Carcinogenesis, Vol. 23, No. 9, 1511-1518,
September 2002
© 2002 Oxford University Press
CARCINOGENESIS |
Cigarette smoke condensate activates nuclear transcription factor-
B through phosphorylation and degradation of I
B
: correlation with induction of cyclooxygenase-2
Cytokine Research Laboratory, Department of Bioimmunotherapy, Box 143, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030 and
1 Division of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, Lexington, KY 40536-0082, USA
| Abstract |
|---|
|
|
|---|
Cigarette smoke (CS) contains several carcinogens known to initiate and promote tumorigenesis and metastasis. Because various genes that mediate carcinogenesis and tumorigenesis are regulated by nuclear factor-
B (NF-
B), we postulated that the effects of CS must be mediated through activation of this transcription factor. Therefore, in the present report we investigated whether cigarette smoke condensate (CSC) activates NF-
B, and whether the pathway employed for activation is similar to that of TNF, one of the potent activators of NF-
B. Our results show that the treatment of human histiocytic lymphoma U-937 cells with CSC activated NF-
B in a dose- and time-dependent manner. The kinetics of NF-
B activation by CSC was comparable with that of TNF. CSC-induced NF-
B activation was not cell type-specific, as it also activated NF-
B in T cells (Jurkat), lung cells (H1299), and head and neck squamous cell lines (1483 and 14B). Activation of NF-
B by CSC correlated with time-dependent degradation of I
B
, an inhibitor of NF-
B. Further studies revealed that CSC induced phosphorylation of the serine residue at position 32 in I
B
. In vitro immunocomplex kinase assays showed that CSC activated I
B
kinase (IKK). The suppression of CSC-activated NF-
B-dependent reporter gene expression by dominant negative form of I
B
, TRAF2, NIK and IKK suggests a similarity to the TNF-induced pathway for NF-
B. CSC also induced the expression of cyclooxygenase-2, an NF-
B regulated gene product. Overall, our results indicate that through phosphorylation and degradation of I
B
, CSC can activate NF-
B in a wide a variety of cells, and this may play a role in CS-induced carcinogenesis.
Abbreviations: B[a]P, benzo[a]pyrene; COPD, chronic obstructive pulmonary disease; COX-2, cyclooxygenase; CS, cigarette smoke; CSC, cigarette smoke condensate; EMSA, electrophoretic mobility shift assay; IL, interleukin; NF-
B, nuclear transcription factor-
B
| Introduction |
|---|
|
|
|---|
Cigarette smoke (CS) is a major risk factor for a number of diseases including cancer, chronic obstructive pulmonary disease (COPD) and cardiovascular disease. Smokers exhibit high incidence of lung cancer, which is the leading cause of cancer mortality in men and women (1). Both active and passive smoking have been implicated in lung cancer. Additionally, cancers of the other sites, e.g. larynx, oral cavity, pharynx, esophagus, pancreas, kidney and bladder are also associated with smoking. Worldwide, 15% of all cancer cases are attributed to CS. Recent estimates indicates that CS causes
8090% of lung cancer in the US (2).
CS is a complex chemical mixture containing
4800 different compounds, of which
100 are known carcinogens, co-carcinogens, mutagens and/or tumor promoters (3). Metabolites of tobacco-specific N-nitrosamines, like 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and polycyclic aromatic hydrocarbons, like diolepoxides of benzo[a]pyrene (B[a]P) are believed to be the primary tobacco carcinogens (4), although other smoke constituents like high levels of free radicals may also play a role. For example each puff of smoke contains over 10 trillion free radicals present in both mainstream and sidestream smoke, which also may contribute to both tumor initiation as well as promotion. One common feature in the pathogenesis of various smoking-associated diseases is inflammation. Yet, the mechanisms underlying the role of smoking in these diseases is presently unknown or poorly understood. Additionally, exposure of cells to B[a]P also mutates p53 gene at the same location as found in 60% of lung cancer patients (5). A tobacco-specific N-nitrosamine or cigarette smoke condensate (CSC) causes neoplastic transformation of xenotransplanted human bronchial epithelial cells (6).
Nuclear transcription factor-
B (NF-
B) is a ubiquitous nuclear transcription factor that plays a major regulatory role in inflammation. It resides in the inactive state in cytoplasm as a heterotrimer consisting of p50, p65,and I
B
subunits. This transcription factor is a dimeric complex composed of different members of the Rel/NF-
B family of polypeptides (for refs, see 7). The p50p65 heterodimer is retained in the cytoplasm by the inhibitory subunit I
B
. On activation of the complex, I
B
sequentially undergoes phosphorylation, ubiquitination and degradation, thus releasing the p50p65 heterodimer for translocation to the nucleus. An I
B
kinase, IKK, has been identified that phosphorylates serine residues in I
B
at position 32 and 36 (8). Treatment of cells with various inflammatory and oxidative stress stimuli activates the IKK, thus leading to the degradation of I
B
and activation of the transcription factor.
Whether CS or its components cause tumor development through the NF-
B activation pathway is not understood. We postulate that the effects of CS in tumorigenesis are mediated through NF-
B activation for several reasons: (i) CS is known to increase oxidative stress and the latter is known to activate NF-
B; (ii) NF-
B activation has been implicated in chemical carcinogenesis and tumorigenesis (9,10); (iii) expression of several genes, such as cyclooxygenase (COX)-2, MMP-9, iNOS, TNF, interleukin (IL)-8, cell surface adhesion molecules, and antiapoptotic proteins involved in tumor initiation, tumor promotion, and metastasis are regulated by NF-
B (for refs, see 11). Therefore, in the present report we investigated whether CSC can activate NF-
B, and whether the pathway employed for activation is similar to that of TNF, an inducer of NF-
B with a well-defined pathway. We demonstrate that CSC activates NF-
B in a wide variety of different cell types and that this activation is mediated through induction of IKK leading to phosphorylation and degradation of I
B
.
| Materials and methods |
|---|
|
|
|---|
Materials
Bacteria-derived human rTNF with a specific activity of 5x107 U/mg, was a kind gift from Genentech (South San Francisco, CA). Penicillin, streptomycin, RPMI 1640 medium and FBS were obtained from Life Technologies (Grand Island, NY). Tris, glycine, NaCl, SDS, PMA and BSA were obtained from Sigma Chemical (St Louis, MO). Rabbit polyclonal antibodies to I
B
, p50 and p65 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). I
B
-Ser32-phospho-specific polyclonal antibodies were obtained from New England BioLab (Beverly, MA). Monoclonal antibodies to IKK
and IKKß were kindly provided by Imgenex (San Diego, CA) and antibodies against COX-2 were obtained from Transduction Laboratories (Lexington, KY). Expression plasmids encoding FLAG-tagged NIK (12) were kindly provided by Dr David Wallach (Weizmann Institute of Science, Rehovot, Israel). The expression plasmids encoding myc-tagged TRAF2, NIK, p65 and dominant negative (DN)-I
B
have been described previously (13).
Cell culture
Human histiocytic lymphoma (U937), human epithelial (HeLa) and human T (Jurkat) cells were obtained from American Type Culture Collection (IL). Human lung epithelial cells (H1299), human head and neck cancer cell lines (14B and 1483) were kindly supplied by Dr Reuben Lotan (University of Texas M. D. Anderson Cancer Center, Houston, TX). U937 and Jurkat cells were grown in RPMI-1640 containing 10% FBS, A293 and HeLa cells were grown in MEM containing 10% FBS, and the remaining three cell lines were cultured in DMEM/F12 containing 10% FBS. Cells were subcultured every 3 days. For most studies human monocytic cell line U937 was used because a significant amount of information is available about the mechanism of NF-
B activation in these cells and this cell line is routinely employed in our laboratory to study NF-
B.
Preparation of CSC
The CSC was prepared from the University of Kentucky Reference Cigarette 1R4F (9 mg tar and 0.8 mg nicotine/cigarette). The `tar' or particulate phase of smoke was collected on a Cambridge filter pad from cigarettes using a smoking machine set to a 35 ml puff vol of 2 s duration under standard conditions prescribed by Federal Trade Commission (14). The smoke particulate matter was dissolved in DMSO at 40 mg/ml, aliquoted into small vials and stored frozen at 80°C. On the day of the experiment, each vial of CSC solution was opened and diluted in the serum-free cell culture medium to desired concentration, vortexed vigorously and used for treatment of cells. Control cells were treated with medium containing an equivalent amount of DMSO. Repeated freezing and thawing of the CSC solution was avoided as much as possible.
Electrophoretic mobility shift assay (EMSA)
U937 cells (2x106/ml) were treated with different concentrations of either CSC (0, 0.01, 0.1, 1 or 10 µg/ml) or TNF (0, 0.01, 0.1 or 1 nM) in serum-free medium for 30 min at 37°C for doseresponse and 10 ug/ml CSC or 0.1 nM TNF at 0, 5, 15, 30, 60 and 120 min. NF-
B activation was analyzed by EMSA as described (15). In brief, 8-µg nuclear extracts prepared from CSC-treated or untreated cells were incubated with 32P-end-labeled 45mer double-stranded NF-
B oligonucleotide from human immunodeficiency virus-1 long terminal repeat (5'-TTGTTACAA GGGACTTTCCGCTGGGGACTTTCCAG GGAGGCGTGG-3'; underline sequence indicates the binding site) for 15 min at 37°C, and the DNAprotein complex resolved in a 6.6% native polyacrylamide gel. The specificity of binding was examined by competition with unlabeled 100-fold excess oligonucleotide and with mutant oligonucleotide. The composition and specificity of binding was also determined by supershift of the DNAprotein complex using specific and irrelevant antibodies. For the supershift experiment, the antibody-treated samples of NF-
B were resolved on a 5% native gel. The radioactive bands from the dried gels were visualized and quantified by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) using ImageQuant software (Molecular Dynamics).
IKK assay
The IKK assay was performed by a method described earlier (16). Briefly, IKK signalosomes were precipitated by treating 300 µg of cytoplasmic extracts with 1 µg IKK
antibody, followed by treatment with 20 µl protein A/G Sepharose (Pierce). The beads were washed three times with lysis buffer and three times with kinase assay buffer. Beads were then resuspended in 20 µl kinase assay mixture containing 50 mM HEPES (pH 7.4), 20 mM MgCl2, 2 mM DTT, 20 µCi
-ATP, 10 µM unlabeled ATP and 2 µg substrate [GST-I
B
(154)]. The mixture was incubated at 30°C for 30 min, and the reaction was terminated by adding 5 µl of 5x SDS sample buffer and boiling for 5 min. Finally, the protein was resolved on 10% acrylamide gel under reducing conditions. The gel was dried, and the radioactive bands were visualized by PhosphorImager as described previously. To determine the total amounts of IKK
and IKKß in each sample, 60 µg of cytoplasmic proteins were resolved on 7.5% acrylamide gels. Resolved samples were electrotransferred to nitrocellulose membranes, and the membranes were blocked with 5% non-fat milk protein for 1 h and incubated separately with IKK
and IKKß antibodies (1:500) for 1 h. The membrane was washed and treated with HRP-conjugated secondary antibodies and finally detected by chemiluminescence (ECL, Amersham Pharmacia Biotech., Arlington Heights, IL).
Western blot analysis
Thirty to sixty micrograms of whole-cell protein was resolved on 10% SDSPAGE gel. The protein was transferred to a nitrocellulose membrane, blocked with 5% non-fat milk, and probed with specific antibodies against I
B
(1:3000), phospho-I
B
(1:1000) and COX-2 (1:1000) separately. The blots were washed, exposed to HRP-conjugated secondary antibodies for 1 h, and finally detected by ECL reagent (Amersham Pharmacia Biotech.). For COX-2 assays, whole-cell extracts were prepared from treated cells (2x106 cells in 2 ml medium) and resolved on 7.5% SDSpolyacrylamide gels.
NF-
B SEAP reporter assay
The effect of TNF and CSC on NF-
B-SEAP reporter gene expression assay was based on our earlier report (13). Briefly, 293 and Hela cells (0.6x106 cells/well) were plated in 6 well plates, and cells were transfected by the calcium phosphate method (Gibco BRL) with various plasmids. At 12 h post-transfection, CSC or TNF was added to the wells in fresh serum-free medium and incubated for an additional 12 h. The supernatants were collected and assayed for SEAP activity. For this, the supernatants were centrifuged for 2 min at 13 000 g, and 25 µl of each sample was incubated with 75 µl of SEAP buffer (500 mM Tris pH 9.0 containing 0.5% BSA) at 65°C for 30 min. The plate was chilled on ice for 2 min. Then 50 µl of 1 mM 4-methylumbelliferyl phosphate was added to each well and incubated at 37°C for 2 h. The activity of SEAP was assayed on a 96 well fluorescence plate reader (Fluoroscan II labsystems, Needham, Heights, MA) with excitation set at 360 nm and emission at 460 nm.
| Results |
|---|
|
|
|---|
Several genes that are implicated in chemical carcinogenesis and tumorigenesis are regulated by NF-
B. Because of the critical role of NF-
B in these processes, we investigated the effect of CSC on NF-
B activation. Because the mechanism of NF-
B activation by TNF is better understood, throughout we used this cytokine as a control for comparison with CSC.
CSC activates NF-
B in dose- and time-dependent manner
To investigate the effect of CSC on NF-
B activation, U937 cells were treated with variable concentrations of either TNF for 30 min or CSC for 60 min, nuclear extracts prepared and NF-
B activation examined by EMSA. As shown in Figure 1A
, TNF activated NF-
B at 0.1 nM and produced a slight additional increase at 1 nM. CSC activated NF-
B at 0.1 µg/ml and reached optimum activation at 110 µg/ml. To examine the kinetics of NF-
B activation, cells were treated with either 0.1 nM TNF or with 10 µg/ml CSC for different times. The result shown in Figure 1B
indicates that an optimum NF-
B activation by CSC could be seen within 15 min, which was comparable with the kinetics of TNF.
|
CSC-activated NF-
B consists of p50 and p65 subunitsVarious combinations of Rel/NF-
B proteins can constitute an active NF-
B heterodimer that binds to specific sequences in DNA (17). To show that the retarded band visualized by EMSA in CSC-treated cells was indeed NF-
B, we incubated nuclear extracts from CSC/TNF-activated cells with antibody to either the p50 (NF-
BI) or p65 (Rel A) subunits and then conducted EMSA. Antibodies to either subunit of NF-
B decreased the DNA binding (Figure 2
B. Excess unlabeled NF-
B (100-fold) caused complete disappearance of the band but mutant oligo did not, indicating the specificity of NF-
B. These EMSA results thus suggest that CSC induced NF-
B activation in monocytic U937 cells.
|
Activation of NF-
B by CSC is not cell type-specificThat distinct signal transduction pathways could mediate NF-
B induction in epithelial and lymphoid cells has been demonstrated (1820). All the effects of CSC described thus far were with U937 cells. Whether CSC could activate NF-
B in cell types other than myeloid cells, was investigated. To probe whether CSC also activates NF-
B in other cells, T-cell (Jurkat), lung cancer cell (H1299) and squamous cell carcinoma (1483 and 14B) were treated with CSC and nuclear extracts were analyzed by EMSA. CSC activated NF-
B in all four cell types tested, although the activation was low compared with that by TNF (Figure 3
B in a wide variety of different cell types.
|
CSC induces degradation of I
B
In the previous sections, we have seen that CSC activates NF-
B in different cell lines, but it was not clear how NF-
B is activated. Although TNF-induced NF-
B activation requires degradation of I
B
(21), no I
B
degradation occurs for NF-
B activated by H2O2, X-rays,
-radiation and pervanadate treatment (2226). Thus, whether CSC activates NF-
B through I
B
degradation was an open question. To determine this, we treated U937 cells with CSC for 0120 min, prepared the cytoplasmic extracts, and assayed for the I
B
degradation by western blot analysis. As shown in Figure 4A
B
degradation began to occur at 15 min of CSC treatment and was almost complete at 60 min. For comparison, TNF-induced the degradation of I
B
could be seen as early as 5 min and was complete by 10 min. These results indicate that CSC-induced NF-
B activation, like TNF-induced activation, is accompanied by I
B
degradation.
|
CSC induces the activation of I
B
kinaseTNF-induced I
B
degradation requires phosphorylation of I
B
at serine 32 and 36 (27). NF-
B activation by pervanadate and H2O2, however, require phosphorylation of I
B
at tyrosine 42 (2830). The phosphorylation of I
B
at serine 32 requires the activation of IKK (31). As CSC phosphorylated I
B
at serine 32, we directly examined the activation of IKK by immunoprecipitation of IKK using specific antibodies followed by immunocomplex kinase assays using GSTI
B
as a substrate. CSC activated IKK within 15 min of treatment (Figure 4B
and IKKß proteins, as their levels as revealed by western blot analysis were unaffected (Figure 4B
B by CSC was similar to that by TNF.
CSC activates NF-
B-dependent reporter gene expression
Although we had shown by EMSA that CSC induced the NF-
B activation, I
B
phosphorylation and degradation, and IKK activation, DNA binding alone does not always correlate with NF-
B-dependent gene transcription, suggesting there are additional regulatory steps (32). To determine the effect of CSC on NF-
B-dependent reporter gene expression, we transiently transfected the A-293 cells with the SEAP reporter construct and then treated them with different concentrations of CSC. An almost 2-fold increase in SEAP activity over the untreated vector control was noted upon stimulation with CSC (Figure 5A
). In contrast, TNF induced a 4-fold activation of the NF-
B SEAP gene reporter construct. To ascertain that CSC can activate NF-
B reporter gene expression in other cell types, we transfected human epithelial HeLa cells with the reporter construct and activated with either TNF or CSC. Again both TNF and CSC induced a significant NF-
B-reporter activity (Figure 5B
). These results demonstrate that CSC-induced NF-
B was transcriptionally active and the effects were not cell type-specific.
|
DN-I
B
, DN-TRAF2, DN-NIK and DN-IKK supress CSC-induced NF-
B-dependent reporter gene expressionTNF-induced NF-
B activation is mediated through sequential interaction of the TNF receptor (TNFR1) with TRADD, TRAF2, NIK and IKK-ß, resulting in phosphorylation of I
B
(12,31,33,34). To delineate the CSC-signaling pathway leading to NF-
B activation, cells were transiently transfected with DN-TRAF2, DN-NIK and DN-IKK plasmids, along with NF-
B-SEAP plasmid, and the NF-
B-dependent SEAP expression was then monitored in CSC-treated cells. TNF-induced NF-
B activation served as a control. Suppression of TNF- or CSC-induced NF-
B reporter activity by the DN-I
B
plasmid indicates that this assay is quite specific (Figure 6
B reporter expression induced by both TNF (upper panel) and by CSC was inhibited by transfection of cells with the plasmids expressing DN-TRAF2, DN-NIK and DN-IKK. These results suggest that the pathway by which CSC activates NF-
B is similar to that of TNF.
|
CSC induces expression of COX-2
So far our results indicate that CSC activates NF-
B through activation of IKK leading to phosphorylation and degradation of I
B
and that this NF-
B is transcriptionally active. Whether CSC-induced NF-
B activation correlates with induction of COX-2, a gene regulated by NF-
B (35), was examined. U937 cells were treated with CSC for different times, the whole-cell extracts prepared and analyzed by western blot for the expression of COX-2 (Figure 7A
B regulated gene product. We have shown above that CSC induces NF-
B-dependent reporter gene expression. Whether CSC also induces COX-2 expression in A293 cells was examined. As shown in Figure 7B
|
| Discussion |
|---|
|
|
|---|
In the present report we investigated the molecular basis by which CS could mediate carcinogenesis and atherogenesis. Because of the critical role of NF-
B in carcinogenesis and atherogenesis, we investigated the ability of CSC to activate NF-
B. Our results clearly demonstrate that CSC can activate NF-
B as indicated by the formation of NF-
BDNA complex, phosphorylation and degradation of I
B
, activation of I
B
kinase, activation of NF-
B-dependent reporter gene transcription, and expression of COX-2 a gene product regulated by NF-
B. Our results also indicate that the activation of NF-
B by CSC is not cell type-specific and occurs in lymphoid, myeloid and epithelial cells. Our results also show that the pathway through which CSC activates NF-
B is very similar to that of TNF.
The chemical moiety in the CSC that activates NF-
B is not, however, clear. CS is an aerosol of complex chemical composition containing both organic and inorganic compounds, of which 4800 have been identified so far (36). Both vapor phase and particulate phase of smoke are known to possess free radicals (37,38). While the gas phase radicals are generally short-lived, the radicals in the particulate phase are relatively stable and consist of a hydroquinonesemiquinonequinone complex. (39). This complex is an active redox system capable of reducing molecular oxygen to produce superoxide, eventually leading to hydrogen peroxide and hydroxyl radicals. Another important constituent of CS are metals like cadmium and nickel, which have a long half-life. In addition, at least 40 different CS carcinogens have been implicated in tumor initiation and promotion (40). These cacinogens include nitrosamine, polynuclear aromatic hydrocarbons, aromatic amines, unsaturated aldehydyes (e.g. crotonaldehyde) and some phenolic compounds (acrolein). The most potent carcinogenic agent contained in CS is the NNK, formed by nitrosation of nicotine; it is thought to be an important etiological factor in tobacco smoke-related human cancers (41). NNK is a site-specific carcinogen in that irrespective of the route of admininstration, NNK has remarkable specificity for the lung (42).
H2O2, a constituent of the CS, is known to activate NF-
B (30). It is unlikely, however, that NF-
B activation observed in our studies was due to H2O2 present in the CSC. Because first, particulate matter of CSC contains very little H2O2 (43); secondly, H2O2 activates NF-
B not through serine but tyrosine phosphorylation of I
B
(30). NO2, another constituent of CSC (44), also is unlikely because it is not known to activate NF-
B. The CSC also contains B[a]P, a well-known potent carcinogen. Two recent reports indicate that B[a]P can activate NF-
B (45,46). It is unlikely, however, that in our studies the activation of NF-
B is due to the B[a]P present in CSC. First, the concentration of B[a]P in CSC is not sufficient to activate NF-
B; secondly, the level of NF-
B binding activity observed following treatment with B[a]P is very minimal as compared with that noted in our studies (45,46). Whether NNK, a lung carcinogen, can activate NF-
B, however, is not clear. Some of our preliminary studies indicate that NNK alone is not sufficient to activate NF-
B. Thus, it is quite probable that NF-
B activation observed in our studies is due to a mixture of inducers present in the CSC.
Our results indicate that CSC can activate NF-
B in a wide variety of cells including myeloid cells, lymphoid cells, lung epithelial cells and in head and neck squamous cell carcinoma cells. Whether CSC activates NF-
B in all these cell types through identical mechanism is, however, not clear. Published reports indicate that the mechanism of NF-
B activation may vary from one cell type to another (19,20). For instance, protein kinase C inhibitor calphostin C, blocked NF-
B activation by TNF in Jurkat cells but not in MCF-7 A/Z cells (19). Similarily, PTEN, a dual specificity lipid phosphatase, inhibited TNF-induced NF-
B activation in PC-3 cells but not in DU145 cells, both prostate cancer cell lines (20).
Our results demonstrate that CSC activates NF-
B through IKK activation leading to I
B
phosphorylation and degradation. Recently Gebel and Muller (47) showed that treatment of 3T3 murine fibroblast cells with CS-bubbled PBS causes a decrease in NF-
B activation during the first 2 h followed by an increase at 4 and 6 h. Although not clear from the data, the results suggest that 3T3 cells must have constitutive NF-
B to be downregulated by the smoke-bubbled PBS. Besides no supershift by the antibodies against the NF-
B protein or competition by excess unlabeled oligo probe was shown, to suggest it is indeed NF-
B that was being modulated by the smoke-bubbled PBS. Therefore, it is not too surprising that authors found no phosphorylation or degradation of I
B
in their experiments (47). Furthermore, it should be pointed out that the CSC preparation used in our study contained both water-soluble and insoluble constituents of smoke as compared with smoke-bubbled PBS used in the above study, which probably contained largely water-soluble fraction of smoke. Our results also indicate that CSC-induced NF-
B activation is blocked by DN TRAF-2, NIK and IKK. This suggests that CSC activates NF-
B through a pathway very similar to that of TNF. Although TNF-induced NF-
B activation is also blocked by DN forms of TRAF-2 and NIK, the deletion of genes for TRAF2 or NIK have no effect on TNF-induced NF-
B activation (33,34), suggesting an alternate pathway. Gene deletion for receptor-interacting protein or MEKK3, however, has been shown to abrogate the TNF-induced NF-
B activation (4850). Whether RIP or MEKK3 also mediate CSC-induced NF-
B activation is not known at present. Like TNF, CSC-induction of NF-
B does require the activation of IKK.
Tumorigenesis of the lung, larynx, oral cavity and pharynx, esophagus, pancreas, kidney and bladder has been linked to CS (1,2,51). Our results show that CSC can activate NF-
B in myeloid, lymphoid, and head and neck squamous cells and in lung cells. These observations suggest that CS, through NF-
B activation, has the potential to initiate carcinogenic cascade in most cell types.
How activation of NF-
B by CSC contributes to carcinogenesis and tumorigenesis is not clear. Several genes that are regulated by NF-
B can contribute to carcinogenesis and atherogenesis including gene products which block apoptosis (e.g. TRAF1, TRAF2, cIAP-1, cIAP-2, XIAP, bcl-2 and bcl-xl), gene products which promote angiogenesis (e.g. cell surface adhesion molecules on endothelial cells, vascular endothelial cell growth factor, COX-2, matrix metalloprotease-9 and urokinase plasminogen activator), and inflammatory cytokines (e.g. TNF, IL-1, IL-6 and IL-8) (for refs, see 11). Indeed the expression of adhesion molecules in cultured endothelial cells by CSC has been reported (52,53). Our studies indicate that CSC can also induce the expression of COX-2 protein. Whether the induction of COX-2 by CSC is a direct result of NF-
B activation, however, is less clear from our studies. COX-2 has been implicated in carcinogenic process (54). Additionally, the levels of COX-2 have been shown to be over expressed in patients with lung cancer, head and neck cancer or breast cancer (5558).
Our results indicate that exposure of cells for 1530 min to 110 µg/ml CSC is sufficient to activate NF-
B. Whether the concentration of CSC used in our studies is achieved by cigarette smokers is not clear. One standard research cigarette can provide up to 10 mg of the CSC (3). Based on 20 cigarettes consumed per day by human (with a body weight of 70 kg), he/she receives
6.8 mg smoke tar/kg body wt (59), resulting in exposure of lung cells to microgram quantities of tar. Thus, the cumulative dose of CS consumed by the smokers may be sufficient to activate NF-
B and induce gene expression.
The delineation of targets of CS, such as NF-
B as described here, suggests that suppression of NF-
B activation induced by CSC should diminish the CS-induced damage. CS is known to play a role not only in cancer but also in cardiovascular diseases and in COPD (60). NF-
B activation has been implicated in both cardiovascular diseases as well as in COPD (6166). Therefore, it is possible that suppression of NF-
B induced by CSC may prove useful in those diseases as well.
| Notes |
|---|
2 To whom correspondence should be addressed Email: aggarwal{at}utmdacc.mda.uth.tmc.edu
| Acknowledgments |
|---|
This research was supported by The Clayton Foundation, the National Institute of Health (P01 CA91844), Institutional Tobacco Funds and from KTRB 5-41165.
| References |
|---|
|
|
|---|
- Parkin,D.M. (1994) Cancer in developing countries. Cancer Sur., 19, 519561.
- Wingo,P.A., Ries,L.A., Giovino,G.A., Miller,D.S., Rosenberg,H.M., Shopland,D.R, Thun,M.J. and Edwards,B.K. (1999) Annual report to the nation on the status of cancer, 19731996, with a special section on lung cancer and tobacco smoking. J Natl Cancer Inst., 91, 675690.
[Abstract/Free Full Text] - Hoffmann,D., Hoffmann,I. and El-Bayomi,K. (2001) The less harmful cigarette: a controversial issue. A tribute to Ernst L. Wynder. Chem. Res. Toxicol., 14, 767790.[Web of Science][Medline]
- Hecht,S.S. (1999) Tobacco smoke carcinogens and lung cancer. J. Natl Cancer Inst., 91, 11941210.
[Abstract/Free Full Text] - Denissenko,M.F., Pao,A., Tang,M. and Pfeifer,G.P. (1996) Preferential formation of benzo[a]pyrene adducts at lung cancer mutational hotspots in P53. Science, 274, 430432.
[Abstract/Free Full Text] - Klein-Szanto,A.J., Iizasa,T., Momiki,S., Garcia-Palazzo,I. Caamano,J. Metcalf,R. Welsh,J. and Harris,CC. (1992) A tobacco-specific N-nitrosamine or cigarette smoke condensate causes neoplastic transformation of xenotransplanted human bronchial epithelial cells Proc. Natl Acad. Sci. USA, 89, 66936697.
[Abstract/Free Full Text] - Ghosh,S., May,M.J. and Kopp,E.B. (1998) NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol., 16, 225260.[Web of Science][Medline]
- Karin,M. and Ben-Neriah,Y. (2000) Phosphorylation meets ubiquitination: the control of NF-
B activity. Annu Rev Immunol., 18, 621663.[Web of Science][Medline]
- Finco,T.S., Westwick,J.K., Norris,J.L., Beg,A.A., Der,J.C. and Baldwain,A.S. Jr (1997) Oncogenic Ha-Ras-induced signaling activates NF-kappaB transcriptional activity, which is required for cellular transformation. J. Biol. Chem., 272, 2411324116.
[Abstract/Free Full Text] - Kim,D.W., Sovak,M.A., Zanieski,G. et al. (2000) Activation of NF-kappaB/Rel occurs early during neoplastic transformation of mammary cells. Carcinogenesis, 21, 871879.
[Abstract/Free Full Text] - Pahl,H.L. (1999) Activators and target genes of Rel/NF-kB transcription factors. Oncogene, 18, 68536866.[Web of Science][Medline]
- Malinin,N.L., Boldin,M.P., Kovalenko,A.V. and Wallach,D. (1997) MAP3K-related kinase involved in NF-kappaB induction by TNF, CD95 and IL-1. Nature, 385, 540.[Medline]
- Darnay,B.G., Ni,J., Moore,P.A. and Aggarwal,B.B. (1999) Activation of NF-
B by RANK requires TRAF6 and NF-
B-inducing kinase (NIK): identification of a novel TRAF6 interaction motif J. Biol. Chem., 274, 7724.[Abstract/Free Full Text] - Pillsbury,H.C. and Bright,C.C. (1972) Comparison of aliquot and complete sample procedure for the determination of nicotine in cigarette smoke. J. Assoc. Off. Anal. Chem., 55, 636638.[Medline] 15Chaturvedi,M.M., Mukhopadhyay,A. and Aggarwal,B.B. (2000) Assay for redox-sensitive transcription factors Methods Enzymol., 319, 585601.[Web of Science][Medline]
- Manna,S.K., Mukhopadhyay,A. and Aggarwal,B.B. (2000) Interferon-
suppresses activation of nuclear transcription factors NF-
B and AP-1 and potentiates TNF-induced apoptosis. J. Immunol., 164, 49274934.
- Baeuerle,P.A. and Baichwal,V.R. (1997) NF-kappa B as a frequent target for immunosuppressive and anti-inflammatory molecules Adv. Immunol., 65, 111.[Web of Science][Medline]
- Bonizzi,G., Piette,J., Merville,M.P. and Bours,V. (1997) Distinct signal transduction pathways mediate nuclear factor-
B induction by IL-1 beta in epithelial and lymphoid cells J. Immunol., 159, 5264.[Abstract]
- Bonizzi,G. (1999) Role of the protein kinase C lambda/iota isoform in nuclear factor-kappaB activation by interleukin-1beta or tumor necrosis factor-alpha: cell type specificities. Biochem. Pharm., 57, 713[Web of Science][Medline]
- Gustin,J.A., Maehama,T., Dixon,J.E. and Donner,D.B. (2001) The PTEN tumor suppressor protein inhibits tumor necrosis factor-induced nuclear factor kappa B activity. Biol. Chem., 276, 2774027744.
- Henkel,T., Machleidt,T., Alkalay,I., Kronke,M., Ben-Neriah,Y. and Baeuerle,P.A. (1993) Rapid proteolysis of I kappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature, 365, 182185.[Medline]
- Li,N. and Karin,M. (1998) Ionizing radiation and short wavelength UV activate NF-kappaB through two distinct mechanisms. Proc. Natl Acad. Sci. USA, 95, 1301213017.
[Abstract/Free Full Text] - Canty,T.G. Jr, Boyle,E.M. Jr, Farr,A., Morgan,E.N., Verrier,E.D. and Pohlman,T.H. (1999) Oxidative stress induces NF-kappaB nuclear translocation without degradation of IkappaBalpha. Circulation, 100 (19 suppl.), II361.[Medline]
- Raju,U., Gumin,G.J, Noel,F. and Tofilon,P.J. (1998) IkappaB alpha degradation is not a requirement for the X-ray-induced activation of nuclear factor kappaB in normal rat astrocytes and human brain tumour cells. Int. J. Radiat. Biol., 74, 617.[Web of Science][Medline]
- Zwacka,R.M., Zhang,Y., Zhou,W., Halldorson,J. and Engelhardt,J.F. (1998) Ischemia/reperfusion injury in the liver of BALB/c mice activates AP-1 and nuclear factor kappaB independently of IkappaB degradation. Hepatology, 28, 1022.[Web of Science][Medline]
- Imbert,V., Rupec,R.A., Livolsi,A. et al. (1996) Tyrosine phosphorylation of I kappa B-alpha activates NF-kappa B without proteolytic degradation of I kappa B-alpha. Cell, 86, 787798.[Web of Science][Medline]
- Traenckner,E.B., Pahl,H.L., Henkel,T., Schmidt,K.N., Wilk,S. and Baeuerle,P.A. (1995) Phosphorylation of human I kappa B-alpha on serines 32 and 36 controls I kappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO J., 14, 28762883.[Web of Science][Medline]
- Mukhopadhyay,A., Manna,S.K. and Aggarwal,B.B. (2000) Pervanadate-induced nuclear factor-
B activation requires tyrosine phosphorylation and degradation of IkB a: comparison with tumor necrosis factor-
. J. Biol. Chem., 275, 8549.[Abstract/Free Full Text] - Schoonbroodt,S., Ferreira,V., Best-Belpomme,M., Boelaert,J.R., Legrand-Poels,S., Korner,M. and Piette,J. (2000) Crucial role of the amino-terminal tyrosine residue 42 and the carboxyl-terminal PEST domain of I kappa B alpha in NF-kappa B activation by an oxidative stress. J. Immunol., 164, 42924300.
[Abstract/Free Full Text] - Livolsi,A., Busuttil,V., Imbert,V., Abraham,R.T. and Peyron,J.F. (2001) Tyrosine phosphorylation-dependent activation of NF-kappa B. Requirement for p56 LCK and ZAP-70 protein tyrosine kinases. Eur. J. Biochem., 268, 15081515.[Web of Science][Medline]
- Li,Z.W., Chu,W., Hu,Y., Delhase,M., Deerinck,T., Ellisman,M, Johnson,R. and Karin,M. (1999) The IKKbeta subunit of IkappaB kinase (IKK) is essential for nuclear factor kappaB activation and prevention of apoptosis. J. Exp. Med., 189, 18391845.
[Abstract/Free Full Text] - Nasuhara,Y., Adcock,I.M., Catley,M., Barnes,P.J. and Newton,R. (1999) Differential IkappaB kinase activation and IkappaBalpha degradation by interleukin-1beta and tumor necrosis factor-alpha in human U937 monocytic cells. Evidence for additional regulatory steps in kappaB-dependent transcription. J. Biol. Chem., 274, 19965.
[Abstract/Free Full Text] - Hsu,H., Shu,H.B, Pan,M.G. and Goeddel,D.V. (1996) TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell, 84, 299.[Web of Science][Medline]
- Devin,A., Lin,Y., Yamaoka,S., Li,Z., Karin,M. and Liu,Zg. (2001) The alpha and beta subunits of IkappaB kinase (IKK) mediate TRAF2-dependent IKK recruitment to tumor necrosis factor (TNF) receptor 1 in response to TNF. Mol. Cell. Biol., 21, 39863994.
[Abstract/Free Full Text] - Plummer,S.M., Holloway,K.A., Manson,M.M., Munks,R.J., Kaptein,A., Farrow,S. and Howells,L. (1999) Inhibition of cyclo-oxygenase 2 expression in colon cells by the chemopreventive agent curcumin involves inhibition of NF-kappaB activation via the NIK/IKK signalling complex. Oncogene, 18, 60136020.[Web of Science][Medline]
- Green,C.R. and Rodgman,A. (1996) The tobacco chemists' research conference: a half century of advances in analytical methodology of tobacco and its products. Recent Adv. Tob. Sci., 22, 131304
- Shinagawa,K., Tokimoto,T. and Shirane,K. (1998) Spin trapping of nitric acid in aqueous solutions of cigarette smoke. Biochem. Biophys. Res. Commun., 253, 99103.[Web of Science][Medline]
- Pryor,W.A., Stone,K., Zang,L. and Bermudez,E., (1998) Fractionation of aqueous cigarette tar extracts: fractions that contain the tar radical cause DNA damage. Chemical Res. Toxicol., 11, 441448.[Web of Science][Medline]
- Pryor,W.A. (1997) Cigarette smoke radicals and the role of free radicals in chemical carcinogenicity. Environ. Health Perspect., 105 (suppl. 4), 875882.[Web of Science][Medline]
- Smith,C.J., Livingston,S.D. and Doolittle,D.J. (1997) An international literature survey of `IARC Group I carcinogens' reported in mainstream cigarette smoke. Food Chem. Toxicol., 35, 11071130.[Web of Science][Medline]
- Hecht,S.S. (1999) Tobacco smoke carcinogens and lung cancer. J. Natl Cancer Inst., 91, 11941210.
[Abstract/Free Full Text] - Castonguay,A., Pepin,P. and Stoner,G.D. (1991) Lung tumorigenicity of NNK given orally to A/J mice: its application to chemopreventive efficacy studies. Exp. Lung Res., 17, 485499.[Web of Science][Medline]
- Nakayama,N., Church,D.F. and Pryor,W.A. (1989) Quantitative analysis of the hydrogen peroxide formed in equeous cigarette tar extracts. Free Radical Biol. Med., 7, 915.[Web of Science][Medline]
- Dooley,M.M. and Pryor,W.A. (1982) Free radical pathology: inactivation of human alpha-1-proteinase inhibitor by products from the reaction of nitrogen dioxide with hydrogen peroxide and the etiology of emphysema. Biochem. Biophys. Res. Commun., 106, 981987.[Web of Science][Medline]
- Pei,X.H., Nakanishi,Y., Takayama,K., Bai,F. and Hara,N. (1999) Benzo[a]pyrene activates the human p53 gene through induction of nuclear factor kappaB activity. J. Biol. Chem., 274, 3524035246.
[Abstract/Free Full Text] - Yan,Z., Subbaramaiah,K., Camilli,T., Zhang,F., Tanabe,T., McCaffrey,T.A., Dannenberg,A.J. and Weksler,B.B. (2000) Benzo[a]pyrene induces the transcription of cyclooxygenase-2 in vascular smooth muscle cells. Evidence for the involvement of extracellular signal-regulated kinase and NF-kB. J. Biol. Chem., 275, 49494955
[Abstract/Free Full Text] - Gebel,S. and Muller,T. (2001) The activity of NF-kappaB in Swiss 3T3 cells exposed to aqueous extracts of cigarette smoke is dependent on thioredoxin. Toxicol. Sci., 59, 7581.
[Abstract/Free Full Text] - Ting,A.T., Pimentel-Muinos,F.X. and Seed,B.(1996) RIP mediates tumor necrosis factor receptor 1 activation of NF-kappaB but not Fas/APO-1-initiated apoptosis. EMBO J., 15, 61896196.[Web of Science][Medline]
- Kelliher,M.A., Grimm,S., Ishida,Y., Kuo,F., Stanger,B.Z. and Leder,P. (1998) The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity, 8, 297303.[Web of Science][Medline]
- Yang,J., Lin,Y., Guo,Z., Cheng,J., Huang,J., Deng,L., Liao,W., Chen,Z., Liu,Zg. and Su,B. (2001) The essential role of MEKK3 in TNF-induced NF-kappaB activation. Nat. Immunol., 2, 620624.[Web of Science][Medline]
- Rivenson,A., Hoffmann,D., Prokopczyk,B., Amin,S. and Hecht,S.S. (1988) Induction of lung and exocrine pancreas tumors in F344 rats by tobacco-specific and Areca-derived N-nitrosamines. Cancer Res., 48, 69126917.
[Abstract/Free Full Text] - Kalra,V.K., Ying,Y., Deemer,K., Natarajan,R., Nadler,J.L. and Coates,T.D. (1994) Mechanism of cigarette smoke condensate induced adhesion of human monocytes to cultured endothelial cells. J. Cell. Physiol., 160, 154162.[Web of Science][Medline]
- Shen,Y., Rattan,V., Sultana,C. and Kalra,V.K. (1996) Cigarette smoke condensate-induced adhesion molecule expression and transendothelial migration of monocytes. Am. J. Physiol., 270, H1624H1633.[Medline]
- Prescott,S.M. and Fitzpatrick,F.A. (2000) Cyclooxygenase-2 and carcinogenesis. Biochim. Biophys. Acta, 1470, M69M78.[Medline]
- Hida,T., Yatabe,Y., Achiwa,H., Muramatsu,H., Kozaki,K., Nakamura,S., Ogawa,M., Mitsudomi,T., Sugiura,T. and Takahashi,T. (1998) Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res., 58, 37613764.
[Abstract/Free Full Text] - Harris,R.E., Alshafie,G.A., Abou-Issa,H. and Seibert,K. (2000) Chemoprevention of breast cancer in rats by celecoxib, a cyclooxygenase 2 inhibitor. Cancer Res., 60, 21012103.
[Abstract/Free Full Text] - Tsujii,M., Kawano,S. and DuBois,R.N. (1997) Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc. Natl Acad. Sci. USA, 94, 333633340.
[Abstract/Free Full Text] - Jaeckel,E.C., Raja,S., Tan,J., Das,S.K., Dey,S.K., Girod,D.A., Tsue,T.T. and Sanford,T.R. (2001) Correlation of expression of cyclooxygenase-2, vascular endothelial growth factor and peroxisome proliferator-activated receptor delta with head and neck squamous cell carcinoma. Arch. Otolaryngol. Head Neck Surg., 127, 12531259.
[Abstract/Free Full Text] - Binns,R. (1977) Inhalation toxicity studies on cigarette smoke. IV. Expression of the dose of smoke particulate material to the lungs of experimental animals. Toxicology, 7, 189195.[Web of Science][Medline]
- Teramoto,S. and Kume,H. (2001) The role of nuclear factor-kappa B activation in airway inflammation following adenovirus infection and COPD [Letter]. Chest, 119, 12941295.[Medline]
- Bureau,F., Bonizzi,G., Kirschvink,N., Delhalle,S., Desmecht,D., Merville,M.P., Bours,V. and Lekeux,P. (2000) Correlation between nuclear factor-kappaB activity in bronchial brushing samples and lung dysfunction in an animal model of asthma. Am. J. Resp. Crit. Care Med., 161, 13141321.
[Abstract/Free Full Text] - Feeley,B.T., Miniati,D.N., Park,A.K., Hoyt,E.G. and Robbins,R.C. (2000) Nuclear factor-kappaB transcription factor decoy treatment inhibits graft coronary artery disease after cardiac transplantation in rodents. Transplantation, 70, 15601568.[Web of Science][Medline]
- Hajra,L., Evans,A.I., Chen,M., Hyduk,S.J., Collins,T. and Cybulsky,M.I. (2000) The NF-kappa B signal transduction pathway in aortic endothelial cells is primed for activation in regions predisposed to atherosclerotic lesion formation. Proc. Natl Acad. Sci. USA, 97, 90529057.
[Abstract/Free Full Text] - Li,C., Browder,W. and Kao,R.L. (1999) Early activation of transcription factor NF-kappaB during ischemia in perfused rat heart. Am J Physiol., 276, H543H552.[Medline]
- Morishita,R., Sugimoto,T., Aoki,M. et al. (1997) In vivo transfection of cis element `decoy' against nuclear factor-kappaB binding site prevents myocardial infarction. Nat. Med., 3, 894899.[Web of Science][Medline]
- Sawa,Y., Morishita,R., Suzuki,K., Kagisaki,K., Kaneda,Y., Maeda,K., Kadoba,K. and Matsuda,H. (1997) A novel strategy for myocardial protection using in vivo transfection of cis element `decoy' against NFkappaB binding site: evidence for a role of NFkappaB in ischemia-reperfusion injury. Circulation, 96 (9 suppl.), II280II284.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K. B. Harikumar, A. B. Kunnumakkara, K. S. Ahn, P. Anand, S. Krishnan, S. Guha, and B. B. Aggarwal Modification of the cysteine residues in I{kappa}B{alpha} kinase and NF-{kappa}B (p65) by xanthohumol leads to suppression of NF-{kappa}B-regulated gene products and potentiation of apoptosis in leukemia cells Blood, February 26, 2009; 113(9): 2003 - 2013. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Aggarwal, R.V. Vijayalekshmi, and B. Sung Targeting Inflammatory Pathways for Prevention and Therapy of Cancer: Short-Term Friend, Long-Term Foe Clin. Cancer Res., January 15, 2009; 15(2): 425 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Castro, D. Kolli, A. Guerrero-Plata, R. P. Garofalo, and A. Casola Cigarette Smoke Condensate Enhances Respiratory Syncytial Virus-Induced Chemokine Release by Modulating NF-kappa B and Interferon Regulatory Factor Activation Toxicol. Sci., December 1, 2008; 106(2): 509 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yuan, J. Ma, H. Zheng, T. Shi, W. Sun, Q. Zhang, D. Lin, K. Zhang, J. He, Y. Mao, et al. Overexpression of OLC1, Cigarette Smoke, and Human Lung Tumorigenesis J Natl Cancer Inst, November 19, 2008; 100(22): 1592 - 1605. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anand, A. B. Kunnumakkara, K. B. Harikumar, K. S. Ahn, V. Badmaev, and B. B. Aggarwal Modification of Cysteine Residue in p65 Subunit of Nuclear Factor-{kappa}B (NF-{kappa}B) by Picroliv Suppresses NF-{kappa}B-Regulated Gene Products and Potentiates Apoptosis Cancer Res., November 1, 2008; 68(21): 8861 - 8870. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Baglole, S. B. Maggirwar, T. A. Gasiewicz, T. H. Thatcher, R. P. Phipps, and P. J. Sime The Aryl Hydrocarbon Receptor Attenuates Tobacco Smoke-induced Cyclooxygenase-2 and Prostaglandin Production in Lung Fibroblasts through Regulation of the NF-{kappa}B Family Member RelB J. Biol. Chem., October 24, 2008; 283(43): 28944 - 28957. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Kunnumakkara, H. Ichikawa, P. Anand, C. J. Mohankumar, P. S. Hema, M. S. Nair, and B. B. Aggarwal Coronarin D, a labdane diterpene, inhibits both constitutive and inducible nuclear factor-{kappa}B pathway activation, leading to potentiation of apoptosis, inhibition of invasion, and suppression of osteoclastogenesis Mol. Cancer Ther., October 1, 2008; 7(10): 3306 - 3317. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Chung and I. M. Adcock Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction Eur. Respir. J., June 1, 2008; 31(6): 1334 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sethi, K. S. Ahn, and B. B. Aggarwal Targeting Nuclear Factor-{kappa}B Activation Pathway by Thymoquinone: Role in Suppression of Antiapoptotic Gene Products and Enhancement of Apoptosis Mol. Cancer Res., June 1, 2008; 6(6): 1059 - 1070. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sethi, K. S. Ahn, B. Sung, and B. B. Aggarwal Pinitol targets nuclear factor-{kappa}B activation pathway leading to inhibition of gene products associated with proliferation, apoptosis, invasion, and angiogenesis Mol. Cancer Ther., June 1, 2008; 7(6): 1604 - 1614. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. T. Stathopoulos, T. P. Sherrill, W. Han, R. T. Sadikot, F. E. Yull, T. S. Blackwell, and B. Fingleton Host Nuclear Factor-{kappa}B Activation Potentiates Lung Cancer Metastasis Mol. Cancer Res., March 1, 2008; 6(3): 364 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. T. Stathopoulos, T. P. Sherrill, D.-S. Cheng, R. M. Scoggins, W. Han, V. V. Polosukhin, L. Connelly, F. E. Yull, B. Fingleton, and T. S. Blackwell Epithelial NF-{kappa}B activation promotes urethane-induced lung carcinogenesis PNAS, November 20, 2007; 104(47): 18514 - 18519. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Pandey, B. Sung, K. S. Ahn, A. B. Kunnumakkara, M. M. Chaturvedi, and B. B. Aggarwal Gambogic acid, a novel ligand for transferrin receptor, potentiates TNF-induced apoptosis through modulation of the nuclear factor-{kappa}B signaling pathway Blood, November 15, 2007; 110(10): 3517 - 3525. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sethi, K. S. Ahn, D. Xia, J. M. Kurie, and B. B. Aggarwal Targeted Deletion of MKK4 Gene Potentiates TNF-Induced Apoptosis through the Down-Regulation of NF-{kappa}B Activation and NF-{kappa}B-Regulated Antiapoptotic Gene Products J. Immunol., August 1, 2007; 179(3): 1926 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida and R. M. Tuder Pathobiology of Cigarette Smoke-Induced Chronic Obstructive Pulmonary Disease Physiol Rev, July 1, 2007; 87(3): 1047 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Pandey, S. K. Sandur, B. Sung, G. Sethi, A. B. Kunnumakkara, and B. B. Aggarwal Butein, a Tetrahydroxychalcone, Inhibits Nuclear Factor (NF)-{kappa}B and NF-{kappa}B-regulated Gene Expression through Direct Inhibition of I{kappa}B{alpha} Kinase beta on Cysteine 179 Residue J. Biol. Chem., June 15, 2007; 282(24): 17340 - 17350. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Kunnumakkara, A. S. Nair, K. S. Ahn, M. K. Pandey, Z. Yi, M. Liu, and B. B. Aggarwal Gossypin, a pentahydroxy glucosyl flavone, inhibits the transforming growth factor beta-activated kinase-1-mediated NF-{kappa}B activation pathway, leading to potentiation of apoptosis, suppression of invasion, and abrogation of osteoclastogenesis Blood, June 15, 2007; 109(12): 5112 - 5121. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Allen, S. Duffy, T. Teknos, M. Islam, Z. Chen, P. S. Albert, G. Wolf, and C. Van Waes Nuclear Factor-{kappa}B-Related Serum Factors as Longitudinal Biomarkers of Response and Survival in Advanced Oropharyngeal Carcinoma Clin. Cancer Res., June 1, 2007; 13(11): 3182 - 3190. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Kamat, G. Sethi, and B. B. Aggarwal Curcumin potentiates the apoptotic effects of chemotherapeutic agents and cytokines through down-regulation of nuclear factor-{kappa}B and nuclear factor-{kappa}B-regulated gene products in IFN-{alpha}-sensitive and IFN-{alpha}-resistant human bladder cancer cells Mol. Cancer Ther., March 1, 2007; 6(3): 1022 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Ahn, G. Sethi, K. Krishnan, and B. B. Aggarwal {gamma}-Tocotrienol Inhibits Nuclear Factor-{kappa}B Signaling Pathway through Inhibition of Receptor-interacting Protein and TAK1 Leading to Suppression of Antiapoptotic Gene Products and Potentiation of Apoptosis J. Biol. Chem., January 5, 2007; 282(1): 809 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Ahn, G. Sethi, and B. B. Aggarwal Embelin, an Inhibitor of X Chromosome-Linked Inhibitor-of-Apoptosis Protein, Blocks Nuclear Factor-{kappa}B (NF-{kappa}B) Signaling Pathway Leading to Suppression of NF-{kappa}B-Regulated Antiapoptotic and Metastatic Gene Products Mol. Pharmacol., January 1, 2007; 71(1): 209 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Nair, S. Shishodia, K. S. Ahn, A. B. Kunnumakkara, G. Sethi, and B. B. Aggarwal Deguelin, an Akt Inhibitor, Suppresses I{kappa}B{alpha} Kinase Activation Leading to Suppression of NF-{kappa}B-Regulated Gene Expression, Potentiation of Apoptosis, and Inhibition of Cellular Invasion J. Immunol., October 15, 2006; 177(8): 5612 - 5622. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ichikawa, M. S. Nair, Y. Takada, D.B. A. Sheeja, M.A. S. Kumar, O. V. Oommen, and B. B. Aggarwal Isodeoxyelephantopin, a Novel Sesquiterpene Lactone, Potentiates Apoptosis, Inhibits Invasion, and Abolishes Osteoclastogenesis through Suppression of Nuclear Factor-{kappa}B (NF-{kappa}B) Activation and NF-{kappa}B-Regulated Gene Expression. Clin. Cancer Res., October 1, 2006; 12(19): 5910 - 5918. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Ahn, G. Sethi, S. Shishodia, B. Sung, J. L. Arbiser, and B. B. Aggarwal Honokiol Potentiates Apoptosis, Suppresses Osteoclastogenesis, and Inhibits Invasion through Modulation of Nuclear Factor-{kappa}B Activation Pathway Mol. Cancer Res., September 1, 2006; 4(9): 621 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sethi, K. S. Ahn, S. K. Sandur, X. Lin, M. M. Chaturvedi, and B. B. Aggarwal Indirubin Enhances Tumor Necrosis Factor-induced Apoptosis through Modulation of Nuclear Factor-{kappa}B Signaling Pathway J. Biol. Chem., August 18, 2006; 281(33): 23425 - 23435. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Baginski, K. Dabbagh, C. Satjawatcharaphong, and D. C. Swinney Cigarette Smoke Synergistically Enhances Respiratory Mucin Induction by Proinflammatory Stimuli Am. J. Respir. Cell Mol. Biol., August 1, 2006; 35(2): 165 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Ahn, G. Sethi, A. K. Jain, A. K. Jaiswal, and B. B. Aggarwal Genetic Deletion of NAD(P)H:Quinone Oxidoreductase 1 Abrogates Activation of Nuclear Factor-{kappa}B, I{kappa}B{alpha} Kinase, c-Jun N-terminal Kinase, Akt, p38, and p44/42 Mitogen-activated Protein Kinases and Potentiates Apoptosis J. Biol. Chem., July 21, 2006; 281(29): 19798 - 19808. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Rahman and I. M. Adcock Oxidative stress and redox regulation of lung inflammation in COPD. Eur. Respir. J., July 1, 2006; 28(1): 219 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Szulakowski, A. J. L. Crowther, L. A. Jimenez, K. Donaldson, R. Mayer, T. B. Leonard, W. MacNee, and E. M. Drost The Effect of Smoking on the Transcriptional Regulation of Lung Inflammation in Patients with Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., July 1, 2006; 174(1): 41 - 50. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-R. Yang, A. S. Chida, M. R. Bauter, N. Shafiq, K. Seweryniak, S. B. Maggirwar, I. Kilty, and I. Rahman Cigarette smoke induces proinflammatory cytokine release by activation of NF-{kappa}B and posttranslational modifications of histone deacetylase in macrophages Am J Physiol Lung Cell Mol Physiol, July 1, 2006; 291(1): L46 - L57. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Sandur, H. Ichikawa, G. Sethi, K. S. Ahn, and B. B. Aggarwal Plumbagin (5-Hydroxy-2-methyl-1,4-naphthoquinone) Suppresses NF-{kappa}B Activation and NF-{kappa}B-regulated Gene Products Through Modulation of p65 and I{kappa}B{alpha} Kinase Activation, Leading to Potentiation of Apoptosis Induced by Cytokine and Chemotherapeutic Agents J. Biol. Chem., June 23, 2006; 281(25): 17023 - 17033. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ichikawa, Y. Takada, S. Shishodia, B. Jayaprakasam, M. G. Nair, and B. B. Aggarwal Withanolides potentiate apoptosis, inhibit invasion, and abolish osteoclastogenesis through suppression of nuclear factor-{kappa}B (NF-{kappa}B) activation and NF-{kappa}B-regulated gene expression. Mol. Cancer Ther., June 1, 2006; 5(6): 1434 - 1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Imre, V. Gekeler, A. Leja, T. Beckers, and M. Boehm Histone Deacetylase Inhibitors Suppress the Inducibility of Nuclear Factor-{kappa}B by Tumor Necrosis Factor-{alpha} Receptor-1 Down-regulation. Cancer Res., May 15, 2006; 66(10): 5409 - 5418. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada, A. Gillenwater, H. Ichikawa, and B. B. Aggarwal Suberoylanilide Hydroxamic Acid Potentiates Apoptosis, Inhibits Invasion, and Abolishes Osteoclastogenesis by Suppressing Nuclear Factor-{kappa}B Activation J. Biol. Chem., March 3, 2006; 281(9): 5612 - 5622. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada, H. Ichikawa, V. Badmaev, and B. B. Aggarwal Acetyl-11-Keto-beta-Boswellic Acid Potentiates Apoptosis, Inhibits Invasion, and Abolishes Osteoclastogenesis by Suppressing NF-{kappa}B and NF-{kappa}B-Regulated Gene Expression. J. Immunol., March 1, 2006; 176(5): 3127 - 3140. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aggarwal, H. Ichikawa, Y. Takada, S. K. Sandur, S. Shishodia, and B. B. Aggarwal Curcumin (Diferuloylmethane) Down-Regulates Expression of Cell Proliferation and Antiapoptotic and Metastatic Gene Products through Suppression of I{kappa}B{alpha} Kinase and Akt Activation Mol. Pharmacol., January 1, 2006; 69(1): 195 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Denlinger, B. K. Rundall, and D. R. Jones Inhibition of phosphatidylinositol 3-kinase/Akt and histone deacetylase activity induces apoptosis in non-small cell lung cancer in vitro and in vivo J. Thorac. Cardiovasc. Surg., November 1, 2005; 130(5): 1422 - 1429. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Martey, C. J. Baglole, T. A. Gasiewicz, P. J. Sime, and R. P. Phipps The aryl hydrocarbon receptor is a regulator of cigarette smoke induction of the cyclooxygenase and prostaglandin pathways in human lung fibroblasts Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L391 - L399. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Vassallo, K. Tamada, J. S. Lau, P. R. Kroening, and L. Chen Cigarette Smoke Extract Suppresses Human Dendritic Cell Function Leading to Preferential Induction of Th-2 Priming J. Immunol., August 15, 2005; 175(4): 2684 - 2691. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada, M. Andreeff, and B. B. Aggarwal Indole-3-carbinol suppresses NF-{kappa}B and I{kappa}B{alpha} kinase activation, causing inhibition of expression of NF-{kappa}B-regulated antiapoptotic and metastatic gene products and enhancement of apoptosis in myeloid and leukemia cells Blood, July 15, 2005; 106(2): 641 - 649. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. Fields, R. M. Leonard, P. S. Odom, B. K. Nordskog, M. W. Ogden, and D. J. Doolittle Gene Expression in Normal Human Bronchial Epithelial (NHBE) Cells Following In Vitro Exposure to Cigarette Smoke Condensate Toxicol. Sci., July 1, 2005; 86(1): 84 - 91. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tsurutani, S.S. Castillo, J. Brognard, C. A. Granville, C. Zhang, J. J. Gills, J. Sayyah, and P. A. Dennis Tobacco components stimulate Akt-dependent proliferation and NF{kappa}B-dependent survival in lung cancer cells Carcinogenesis, July 1, 2005; 26(7): 1182 - 1195. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ichikawa, Y. Takada, A. Murakami, and B. B. Aggarwal Identification of a Novel Blocker of I{kappa}B{alpha} Kinase That Enhances Cellular Apoptosis and Inhibits Cellular Invasion through Suppression of NF-{kappa}B-Regulated Gene Products J. Immunol., June 1, 2005; 174(11): 7383 - 7392. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada, Y. Kobayashi, and B. B. Aggarwal Evodiamine Abolishes Constitutive and Inducible NF-{kappa}B Activation by Inhibiting I{kappa}B{alpha} Kinase Activation, Thereby Suppressing NF-{kappa}B-regulated Antiapoptotic and Metastatic Gene Expression, Up-regulating Apoptosis, and Inhibiting Invasion J. Biol. Chem., April 29, 2005; 280(17): 17203 - 17212. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Bava, V. T. Puliappadamba, A. Deepti, A. Nair, D. Karunagaran, and R. J. Anto Sensitization of Taxol-induced Apoptosis by Curcumin Involves Down-regulation of Nuclear Factor-{kappa}B and the Serine/Threonine Kinase Akt and Is Independent of Tubulin Polymerization J. Biol. Chem., February 25, 2005; 280(8): 6301 - 6308. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Arredondo, A. I. Chernyavsky, L. M. Marubio, A. L. Beaudet, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando Receptor-Mediated Tobacco Toxicity: Regulation of Gene Expression through {alpha}3{beta}2 Nicotinic Receptor in Oral Epithelial Cells Am. J. Pathol., February 1, 2005; 166(2): 597 - 613. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Moraitis, B. Du, M. S. De Lorenzo, J. O. Boyle, B. B. Weksler, E. G. Cohen, J. F. Carew, N. K. Altorki, L. Kopelovich, K. Subbaramaiah, et al. Levels of Cyclooxygenase-2 Are Increased in the Oral Mucosa of Smokers: Evidence for the Role of Epidermal Growth Factor Receptor and Its Ligands Cancer Res., January 15, 2005; 65(2): 664 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Singh, G. U. Mallikarjuna, G. Sharma, S. Dhanalakshmi, A. K. Tyagi, D. C. F. Chan, C. Agarwal, and R. Agarwal Oral Silibinin Inhibits Lung Tumor Growth in Athymic Nude Mice and Forms a Novel Chemocombination with Doxorubicin Targeting Nuclear Factor {kappa}B-Mediated Inducible Chemoresistance Clin. Cancer Res., December 15, 2004; 10(24): 8641 - 8647. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada, X. Fang, Md. S. Jamaluddin, D. D. Boyd, and B. B. Aggarwal Genetic Deletion of Glycogen Synthase Kinase-3{beta} Abrogates Activation of I{kappa}B{alpha} Kinase, JNK, Akt, and p44/p42 MAPK but Potentiates Apoptosis Induced by Tumor Necrosis Factor J. Biol. Chem., September 17, 2004; 279(38): 39541 - 39554. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Palozza, S. Serini, F. Di Nicuolo, A. Boninsegna, A. Torsello, N. Maggiano, F. O. Ranelletti, F. I. Wolf, G. Calviello, and A. Cittadini {beta}-Carotene exacerbates DNA oxidative damage and modifies p53-related pathways of cell proliferation and apoptosis in cultured cells exposed to tobacco smoke condensate Carcinogenesis, August 1, 2004; 25(8): 1315 - 1325. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shishodia and B. B. Aggarwal Cyclooxygenase (COX)-2 Inhibitor Celecoxib Abrogates Activation of Cigarette Smoke-Induced Nuclear Factor (NF)-{kappa}B by Suppressing Activation of I-{kappa}B {alpha} Kinase in Human Non-Small Cell Lung Carcinoma: Correlation with Suppression of Cyclin D1, COX-2, and Matrix Metalloproteinase-9 Cancer Res., July 15, 2004; 64(14): 5004 - 5012. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada, F. R. Khuri, and B. B. Aggarwal Protein Farnesyltransferase Inhibitor (SCH 66336) Abolishes NF-{kappa}B Activation Induced by Various Carcinogens and Inflammatory Stimuli Leading to Suppression of NF-{kappa}B-regulated Gene Expression and Up-regulation of Apoptosis J. Biol. Chem., June 18, 2004; 279(25): 26287 - 26299. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada and B. B. Aggarwal Flavopiridol Inhibits NF-{kappa}B Activation Induced by Various Carcinogens and Inflammatory Agents through Inhibition of I{kappa}B{alpha} Kinase and p65 Phosphorylation: ABROGATION OF CYCLIN D1, CYCLOOXYGENASE-2, AND MATRIX METALLOPROTEASE-9 J. Biol. Chem., February 6, 2004; 279(6): 4750 - 4759. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Campa, S. Zienolddiny, V. Maggini, V. Skaug, A. Haugen, and F. Canzian Association of a common polymorphism in the cyclooxygenase 2 gene with risk of non-small cell lung cancer Carcinogenesis, February 1, 2004; 25(2): 229 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Wang, H. Tai, C. Xie, X. Wang, J. L. Wright, and A. Churg Cigarette Smoke Produces Airway Wall Remodeling in Rat Tracheal Explants Am. J. Respir. Crit. Care Med., November 15, 2003; 168(10): 1232 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.F. Voelkel and C.D. Cool Pulmonary vascular involvement in chronic obstructive pulmonary disease Eur. Respir. J., November 2, 2003; 22(46_suppl): 28s - 32s. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tsiara, M. Elisaf, and D. P. Mikhailidis Influence of Smoking on Predictors of Vascular Disease Angiology, September 1, 2003; 54(5): 507 - 530. [Abstract] [PDF] |
||||
![]() |
S. Shishodia, S. Majumdar, S. Banerjee, and B. B. Aggarwal Ursolic Acid Inhibits Nuclear Factor-{kappa}B Activation Induced by Carcinogenic Agents through Suppression of I{kappa}B{alpha} Kinase and p65 Phosphorylation: Correlation with Down-Regulation of Cyclooxygenase 2, Matrix Metalloproteinase 9, and Cyclin D1 Cancer Res., August 1, 2003; 63(15): 4375 - 4383. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shishodia, P. Potdar, C. G. Gairola, and B. B. Aggarwal Curcumin (diferuloylmethane) down-regulates cigarette smoke-induced NF-{kappa}B activation through inhibition of I{kappa}B{alpha} kinase in human lung epithelial cells: correlation with suppression of COX-2, MMP-9 and cyclin D1 Carcinogenesis, July 1, 2003; 24(7): 1269 - 1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Lippman and W. K. Hong Cancer Prevention Science and Practice Cancer Res., September 15, 2002; 62(18): 5119 - 5125. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


























