillar carcinomas (27,28). The genomic organization of HPV 33 is similar to that of other papillomaviruses (29). The upstream regulatory region of the virus, however, contains a 78 bp perfect tandem repeat, which is not found in the genomes of other HPV types. This tandem repeat harbors an enhancer of the viral early promoter and in the transcription of the early region, there are some features that are specific for HPV 33. Studies of variability in the HPV 33 genome have been restricted previously to the consensus region of L1 (30).

The UT-DEC-1 cell line progressed to a transformed phenotype during passaging, and acquired independence for additional growth factors, as well as anchorage support, during clonal growth (25). Furthermore, there was evidence for a change of the episomal form of HPV 33 to a form integrated into the cellular DNA during passaging (25,31). Thus, this cell line is potentially useful for studies on such integration events in transformation and progression in HPV-associated carcinogenesis.

In this study, we determined the physical state and genomic variability of HPV 33 at different passages of the UT-DEC-1 cell line to further elucidate HPV-induced pathogenesis. We have mapped the integration site both in the viral and human genome, and quantified episomal and integrated forms of HPV 33 during passaging using a real-time PCR. We report the single copy heterozygote integration site of HPV 33 DNA in chromosome 5p14 in the UT-DEC cell line. This viral-cellular DNA recombination is non-homologous and causes the deletion of viral DNA, only. The identified genomic region is likely to be implicated in the tumor phenotype.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell culture
The UT-DEC-1 cell line was derived from a HPV 33-positive VAIN I lesion as described by Hietanen et al. (25) (Figure 1Go). At the time of establishment, the cells were cultured in D-MEM supplemented with 1% non-essential amino acids, 2 mM L-glutamine, 50 µg/ml streptomycin, 100 U/ml penicillin, 1 µM dexamethasone, 10 ng/ml human recombinant epidermal growth factor and 10% fetal calf serum. From passage 19 onwards, the cells became independent of dexamethasone and epidermal growth factor. Early passage cells for present analyses were taken from cryo-preserved stocks and cultured in serum-free keratinocyte medium (Keratinocyte-SFM, Gibco, Paisley, UK).



View larger version (165K):
[in this window]
[in a new window]
 
Fig. 1. Histology of the HPV 33-positive VAIN-lesion. The micrograph shows the histology of the original VAIN-lesion from which the UT-DEC-1 cell line was established. The presence of HPV 33 DNA is detected by non-radioactive in situ hybridization. Strong positive signals are seen in the upper third of the epithelium (arrow).

 
PCR for mapping the viral genome
DNA was extracted from the UT-DEC-1 cell line according to the method of Miller et al. (32). PCR was carried out in a 50 µl reaction mixture containing 250 ng of DNA sample, 20 pmol of each primer, 200 µM of each deoxynucleotide triphosphate and 1 U AmpliTaq GoldTM DNA polymerase (Perkin Elmer, Roche Molecular Systems, Branchburg, NJ) in enzyme-specific GeneAmp® PCR buffer (Perkin Elmer). The template DNA was first denatured at 94°C for 10 min, after which 35 amplification cycles were carried out as follows: DNA denaturation at 94°C for 1 min, annealing at 55–60°C for 1 min and extension at 72°C for 1 min. The final extension step was prolonged with another 7 min at 72°C. The PCR products were analyzed on ethidium bromide-stained agarose gel (SeaKem LE agarose, FMC Bioproducts, Rockland, ME).

Assay for integration
Integration (3' breakpoint) was scored using the APOT (amplification of papillomavirus oncogene transcripts) assay of Ruediger et al. (33) developed for HPV 16. Total RNA was isolated from the UT-DEC-1 cell line with Trizol (Life Technologies, Gibco-BRL, Karlsruhe, Germany). cDNA was synthesized from 5 µg of total RNA in a 33 µl reaction volume with First-Strand synthesis kit (Amersham Pharmacia Biotech, Uppsala, Sweden) and was primed using the oligo(dT)17 adaptor primer, as described by Ruediger et al. (33). The PCR products were generated using the HPV 33 upstream E6 or E7 primers described by Snijders et al. (34), together with the downstream adaptor primer. The 5' flanking sequence was identified with PCR, using serial primers targeting the 5' sequence of the identified chromosomal sequence (accession no. AC032041) and HPV 33-specific primers present in the integrated virus E2 ORF.

Subcloning of UT-DEC-1 cells and detection of integration site
Subcloning of passage 92 cells was carried out by plating the cells in eight 96 well plates at a dilution of maximally 1 cell/well. Clonal growth was observed in 22 wells from which the subclones were successfully isolated. These subclones were first tested for the presence of the E6 ORF and then analyzed for the presence of identified flanking sites with PCR using primer pairs in the human/HPV 33 E2 (5' end; human, 5'–3' AGTGAGCTAACCGTCATCTG; HPV 33 E2 5'–3' TGGATGACATAGAACTATACAAC) and HPV 33 E1/human (3' end, primers as given in Table IGo) parts. The PCR program was: denaturation at 94°C for 10 min; 35 cycles of denaturation 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 1 min; final extension at 72°C, for 7 min. The amplicons were analyzed using agarose gel electrophoresis.


View this table:
[in this window]
[in a new window]
 
Table I. TaqManTM system for real-time PCR detection of episomal and integrated HPV 33 DNAa
 
Purification and sequencing of the PCR products
The PCR products were separated in SeaKem agarose gels with l HindIII or PhiX174 HaeIII (Promega, Madison, WI, USA) as markers, and purified using QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) or excised from the agarose gel and purified using QIAquick Gel Extraction kit (Qiagen). Sequencing reactions were made using the ABI PRISM BigDyeTM Terminator Cycle Sequencing Kit (PE Applied Biosystems, Perkin Elmer, Norwalk, CT) according to the manufacturer's instructions, and analysis was carried out with automated ABI PRISM 377 DNA Sequencer (PE Applied Biosystems). Sequence analysis was performed using the DNASIS program 2.6 (Hitachi Software Engineering, Yokohama, Japan) and FASTA homology searches.

Real-time PCR
Real-time PCR was performed using the ABI Prism 7700 Sequence Detection System and the TaqMan Universal PCR Master Mix (PE Applied Biosystems). The amplification conditions were: 2 min at 50°C, 10 min at 95°C, a two-step cycle at 95°C for 15 s and 60°C for 60 s for a total of 50 cycles. The primers and probe (Table IGo) were designed with the aid of the Primer Express program, 1.0b6 (PE Applied Biosystems). For the specific amplification of episomal and integrated forms of HPV 33, the amplimer was designed to span the known integration site at genomic position 1715. Integrated virus was scored using the same upstream primer and probe used for episomal detection, but with a downstream primer from the cellular 3' junction sequence obtained in this study (Figure 2Go and Table IGo). The sizes of the episomal and integrated amplimers were 160 and 166 bp, respectively. The probe was labeled with FAM (6-carboxyfluorescein) at the 5' end and TAMRA (6-carboxy-tetramethylrhodamine) at the 3' end. Final concentrations of primers and probe, in a total volume of 50 µl, were 0.3 and 0.1 mM, respectively. Fifty nanograms of DNA, from the different passages, were added to the reaction mixture. A standard curve was obtained by amplification of a dilution series, from 5 to 5 million copies per 5 µl of sterilized water, of a clone of HPV 33 in pBR322 (kindly provided by Prof. Gerard Orth, Institut Pasteur, Paris, France). There was a linear relationship between the Ct values plotted against the log of the copy number over the entire range of dilutions (not shown). All samples were also analyzed using the ß-actin amplification kit from PE Applied Biosystems, and the HPV 33 copy number values were normalized using the results from these amplifications. At least three `no template control' reactions were included in each run. All experiments were performed twice in duplicate, with similar results.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2. Genetic map of HPV 33. (A) HPV 33 approximate genetic map positions of PCR primers (arrows) and viral mutations (triangle) in the cell line UT-DEC-1. (B) Physical map of HPV 33 DNA integrated into the cellular genome. HPV 33 genomic positions for breakage in the integrated form are indicated by arrows, and were obtained by sequencing of PCR amplimer from cellular DNA template. Below the map is a representation of the most abundant mRNA species, used for the APOT assay. The second splice site is delimited by the E1 splice donor site at nt 894 described by Snijders et al. (34), and an unknown splice acceptor site in human DNA. (C and D) Sequence alignment showing the exact 3' and 5' breakpoints. PCR products using primers in E1 and the human cellular parts were subject of direct sequencing. Junction DNA sequences from the 3' and 5' integration points deposited with GenBank under the accession numbers AF0330704 and AF330705, respectively. (E) Alignment of sequences from the HPV-unoccupied allele.

 
Cell mixing experiment
In the cell mixing experiment we mixed late passage cells (passage 160), which contained approximately one integrated virus per cell and no episomal virus and early passage cells (passage 10), which contain high level of episomal virus and very low level of the integrated virus form. The mixing ratios were 1:1, 1:10 and 1:100, respectively. The cells were allowed growth over four passages. Simultaneously cultured early and late passage cells were used as control lines. All cells were cultured and passaged in serum-free keratinocyte medium (Keratinocyte-SFM, Gibco). At each passage the genomic DNA was extracted according to the method of Miller et al. (32). Episomal and integrated virus copy numbers were analyzed with real-time PCR as described above.

Karyotyping and 24 color M-FISH analysis
Chromosome preparations for chromosome and fluorescent in situ hybridization (FISH) analysis were done on passage 150 cells using routine cytogenetic methods. For karyotyping the slides were stained with G-banding method and the karyotypes were interpreted using the International System for Cytogenetic Nomenclature criteria (35). The karyotype was carried out on 10 cells. For multicolor FISH analysis (M-FISH) the Vysis Spectra Vysion Assay (Vysis) with painting probes for all 24 human chromosomes was used. The in situ hybridization on metaphase preparates was carried out according to the protocols recommended by Vysis. The image analyzing was carried out with Cytovision cytogenetic workstation (Applied Imaging International) attached to leica DMRB microscope. M-FISH-karyotyping was carried out on 20 cells.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Physical mapping
The UT-DEC-1 cell line has now been propagated up to the passage number 170. The entire HPV 33 genome of passages 1, 46 and 92 was sequenced from >20 overlapping PCR fragments (Figure 2AGo). HPV DNA from passage 1 showed single mutations in open reading frames (ORF) E6 (nt 81) and E4 (nt 3469), and two mutations in reading frames E2 (nt 3469 and 3759) and L2 (nt 4438 and 5220) compared with the prototype HPV 33 strain (29; GenBank accession no. M12732). The mutation in E6 was upstream of the coding region, the nt 3759 mutation in E2, as well as the nt 5220 mutation in L2, were silent. However, amino acid substitutions were introduced by the second mutation in E2 (T241->P; variable `hinge' region in E2 protein), and the mutations in E4 (L48->F) and L2 (D77->N). The sequence variation pattern was the same for passages 46 and 92. However, when compared with passage 1, a large deletion in the HPV 33 DNA was found, encompassing more than half of the 3' part of E1 and major parts of the E2 and E4 genes (Figure 2BGo).

In using the APOT assay (33), amplified products were obtained from passages 16 and 117 (Figure 3Go) and subjected to DNA sequencing. The DNA sequence from passage 117 revealed a fusion transcript of viral and cellular DNA. The genomic breakpoint could be deduced from DNA sequences of PCR products of cellular DNA from passages 9 and 123, obtained by using specific HPV 33 forward primers and human cellular reverse primers (Figure 2B and CGo). A change from HPV33 to human sequence was found at position 1715 in the E1 ORF (3' side), and at position 3516 in the E2/E4 ORF (5' side) (Figure 2C and DGo). The cellular DNA sequence from the insertion points showed complete homology over at least 650 bp with the clone RP11-365F5 (accession no. AC032041) from chromosome 5, band 5p14.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3. Agarose gel with RT–PCR products from early and late passages. Lanes 1 and 6 represent the base pair size markers (PhiX174 HaeIII). Lane 2, p117 with PCR primers targeting 33E6 and adaptor. Lane 3, p16 (episomal form) with the same primers as in lane 2. Lane 4, p117 with primers targeting 33E7 and adaptor. Lane 5, p16 (episomal form) with the same primers as in lane 4. The RT–PCR products from p117 (lanes 2 and 4) represent fusion transcripts of viral and cellular DNA. The sequence analyses of the human DNA showed complete homology over at least 135 bp with a clone RP11-365F5 from chromosome 5, band 5p14.

 
However, there was a stretch of 16 nt immediately downstream of the HPV E1 sequence. This sequence showed 100% homology to the clone RP5-1128N12 (AL 109837) on chromosome 20 (nt 50166–50181). Only a single copy of HPV 33 was found, and there were no deletions or rearrangements in the chromosome region close to the site of integration. The other allele was HPV DNA unoccupied (Figure 2EGo). All the 22 subclones from passage number 92 were positive for both the 5' and 3' integration points by the presence of an amplicon of the correct size (229 and 166 bp, respectively) after agarose gel electrophoresis (not shown).

Dynamics of integration
The deduced DNA sequence of the integration point made possible the construction of a real-time PCR system for specific detection of integrated and episomal HPV 33. The primers and probe for this system are shown in Table 1Go, and cover the 3' integration point. The physical state of HPV 33 in DNA from passages 9, 15–22, 29–31 (combined passage 29, 30 and 31), 38, 45, 50, 92, 108 and 123 were assayed by real-time PCR. There was a drastic change from episomal to integrated form between passages 21 and 22 (Figure 4Go). In passages following this, episomal form was below the detection limit (~5 copies/50 ng DNA). Low-level signals from integrated HPV 33 were, however, reproducibly found by real-time PCR already at passages 9, 16 and 18, but not at passages 15, 17, 19, 20 or 21 (Figure 4Go).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. Real-time PCR detection of episomal and integrated HPV 33 sequences in different passages of cell line UT-DEC-1. Copy numbers for both episomal and integrated HPV 33 were calculated by the SDS program, using the standard curve obtained from the dilution series of the HPV 33 clone.

 
Selective growth advantage
Using the real-time PCR procedure for quantification of episomal and integrated HPV DNA described above, we show (Figure 5A and BGo) that cells with integrated virus expanded and those with episomal virus were gradually depleted during passaging in all the different mixing ratios. The same changes were detectable also in the morphology and growth kinetics of the cells.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Mixing experiment shows selective growth advantage of cells harboring integrated HPV 33. The copy numbers of episomal (A) and integrated (B) forms. UT-DEC-1 cells at p.160 and p.10 were mixed in ratios of 1:1; 1:10 and 1:100 and were grown over four passages. Episomal and integrated virus copy numbers were analyzed with real-time PCR as described in Materials and methods.

 
Karyotype and M-FISH analysis
Chromosome number of analyzed cells was mostly hypodiploid 41 but also some hypotetraploid cells were present. Chromosomes 1, 3, 4, 7, 8, 13, 14, 15, 18, 19, 21, 22 and X were either missing or took part in structural rearrangements as was shown in the earlier karyotype analysis on passages 28–30 (25). Most of the structural rearrangements were unbalanced, leading to partial monosomy of chromosome regions 1q, 3p, 4q, 8p, 10p, 13q, 21q and partial trisomy of at least chromosome regions 8q, 12q 14q and 19. M-FISH analysis could confirm unbalanced translocations der(1)t(1;8) and der(3;19) also identified in the earlier study (25) and showed the origin of unknown additional material on derivate chromosomes der(4), der(7), add(14)(p),add(15)(p), add(18)(q23) and add(22)(p) seen but not characterized in the earlier study (25) (Figure 6BGo). The M-FISH karyotype is presented in (Figure 6AGo). The main line karyotypes of the cell line UT-DEC-1 on passage 150 according to conventional karyotype analysis and M-FISH analysis are 41,X,-X,der(1)t(1;8)(q?42;q12~13),der(3;19)(q10; q10),der(4)t(4;7;13)(4pter->4q13~21::7q?22->q?31::13q?-> 13q?),der(7)t(4;7)(?;p22)t(7;21)(q3;q?),-8,del(10)(p?12),13, der(14;19)(q10;p10),der(14)?inv dup(14)(q32q31-24)t(7;14) (?;?q32),der (15)t(8;15)(q12~13;q10), der(18)t(18;12)(q23;q? 15),-21,der(22;19)(q10;?p10)/41,idem, -der(1)t(1;8)(q?42; q12~13),+i(1)(p10).



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 6. Karyotyping of UT-DEC-1 at passage 150. (A) M-FISH karyotype of a cell from UT-DEC-1 cell line on passage 150.41,X,-X,i(1)(p10),der(3;19),der(4)t(4;7;13),der(7)t(4;7;21),-8,10p-,-13,14q+,der(14;19),der(15)t(8;15),der(18)t(12;18),der(19;22),-21. The derivate chromosome der(1)t(1;8) seen in most of the cells and in earlier study (25) is not present in this cell. Instead there is an isochromosome of the short arm of chromosome 1 seen also in two other cells. (B) The structurally rearranged derivate chromosomes from cell line UT-DEC-1 on passage 150 are presented both by G-banding and M-FISH: der(1)t(1;8)(wcpl+,wcp8+),der(3;19)(wcp19+, wcp3+),der(4)t(4;7;13)(wcp4+,wcp7+,wcp13+),der(7)t(4;7;21)(wcp4+, wcp7+,wcp21+),der(14)(wcp14+,wcp?7+),der(14;19)(wcp19+,wcp14+), der(15)t(wcp8+,wcp15+),der(18)t(12;18)(wcp18+,wcp12+),der(19;22) (wcp19+,wcp22+).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Integration, resulting in the disruption of the E1 or E2 reading frames, is common for high-risk HPV types detected in carcinomas, and disruption of either of these regulatory genes increases viral immortalization capacity (36) by upregulation of the E6 and E7 genes (37,38). However, it has been reported that the integration of foreign DNA into the host genome may be another consequence of genetic instability induced by high-risk HPV E6 or E7 expression (17,39). Multiple chromosomal integration sites have been detected for HPV 16 and 18 (1113,15,4044), and chromosomal fragile sites have been suggested to be the preferential targets for viral integration (45,46). Several cytogenetic studies have demonstrated an association between common chromosomal fragile sites and the site of HPV integration (11,12,15,43). Interestingly, in the 5p14 site there is a common fragile site FRAE5 (4749), but at present, the significance of this finding for the integration of HPV 33 is unclear. This band also contains the integration site homology of Moloney murine retrovirus, Mlvi2 (50).

The karyotype analysis on UT-DEC-1 on passage 150 showed that karyotypically the cell line had remained relatively stable when compared with the analysis carried out on passages 28–30 (25).

Recurrent integration at specific chromosomal locations, such as 8q21-q24 and 12q13-q15, has been detected for HPV 18 and 16 (8,5153). Chromosome region 12q15 was seen to take part in a rearrangment in UT-DEC-1 in derivate chromosome der(18)t(18;12). In addition to this, losses of heterozygosity have been described in chromosome regions 3p14-22, 4p16, 5p15, 6p21-22, 11q23 and 17p13.3 (54). However, no rearrangements of these chromosomal regions were seen in UT-DEC-1. Amplification has been frequently mapped to the chromosome 3q+ arm (3q24-28) in invasive carcinomas (55).

In the present study, we have identified the precise integration site of HPV 33 in chromosome 5p14. The chromosome and M-FISH analysis showed that chromosome 5 is intact in UT-DEC-1. Our results support the view that the short arm of chromosome 5 is likely to be implicated in the tumor phenotype. Furthermore, we have identified a new HPV-associated locus. Several studies have indicated that the short arm of chromosome 5 might be of importance in cervical cancer and there might be a dose effect of gene located in chromosome 5 (5659).

The integration event usually involves deletions in the viral flanking sites, often several kilobases in length. Likewise, the unoccupied allele usually is completely lost or deletions occur in large areas (60). Our data show that the HPV 33 integration occurred without a single nucleotide deletion, but with a gain of an unknown 16 nt sequence at the 3' end. Moreover, the presence of an intact second allele seems to be uncommon in previous cases involving other oncogenic HPVs (61,62). The presence of heterozygosity suggests that the effects of the integration are not due to the inactivation of a tumor suppressor gene. One possible explanation for the apparent heterozygosity could be that even at late passages, the cells are multiclonal. However, the subcloning experiment showing that all 22 subclones at passage 92 shared the same 5' and 3' integration sites, strongly argues against this.

Gallego et al. (61) have identified the precise integration site of HPV 18 in cervical carcinoma cell line SW756 in chromosome region 12q15, in the papillomavirus-associated locus –2 (PAL2). At the 5' breakpoint they could also detect an insertion of 17 nt of unknown origin between the cellular and viral sequences. They suggested that these extra nucleotides were a molecular remnant of the cellular sequences originally involved in the rearrangement induced by viral DNA recombination and integration. The extra sequences (16 nt) found by us had a 100% homology to chromosome 20 (AL109837). This rearrangement might also be explained as a result of HPV 33 integration. The absence of homology between the chromosomal junction sequences and HPV 33, excludes the possibility of homologous recombination as a mechanism for integration. A possible mode of HPV DNA integration could be the same as recently known to occur during adeno-associated virus or adenovirus integration (63,64).

HPV 33 integration has been studied previously using the immortalized cervical keratinocyte cell lines CK1 to CK12 (65,66). It should be noted that HPV 33 integrated at a single and identical site in CK1 to CK10 (subclones of the transfected cells), which was also evident in the HPV 33-carrying UT-DEC-1 cell line. However, our cell line differs from the CK cell lines in several important respects. First, our cell line was established from a natural low-grade dysplasia, which acquires a transformed phenotype, and cells containing integrated virus are selected from a population carrying mainly the episomal form of the virus during passaging. Moreover, the present study is the first one assessing the genomic variation of the entire HPV 33 genome, whereas the L1 region has mostly been studied in searching for HPV 33 variants. Earlier studies have shown nucleotide substitutions at nt 3603, 6637, 6664, 6666, 6674, 6679 and 6938, of which only two resulted in amino acid change (http://hpv-web.lanl.gov).

The data showed that there was a drastic change in the cell population from cells containing episomal to those containing integrated forms, occurring over one to two passages after a lag period of 20 passages. The most probable scenario regarding the physical state of HPV 33 in the UT-DEC-1 cell line is an early integration, followed by a selective enrichment of the cells containing integrated form. A positive selection for the cells containing integrated HPV is supported by the observation that HPV 16 and HPV 18 integrated into the cellular genome provided a growth advantage to these cells (7,37,66,67). The results of the mixing experiment with `episomal' and `integrated' cells supported such selective growth advantage for the latter UT-DEC-1 cells. We could also demonstrate that although the HPV 33 strain in our cell line carries a number of mutations compared with the prototype isolate, there is no change in the mutation pattern during the passaging.

What remains to be established at this point, is what cellular and/or viral factors are responsible for the onset of this dynamic change in the physical status and consequent expression pattern of the HPV 33 genome. Also, the identified fusion transcript with viral and cellular sequences needs further studies to explore its impact on transformation.


    Notes
 
4 To whom correspondence should be addressed Email: stina.syrjanen{at}utu.fi Back


    Acknowledgments
 
Supported by grants Academy of Finland, Medical Council and Finnish Cancer Society.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. zur Hausen,H. (1996) Papillomavirus infections—a major cause of human cancers. Biochim. Biophys. Acta, 1288, F55–F78.[Medline]
  2. Syrjänen,K. and Syrjänen,S. (2000) Epidemiology of genital HPV infections, CIN and cerviacal cancer. In Papillomavirus Infections in Human Pathology. J. Wiley and Sons, London, pp. 117–140.
  3. Ylitalo,N., Josefsson,A., Melbye,M. et al. (2000) A prospective study showing long-term infection with human papillomavirus 16 before the development of cervical carcinoma in situ. Cancer Res., 60, 6027–6032.[Abstract/Free Full Text]
  4. Dürst,M., Kleinheiz,A., Hotz,M. and Gissmann,L. (1985) The physical state of human papillomavirus type 16 DNA in benign and malignant genital tumours. J. Gen. Virol., 66, 1515–1522.[Abstract/Free Full Text]
  5. Baker,C.C., Phelps,W.C., Lindgren,V., Braun,M.J., Gonda,M.A. and Howley,P.M. (1987) Structural and transcriptional analysis of human papillomavirus type 16 sequences in cervical carcinoma cell lines. J. Virol., 61, 962–971.[Abstract/Free Full Text]
  6. Reuter,S., Delius,H., Kahn,T., Hofmann,B., zur Hausen,H. and Schwarz,E. (1991) Characterization of a novel human papillomavirus DNA in the cervical carcinoma cell line ME180. J. Virol., 65, 5564–5568.[Abstract/Free Full Text]
  7. Jeon,S., Allen-Hoffmann,B.L. and Lambert,P.F. (1995) Integration of human papillomavirus type 16 into the human genome correlates with a selective growth advantage of cells. J. Virol., 69, 2989–2997.[Abstract]
  8. Sastre-Garau,X., Favre,M., Couturies,J. and Orth,G. (2000) Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours. J. Gen. Virol., 81, 1983–1993.[Abstract/Free Full Text]
  9. Unger,E.R., Vernon,S.D., Thoms,W.W., Nisenbaum,R., Spann,C.O., Horowitz,I.R., Icenogle,J.P. and Reeves,W.C. (1995) Human papillomavirus and disease-free survival in FIGO stage Ib cervical cancer. J. Infect. Dis., 172, 1184–1190.[ISI][Medline]
  10. Kalantari,M., Karlsen,F., Kristensen,G., Holm,R., Hagmar,B. and Johansson,B. (1998) Disruption of the E1 and E2 reading frames of HPV 16 in cervical carcinoma is associated with poor prognosis. Int. J. Gynecol. Pathol., 17, 146–153.[ISI][Medline]
  11. Cannizzarro,L.A., Dürst,M., Mendez,M.J., Hecht,B.K. and Hecht,F. (1988) Regional chromosome localization of human papillomavirus integration sites near fragile sites, oncogenes and cancer chromosome breakpoints. Cancer Genet. Cytogenet., 33, 93–98.[ISI][Medline]
  12. Popescu,N.C., Zimonjic,D. and Dipaolo,J.A. (1990) Viral integration, fragile sites and proto-oncogenes in human neoplasia. Hum. Genet., 84, 383–386.[ISI][Medline]
  13. Koopman,L.A., Szuhai,K., van Eedenburg,J.D.H., Bezrookove,V., Kenter,G.G., Schuuring,E., Tanke,H. and Fleuren,G.J. (1999) Recurrent integration of human papillomaviruses 16, 45, and 67 near translocation breakpoints in new cervical cancer cell lines. Cancer Res., 59, 5615–5624.[Abstract/Free Full Text]
  14. Lazo,P.A., Gallego,M.I., Ballester,S. and Feduchi,E. (1992) Genetic alterations by human papillomaviruses in oncogenesis. Fed. Eur. Biochem. Soc., 300, 109–113.
  15. Wilke,C.M., Hall,B.K., Hoge,A., Paradee,W., Smith,D.I. and Glover,T.W. (1996) FRA3B extends over a broad region and contains a spontaneous HPV16 integration site: direct evidence for the coincidence of viral integration sites and fragile sites. Hum. Mol. Genet., 2, 187–195.
  16. Rohlfs,M., Winkenbach,S., Meyer,S., Rupp,T. and Dürst,M. (1991) Viral transcription in human keratinocyte cell lines immortalized by human papillomavirus type-16. Virology, 183, 331–342.[ISI][Medline]
  17. Jeon,S. and Lambert,P.F. (1995) Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: implications for cervical carcinogenesis. Proc. Natl Acad. Sci. USA, 92, 1654–1658.[Abstract/Free Full Text]
  18. Francis,D.A., Schmid,S.I. and Howley,P.M. (2000) Repression of the integrated papillomavirus E6/E7 promoter is required for growth suppression of cervical cancer cells. J. Virol., 74, 2679–2687.[Abstract/Free Full Text]
  19. Dyson,N, Howley,P.M., Munger,K. and Harlow,E. (1989) The human papillomavirus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science, 243, 934–937.[Abstract/Free Full Text]
  20. Wernes,B.A., Levine,A.J. and Howley,P.M. (1990) Association of human papillomavirus type 16 and 18 E6 proteins with p53. Science, 248, 76–79.
  21. Scheffner,M., Werness,B A., Huibregtse,J.M., Levine,A.J. and Howley,P.M. (1990) The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell, 63, 1129–1136.[ISI][Medline]
  22. Massimi,P. and Banks,L. (1997) Repression of p53 transcriptional activity by the HPV E7 proteins. Virology, 227, 255–229.[ISI][Medline]
  23. Kubbutat,M.H.G. and Voudsen,K.H. (1996) Role of E6 and E7 oncoproteins in HPV-induced anogenital malignancies. Semin. Virol., 7, 925–304.
  24. Hietanen,S., Lain,S., Krausz,E., Blattner,C. and LaneD.P. (2000) Activation of p53 in cervical carcinoma cells by small molecules. Proc. Natl Acad. Sci. USA, 97, 8501–8506.[Abstract/Free Full Text]
  25. Hietanen,S., Auvinen,E., Grénman,S., Lakkala,T., Sajantila,A., Klemi,P. and Mäenpää,J. (1992) Isolation of two keratinocyte cell lines derived from HPV-positive dysplastic vaginal lesions. Int. J. Cancer, 52, 391–398.[ISI][Medline]
  26. Beaudenon,S., Kremsdorf,D., Croissant,O., Jablonska,S., Wain-Hobson,S. and Orth,G. (1986) A novel type of human papillomavirus associated with genital neoplasias. Nature, 321, 246–249.[Medline]
  27. Snijders,P.J.F., van den Brule,A.J.C., Schrijnemakers,H.F.J., Raaphorst,P.M.C., Neijer,C.J.L. and Walboomers, J.M.M. (1992) Human papillomavirus type 33 in tonsillar carcinoma generates its putative E7 mRNA via two E6* transcript species which are terminated at different early region poly(A) sites. J. Virol., 66, 3172–3178.[Abstract/Free Full Text]
  28. Walboomers,J.M.M., Jacobs,M.V., Manos,M.M., Bosch,F.X., Kummer,J.A., Shah,K.V., Snijders,P.J.F., Peto,J., Meijer,C.J.L.M. and Muñoz,N. (1999) Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J. Pathol., 189, 12–19.[ISI][Medline]
  29. Cole,S.T. and Streeck,R.E. (1986) Genome organization and nucleotide sequence of human papillomavirus type 33, which is associated with cervical cancer. J. Virol., 58, 991–995.[Abstract/Free Full Text]
  30. Stewart,A.C., Eriksson,A.M., Manos,M.M., Munoz,N., Bosch,F.X., Peto,J. and Wheeler,C.M. (1996) Intratype variation in 12 human papillomavirus types: a worldwide perspective. J. Virol., 70, 3127–3136.[Abstract]
  31. Hietanen,S.H., Syrjänen,K. and Syrjänen,S. (1998) Characterization of keratin and cell cycle protein expression in cell lines from squamous intraepithelial lesions progessing towards a malignant phenotype. Br. J. Cancer, 77, 766–775.[ISI][Medline]
  32. Miller,S.A., Dykes,D.D. and Polesky,H.F. (1988) A simple salting out procedure for extractin DNA from human nucleated cells. Nucleic Acids Res., 16, 1215.[Free Full Text]
  33. Ruediger,K., Woerner,S.M., Ridder,R., Wentzensen,N., Dürst,M., Schneider,A., Lotz,B., Melsheimer,P. and von Knebel Doeberitz,M. (1999) Detection of high-risk cervical intraepithelial neoplasia and cervical cancer by amplification of transcripts derived from integrated papillomavirus oncogenes. Cancer Res., 59, 6132–6136.[Abstract/Free Full Text]
  34. Snijders,P.J.F., van den Brule,A.J.C., Schrijnemakers,H.F.J., Raaphorst,P.M.C., Meijer,C.J.L.M. and Walboomers,J.M.M. (1992) Human papillomavirus type 33 in a tonsillar carcinoma generates its putative E7 mRNA via two E6* transcript species which are terminated at different early region poly(A) sites. J. Virol., 66, 3172–3178.
  35. International System for Cytogenetic Nomenclature (1995) In Mitelman,F. (ed.) An International System for Human Cytogenetic Nomenclature. S. Karger, Basel, 1995.
  36. Romanczuk,H. and Howley,P.M. (1992) Disruption of either the E1 or the E2 regulatory gene of human papillomavirus type 16 increases viral immortalization capacity. Proc. Natl Acad. Sci. USA, 89, 3159–3163.[Abstract/Free Full Text]
  37. Yokoyama,M., Nakao,Y., Yang,X., Sun,Q., Tsutsumi,K., Pater,A. and Pater,M.M. (1995) Alterations in physical state and expression of human papillomavirus type 18 DNA following crisis and establishment of immortalized ectocervical cells. Virus Res., 37, 139–151.[ISI][Medline]
  38. Nishikawa,A., Yamashita,T., Shimada,M., Fujinaga,Y., Yamakawa,Y., Fukushima,M., Kudo,R. and Fujinaga,K. (1996) Structural and expressional alterations of episomal and integrated human papillomavirus type 16 in precancerous lesions and carcinomas of the cervix. Tumor Res., 31, 73–88.
  39. Kessis,T.D., Conolly,D.C., Hedrick,L. and Cho,K.R. (1996) Expression of HPV16 E6 or E7 increases integration of foreign DNA. Oncogene, 13, 427–431.[ISI][Medline]
  40. Dürst,M., Croce,C.M., Gissmann,L., Schwarz,E. and Huebner,K. (1987) Papillomavirus sequences integrate near cellular oncogenes in some cervical carcinomas. Proc. Natl Acad. Sci. USA, 84, 1070–1074.[Abstract/Free Full Text]
  41. Minscheva,A., Gissman,L. and zur Hausen,H. (1987) Chromosomal integration sites of human papillomavirus DNA in three cervical cancer cell lines mapped by in situ hybridization. Med. Microbiol. Immunol., 176, 245–256.[Medline]
  42. Lazo,P.A. (1988) Rearrangement of both alleles of human chromosome 8 in HeLa cells, one of them as a result of papillomavirus DNA. J. Biol. Chem., 263, 360–367.[Abstract/Free Full Text]
  43. Popescu,N.C. and DiPaolo,J.A. (1990) Integration of human papillomavirus 16 DNA and genomic rearrangements in immortalized human keratinocyte lines. Cancer Res., 50, 1316–1323.[Abstract/Free Full Text]
  44. Gallego,M.I., Zimonjic,D.B., Popescu,N.C., DiPapolo,J.A. and Lazo,P.A. (1994) Integration site of human papillomavirus type-18 DNA in chromosome band 8q22. 1 of C4-I cervical carcinoma: Dnase I hypersensitivity and methylation of cellular flanking sequences. Genes Chromo. Cancer, 9, 28–32.[ISI][Medline]
  45. Smith,P.P., Friedman,C.L., Bryant,E.M. and McDougall,J.K. (1992) Viral integration and fragile sites in human papillomavirus-immortalized human keratinocyte cell lines. Genes Chromo. Cancer, 5, 150–157.[ISI][Medline]
  46. Thorland,E.C., Myers,S.L., Persing,D.H., Sarkar,G., McGovern,R.M., Gostout,B.S. and Smith,D.I. (2000) Human papillomavirus type 16 integrations in cervical tumors frequently occur in common fragile sites. Cancer Res., 60, 5916–5921.[Abstract/Free Full Text]
  47. Yunis,J.J., Soreng,A.L. and Bowe,A.E. (1987) Fragile sites are targets of diverse mutagenes and carcinogens. Oncogene, 1, 59–69.[ISI][Medline]
  48. Yunis,J.J. (1987) Multiple recurrent genomic rearrangements and fragile sites in human cancer. Somat. Cell Mol. Genet., 13, 397–403.[ISI][Medline]
  49. Smith,D.I., Huang,H. and Wang,L. (1998) Common fragile sites and cancer. Int. J. Oncol., 12, 187–196.[ISI][Medline]
  50. Anagnou,N.P., Economou-Pachnis,A., O'Brien,S.J., Modi,W.S., Nienhuis,A.W. and Tsichlis,P.N. (1989) The human homolog of the Moloney leukemia virus integration 2 locus (MLV12) maps to band p14 of chromosome 5. Genomics, 5, 354–358.[ISI][Medline]
  51. Gallego,M.I. and Lazo,P.A. (1995) Deletion in human chromosome region 12q13-15 by integration of human papillomavirus DNA in a cervical carcinoma cell line. J. Biol. Chem., 270, 24321–24326.[Abstract/Free Full Text]
  52. Sastre-Garau,X., Schneider-Maunoury,S., Couturier,J. and Orth,G. (1990) Human papillomavirus type 16 DNA is integrated into chromosome region 12q14-q15 in a cell line derived from a vulvar intraepithelial neoplasia. Cancer Genet. Cytogenet., 44, 243–251.[ISI][Medline]
  53. Lopez-Borges,S., Gallego,M.I. and Lazo,A. (1998) Recurrent integration of papillomavirus DNA within the human 12q14-15 uterine breakpoint region in genital carcinomas. Genes Chromo. Cancer, 23: 55–60.[ISI][Medline]
  54. Popescu,N.C., Zimonjic,D.B., Simpson,S. and Dipaolo,J.A. (1995) Cumulative gene and chromosome alterations associated with in vitro neoplastic transformation of human cervical cells. Int. J. Oncol., 7, 279–285.
  55. Larson,A.A., Kern,S., Curtiss,S., Gordon,R., Cavenee,W.K. and Hampton,G.M. (1997) High resolution analysis of chromosome 3p alterations in cervical carcinoma. Cancer Res., 5, 4082–4090.
  56. Popescu,N.C. and DiPaolo,J.A. (1989) Preferential sites for viral integration on mammalian genome. Cancer Genet. Cytogenet., 42, 157–171.[ISI][Medline]
  57. Atkin,N.B., Baker,M.C. and Fox,M.F. (1990) Chromosome changes in 43 carcinomas of the cervix uteri. Cancer Genet. Cytogenet., 44, 229–241.[ISI][Medline]
  58. Heselmeyer,K., Macville,M., Schrök,E., Blegen,H., Hellström,A-C., Shah,K., Auer,G. and Ried,T. (1997) Advanced-stage cervical carcinomas are defined by a recurrent pattern of chromosomal aberrations revealing high genetic instability and a consistent gain of chromosome arm 3q. Genes Chromo. Cancer, 19, 233–240.[ISI][Medline]
  59. De BraekeleerM., Sreekantaiah,C. and Haas,O. (1992) Herpes simplex virus and human papillomavirus sites correlate with chromosomal breakpoints in human cervical carcinoma. Cancer Genet. Cytogenet., 59, 135–137.[ISI][Medline]
  60. Choo,K.-B., Chen,C.-M., Han,C.-P., Cheng,W.T.K. and Au,L.-C. (1996) Frequent viral integration in topologically destablished and transcriptionally active chromosomal regions. J. Med. Virol., 49, 15–22.[ISI][Medline]
  61. Gallego,M.I., Schoenmakers,E.F.P.M., Van de Ven,W.J.M. and LazoP.A. (1997) Complex genomic rearrangement within the 12q15 multiple aberration region induced by integrated human papillomavirus 18 in a cervical carcinoma cell line. Mol. Carcinogen., 19, 114–121.[ISI][Medline]
  62. Bauer-Hofmann,R., Borghouts,C., Auvinen,E., Bourda,E., Rösl,F. and Alonso,A. (1996) Genomic cloning and characterization of the nonoccupied allele corresponging to the integration site of human papillomavirus type 16 DNA in the cervical cancer cell line SiHa. Virology, 217, 33–41.[ISI][Medline]
  63. Doerfler,W. (1996) A new concept in (adenoviral) oncogenesis: integration of foreign DNA and its consequences. Biochim. Biophys. Acta, 1288, F79–F99.[Medline]
  64. Linden,R.M., Ward,P., Giraud,C., Winocour,E. and Berns,K.I. (1996) Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA, 93, 11288–11294.[Abstract/Free Full Text]
  65. Gilles,C., Piette,J., Rombouts,S., Laurent,C. and Foidart,J.M. (1993) Immortalization of human cervical keratinocytes by human papillomavirus type 33. Int. J. Cancer, 53, 872–879.[ISI][Medline]
  66. Gilles,C., Piette,J., Ploton,D., Doco-Fenzy,M. and Foidart,J.M. (1996) Viral integration sites in human papilloma virus-33-immortalized cervical keratinocyte cell lines. Cancer Genet. Cytogenet., 90, 63–69.[ISI][Medline]
  67. Solinas-Toldo,S., Dürst,M. and Licher,P. (1997) Specific chromosomal imbalances in human papillomavirus-transfected cells during progression toward immortality. Proc. Natl Acad. Sci. USA, 94, 3854–3859.[Abstract/Free Full Text]
Received December 28, 2001; revised March 6, 2002; accepted March 7, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Clin. Pathol.Home page
S-M A Kulmala, S M Syrjanen, U B Gyllensten, I P Shabalova, N Petrovichev, P Tosi, K J Syrjanen, and B C Johansson
Early integration of high copy HPV16 detectable in women with normal and low grade cervical cytology and histology
J. Clin. Pathol., May 1, 2006; 59(5): 513 - 517.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Wentzensen, S. Vinokurova, and M. v. K. Doeberitz
Systematic Review of Genomic Integration Sites of Human Papillomavirus Genomes in Epithelial Dysplasia and Invasive Cancer of the Female Lower Genital Tract
Cancer Res., June 1, 2004; 64(11): 3878 - 3884.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Peitsaro, P.
Right arrow Articles by Syrjänen, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peitsaro, P.
Right arrow Articles by Syrjänen, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?