Carcinogenesis Advance Access originally published online on July 17, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 24, No. 10, 1625-1635,
October 2003
© 2003 Oxford University Press
CANCER BIOLOGY |
Inhibitors of DNA methylation and histone deacetylation activate cytomegalovirus promoter-controlled reporter gene expression in human glioblastoma cell line U87
1 Department of Molecular Pathology, University Hospital of Tübingen, Liebermeisterstrasse 8, D-72076, Tübingen, Germany, 2 Department of Internal Medicine, University Hospital of Trieste, Cattinara 34149, Trieste, Italy, 3 Istituto di Neurobiologia e Medicina Molecolare, CNR, Roma, Italy, 4 Dipartimento di Medicina Molecolare e Patologia, Università di Roma La Sapienza, Roma, Italy, 5 Department of Chemical, Environmental and Raw Materials Engineering DICAMP, University of Trieste, Piazzale Europa 1, I-34127 Trieste, Italy and 6 Laboratory of Cellular and Molecular Cardiology, Department of Internal Medicine, University of Rome Tor Vergata, Roma, Italy
| Abstract |
|---|
|
|
|---|
The expression of many cellular genes is modulated by DNA methylation and histone acetylation. These processes can influence malignant cell transformation and are also responsible for the silencing of DNA constructs introduced into mammalian cells for therapeutic or research purposes. As a better understanding of these biological processes may contribute to the development of novel cancer treatments and to study the complex mechanisms regulating gene silencing, we established a cellular system suitable to dissect the mechanisms regulating DNA methylation and histone acetylation. For this purpose, we stably transfected the neuroblastoma cell line U87 with a cytomegalovirus promoter-driven reporter gene construct whose expression was analyzed following treatment with the DNA methylation inhibitor 5'-aza-2'-deoxycytidine or histone deacetylation inhibitor trichostatin A. Both substances reactivated the silenced cytomegalovirus promoter, but with different reaction kinetics. Furthermore, whereas the kinetics of reactivation by trichostatin A did not substantially change over the time range considered (5 days), reactivation induced by 5'-aza-2'-deoxycytidine showed profound differences between day 1 and longer time points. We showed that this effect is related to the down-regulation of DNA replication by 5'-aza-2'-deoxycytidine. Finally, we have shown that the simultaneous administration of trichostatin A and 5'-aza-2'-deoxycytidine results in reactivation of the CMV promoter according to a cooperative, not synergistic or additive, mechanism. In conclusion, our cellular system should represent a powerful tool to investigate the complex mechanisms regulating gene silencing and to identify new anticancer drugs.
Abbreviations: 5'-AZA, 5'-aza-2'-deoxycytidine; BrdU, bromodeoxyuridine; CMV, cytomegalovirus; DNMTS, DNA methyltransferases; HATs, histone acetyltransferases; HDACs, histone deacetylase enzymes; MBD, methyl-cytosine-binding domain; MFI, median fluorescence intensity; TSA, trichostatin A
| Introduction |
|---|
|
|
|---|
Modification of accessibility of the transcription machinery to gene promoters is one of the underlying mechanisms regulating gene expression in mammalian cells. Although several mechanisms combine to regulate this process (1,2), the status of histone acetylation/deacetylation (35) and DNA methylation/demethylation (69) seems to be of major importance. DNA methylation is mediated by a class of enzymes called DNA methyltransferases (DNMTs) (6), which covalently link a methyl group to the cytosine residue within 5'-CpG-3' palindromes (9). While 5'-CpG-3' palindromes cluster (CpG islands) in the promoters of about half of all human genes, they are rare in other regions of the human genome, indicating their role in the regulation of gene expression. Following methylation, particular proteins containing a methylcytosine-binding domain (MBD) (10,11) are recruited and linked to the methylated DNA, thus repressing gene transcription by blocking the access of transcription factors to the gene promoter. Furthermore, MBD binding leads to the recruitment of histone deacetylase enzymes (HDACs) (4,12), which catalyze the removal of acetyl groups from the
-amino group of specific lysine residues, present in the N-terminal parts of histones. Upon histone deacetylation, a tighter packaging of DNA (chromatin condensation) takes place (13,14), further decreasing the access of transcription factors to their binding sites on gene promoters, eventually resulting in gene silencing. In contrast to histone deacetylation, histone hyperacetylation, mediated by histone acetyltransferases (HATs) (15), induces a more relaxed chromatin conformation which favors transcription. Thus, the acetylation status of histones depends on the balance between the activity of HDACs and HATs. DNA methylation and histone acetylation play a physiological role in the regulation of gene expression during development and in inactivation of the X chromosome (16,17), and imbalances of these processes also seem to be an important step in malignant transformation. It has been shown that altered DNA methylation and histone acetylation patterns of, for example, tumor suppressor genes are present in several human tumors (1823). Gene silencing is not limited to endogenous genes, it can also affect exogenous DNA transcription units introduced into mammalian cells for therapeutic or research purposes (2426). For the human cytomegalovirus (CMV) immediate-early promoter/enhancer, which is one of the strongest mammalian promoters known so far, it has often been documented that stable integrated transcription units containing this promoter are silenced in the course of time. Whereas early CMV promoter silencing limits its usefulness in many research procedures and in gene therapy approaches of human diseases, it provides an experimental system to study the mechanisms regulating gene silencing. Thus, the generation of a cellular system in which CMV promoter activity can be modulated by interfering with DNA methylation and histone acetylation should contribute to the basal understanding of these two mechanisms and their role in tumorigenesis.
In the present study, the rescue of CMV promoter activity was analyzed using 5'-aza-2'-deoxycytidine (5'-AZA) and trichostatin A (TSA), two chemicals known to interfere with DNA methylation and histone acetylation, respectively. In particular, after incorporation of 5'-AZA into newly synthesized DNA in place of deoxycytosine, covalent links between 5'-AZA and DNMTs are formed (27). This event leads to a progressive depletion of functional DNMTs in the cell, which finally results in profound hypomethylation after several rounds of DNA replication. As hypomethylated DNA cannot bind MBD proteins, the access of transcription factors to gene promoters is not impeded and no HDACs can be recruited, thus allowing gene expression. TSA, the second agent used here, acts by directly inhibiting HDAC enzyme activity (5), resulting in histone hyperacetylation. This last event is responsible for a more relaxed chromatin conformation which allows for the binding of transcription factors to promoters, with consequential changes in gene expression.
The cellular model we chose to test the effects of 5'-AZA and TSA on promoter reactivation is based on a stable transfectant of the human glioblastoma cell line U87, which was engineered to express a fusion protein of hygromycin and enhanced green fluorescence protein (H-EGFP) under control of the CMV promoter. In the presence of hygromycin B, cells are selected for expression of the fusion protein, which can be visualized by fluorescence microscopy and quantified by flow cytometry. Removal of selection pressure leads to down- regulation of CMV promoter activity within a few days. As the green fluorescence of the cells is proportional to CMV promoter-dependent expression rate, it is possible to follow fluctuations in promoter activity by quantifying fluorescence intensities. In U87 cells we show that upon removal of selection pressure and down-regulation of CMV promoter activity, it is feasible to rescue its activity by application of TSA and 5'-AZA, which induce reactivation with different kinetics. Furthermore, we show that whereas the TSA reactivation kinetics do not substantially change over the time range considered here (5 days), reactivation sustained by 5'-AZA displays profound differences between day 1 and longer time points. We provide evidence that this effect is related to the down-regulation of DNA replication induced by 5'-AZA. Finally, we demonstrate that the simultaneous administration of TSA and 5'-AZA results in reactivation of the CMV promoter according to a cooperative, and not synergistic, mechanism at all concentrations of TSA and 5'-AZA tested.
| Materials and methods |
|---|
|
|
|---|
Construction of plasmid pCMV-HygroEGFP
Vector pCRScript SK(+) (Stratagene) was opened with EcoRV and HindIII and a 625 bp SmaIHindIII fragment containing the polyadenylation signal of the herpes simplex virus thymidine kinase was ligated into the vector, giving rise to the intermediate construct pScriptpolyA. All further cloning steps were performed following blunt end generation with T4 DNA polymerase of the respective fragments and vectors. The 620 bp PstI CMV promoter fragment of plasmid pL15TK (28) was ligated into the SrfI site of pScriptpolyA (pCMV-A). This plasmid was opened with PstI and the BamHINotI EGFP fragment of plasmid pEGFP (Clontech) was ligated into this site (pCMV-EGFP). A 1031 bp PCR fragment comprising the open reading frame of the hygromycin resistance gene without stop codon was ligated into the AgeI site of pCMV-EGFP and sequenced, resulting in the desired plasmid pCMV-HygroEGFP containing an in-frame fusion of hygromycin and EGFP, separated by a short peptide linker (Pro-Val-Ala-Thr).
Cell lines
U87 cells (ATCC catalog no. HTB-14) were stably transfected with plasmid pCMV-HygroEGFP using the calcium phosphate transfection protocol. Colonies resistant to 800 U/ml hygromycin B were selected and subjected to subcloning. One clone, U87 H-EGFP, which stably expressed the fusion protein in 100% of cells in the presence of hygromycin, the selection agent, was identified by fluorescence microscopy. Without hygromycin, the expression of hygromycinEGFP fusion protein rapidly decreased within 2 days. U87 H-EGFP and U87 parental cells were cultured in Dulbecco's modified Eagle's medium (DMEM low glucose; Gibco BRL) supplemented with 10% fetal calf serum (Seromed), 100 U/ml penicillin, 100 µg/ml streptomycin and 1 µg/ml amphotericin B (Gibco BRL) at 37°C in a humidified atmosphere containing 5% CO2. The culture medium was supplemented with 800 U/ml hygromycin B (Calbiochem) for the U87 H-EGFP cell line.
Fluorescence microscopy
About 105 U87 H-EGFP and U87 parental cells were seeded on polylysine-coated coverslips. Cells were treated with 5'-AZA (Sigma) or TSA (Sigma) for 48 h and then fixed in 5% formaldehyde/phosphate-buffered saline (PBS) for 30 min at room temperature. Afterwards, samples were analyzed by fluorescence microscopy (Axiophot; Zeiss, Jena, Germany).
Flow cytometry
U87 H-EGFP and U87 parental cells were seeded at a density of 1.5 x 105 cells/well in 6-well plates (Nuclon; NUNC) using DMEM without hygromycin B. Forty-eight hours later, cells were exposed to either 5'-AZA or TSA (Sigma) for different time intervals, ranging from 1 to 5 days. Afterwards, cells were trypsinized, resuspended in 1 ml of complete DMEM and stained with propidium iodide at a final concentration of 10 µg/ml. Cells were then resuspended in PBS (0.1369 M NaCl, 0.0026 M KCl, 0.0103 M Na2HPO4, 0.0017 M KH2PO4, pH 7.4) and individual cells were analyzed by flow cytometry (FACScalibur instrument; Becton Dickinson, Mountain View, CA). Data were analyzed by CellQuest software. Dead cells, i.e. positive for propidium iodide staining only, were excluded from the evaluation of fluorescence intensity. The median fluorescence intensity (MFI) was used to define the fluorescence intensity of each cell population analyzed.
Evaluation of DNA replication
U87 H-EGFP cells were cultured as described in the section Flow cytometry and treated with either 1 µM 5'-AZA, 40 µM 5'-AZA or not treated. One or five days thereafter, cells were pulsed with bromodeoxyuridine (BrdU) (final concentration 10 µM) for 8 h and then prepared as follows. Cells were harvested, centrifuged for 5 min at 500 g and fixed in ice-cold 70% ethanol for 20 min. After adding 1x PBS containing 0.5% bovine serum albumin (wash buffer), cells were pelletted for 5 min at 500 g, then resuspended in 1 M HCl, 0.5x PBS, 0.5% bovine serum albumin (denaturing solution). After 20 min, cells were washed with wash buffer, resuspended in 0.1 M sodium borate, pH 8.5, for 2 min. Following a last wash, each sample was divided into two aliquots: one was incubated with an anti-BrdU monoclonal antibody (Becton Dickinson) while the other one was incubated with an isotype antibody (Becton Dickinson) which does not bind to BrdU. Both incubations were performed for 40 min. After a washing step, pellets were incubated for 1 h in the presence of RNase A (final concentration 100 µg/ml) and 7-amino-actinomycin D (Via-Probe; Becton Dickinson) in the dark. Finally, each sample was washed with wash buffer, resuspended in 1x PBS, and analyzed by flow cytometry using a FACScalibur instrument (Becton Dickinson). Data were analyzed with CellQuest software.
Mathematical description of CMV promoter reactivation
To mathematically describe the correlation between MFI, which reflects the degree of promoter reactivation, and the concentration of the reactivating agent, we developed the two equations described below.
For the relations between MFI and the concentration C of 5'-AZA, we found the following empirical exponential law:
![]() | (1) |
![]() | (2) |
For both equations, it can be mathematically demonstrated that with an increase in C, MFI tends to a plateau situated at A + B. This indicates that when C approaches a threshold value (in our experimental set-up 40 µM 5'-AZA or 3 µM TSA), any further increases in C will not modify MFI, as seen in our experiments. In contrast, when C approaches 0, MFI tends to A, which represents the background fluorescence of the cells.
Sodium bisulfite conversion
DNA was extracted from cell cultures by the salting out method and modified by the sodium bisulfite technique as reported (29), with some modifications. Briefly, 3 µg of genomic DNA was denatured by a freshly prepared 0.37 M NaOH solution for 15 min at 75°C. DNA was then treated with sodium bisulfite at 3.6 M final concentration, adjusted to pH 5.0 and 1 mM hydroquinone, overlaid with mineral oil and incubated at 55°C for 6 h. DNA samples were purified by a Wizard DNA Clean-Up System according to the manufacturer's protocol (Promega). Modification was completed by desulfonation, incubating samples with 0.3 M NaOH for 15 min at 37°C. The solution was neutralized by addition of ammonium acetate (NH4OAc), pH 7, to 3 M and the DNA was ethanol precipitated.
PCR amplification and sequencing of the CMV promoter
After ethanol precipitation, DNA samples were dissolved in 20 µl of 10 mM TrisHCl, pH 8. A fragment of 360 bp of the CMV promoter containing 15 CpG sites was amplified by PCR. Primers were designed to amplify bisulfite-converted DNA. Amplifications were performed in a 100 µl reaction mixture containing 4 µl of bisulfite-treated genomic DNA, 200 µM dNTPs, 0.4 µM primers, 50 mM KCl, 1.5 mM MgCl2, 10 mM TrisHCl pH 9, 5% DMSO, 0.2 µl Taq DNA polymerase (Promega). Primers used were: 1F, ATTATTGACTAGTTATTAATAGTAATCA (positions 145172 of GenBank accession no. AF477200); 1R, TAAATATACTACCAAATAAAAAAATCC (positions 492466). The following conditions were used: 94°C for 30 s, 52°C for 60 s and 72°C for 30 s for 35 cycles. PCR fragments were purified using a microspin S-400 spin column. Nucleotide sequencing was performed with an automatic sequencer using both forward and reverse primers. The diagrams are derived directly from sequence electropherograms. Each column has been calculated from the ratio between the height of the thymine electropherogram peak at that site and the sum of the heights of the cytosine and thymine peaks at the same site.
Statistical analysis
P values were calculated using the ANOVA one-factorial variance analysis program with MS Excel. P values <0.05 were considered to be statistically significant.
| Results |
|---|
|
|
|---|
Establishment of U87 H-EGFP cell line
The model system presented here was obtained by stable transfection of the human glioblastoma cell line U87 with plasmid pCMVhygroEGFP. Under the control of the CMV promoter, this plasmid expresses a fusion of the hygromycin resistance gene and the enhanced green fluorescence gene (H-EGFP). The fusion protein H-EGFP renders cells resistant to the antibiotic hygromycin B, which thus allows for the selection of stable transfectants. Due to the EGFP portion of the fusion protein, cells expressing this gene can be easily detected by fluorescence microscopy and flow cytometry. In the absence of the selective agent hygromycin, cells rapidly down-regulate the expression of H-EGFP, as evidenced by the rapid loss of green fluorescence, indicating that CMV promoter activity is directly proportional to the amount of H-EGFP protein present in the cells. Thus, we could investigate promoter activity by flow cytometry without further RNA analysis.
Effects of 5'-AZA on CMV promoter activity
To study the mechanisms regulating gene silencing and to investigate whether CMV promoter activity can be rescued and/or modulated in our system, 5'-AZA, a drug known to interfere with the process of gene silencing (27), was applied to U87 H-EGFP cells. Cells were cultured in the absence of hygromycin B for 2 days, so that silencing of the CMV promoter could occur. This time point was chosen as longer culturing in the absence of selective pressure did not substantially decrease CMV expression. Afterwards, cells were incubated for different time intervals of from 1 to 5 days in the presence of different concentrations of 5'-AZA.
To quantify the effects of 5'-AZA on the degree of CMV promoter activity, as visualized by green fluorescence, flow cytometry was conducted on treated cells. A representative example of the experiment performed is shown in Figure 1A, together with the corresponding fluorescence microscopy image. Figure 1BD summarizes the results with the MFI, reflecting CMV promoter reactivation, plotted against the amount of 5'-AZA administered. On day 1 (Figure 1B) an inverse correlation between MFI and 5'-AZA concentration was detected. In contrast, on both days 2 and 5 (Figure 1C and D) a direct correlation between the concentration of 5'-AZA and MFI was observed. We speculated that the inverse correlation noticed on day 1 could have been due to a 5'-AZA-mediated inhibitory effect on DNA replication, which would have reduced 5'-AZA incorporation into DNA, thus affecting its demethylating activity and CMV promoter reactivation. At longer time points, the replication inhibitory effect could have been relieved, with a consequent increase in DNA replication rate and reactivation of the CMV promoter. To prove our hypothesis, DNA replication rates were evaluated, by means of BrdU incorporation, in cells treated with either 1 or 40 µM 5'-AZA on days 1 and 5. These time points and 5'-AZA concentrations were chosen as those at which the differences with respect to CMV promoter reactivation were most evident. Figure 2 reports the results with MFI (left) and percent BrdU incorporated (right) plotted against the different concentrations of 5'-AZA tested. On day 1 (Figure 2A), BrdU incorporation is comparable between non-treated and 1 µM 5'-AZA treated cells, for which a clear increase in MFI is evident (P = 5 x 10-6). In contrast, cells treated with 40 µM 5'-AZA showed a dramatic reduction in BrdU incorporation, paralleled by the absence of any detectable effect of 5'-AZA on MFI (P = 0.23). On day 5 (Figure 2B), the incorporation of BrdU increases dramatically in cells treated with 40 µM 5'-AZA. Notably, this event is paralleled by a marked increase in MFI, thus proving the need for a high DNA replication rate to detect CMV promoter reactivation induced by 5'-AZA in our system.
|
|
Because of the inhibitory effect of 5'-AZA on DNA replication on day 1, which affects CMV promoter expression, CMV promoter reactivation kinetics were studied at longer time points. Therefore, we focused our attention on day 2, when a direct correlation between 5'-AZA concentration and MFI increase was evident and when a minor effect on DNA replication was revealed (data not shown). Day 5 was excluded as a clear reduction in MFI indicated that the effects of 5'-AZA were almost relieved, thus making a kinetic analysis inappropriate. For a comprehensive evaluation of the reactivation kinetics on day 2, additional concentrations of 5'-AZA were tested as shown in Figure 3. In this set of experiments we also included the parental U87 cells, which do not contain the pCMVhygroEGFP plasmid, in order the prove that 5'-AZA per se does not induce any fluorescence increase independent of the expression of H-EGFP fusion protein. At 1 µM 5'-AZA, U87 H-EGFP cells showed a 1.5-fold increase in MFI (Figure 3) compared with untreated U87 H-EGFP cells (P = 0.0055). Furthermore, MFI increased progressively with the increase in 5'-AZA concentration, reaching a maximum at 40 µM (2.1-fold increase, compared with untreated U87 H-EGFP cells). Parental U87 cells, which do not contain the plasmid pCMVhygroEGFP, showed a negligible increase in MFI (Figure 3) compared with untreated U87 cells.
|
Effects of TSA on CMV promoter activity
CMV promoter reactivation was also studied in the presence of TSA, a drug known to interfere with the process of gene silencing (5), by acting on histone acetylation status. As for 5'-AZA studies, different concentrations of TSA were applied to U87 H-EGFP cells for different times, from 1 to 5 days. A representative example of the experiment performed is shown in Figure 4A, together with the corresponding fluorescence microscopy image. The results, summarized in Figure 4BD, are expressed as MFI, reflecting CMV promoter reactivation, plotted against the amount of TSA administered. At all time points considered, a direct relation between MFI and TSA concentration was noticed. On day 1, however, a saturation of CMV promoter reactivation was detected at 1 µM TSA. Additionally, a marked reduction in the absolute values of MFI was evident on day 5 compared with days 1 and 2, indicating an extinction of the TSA effect, similar to that shown for 5'-AZA. Therefore, by analogy to the 5'-AZA experiments, for a more detailed characterization of CMV promoter reactivation kinetics we chose day 2. As for 5'-AZA treated cells, the parental cell line U87, which does not contain the pCMVhygroEGFP plasmid, was included, in order to prove that TSA per se does not induce any fluorescence increase independent of expression of the H-EGFP fusion protein. At 200 nM TSA, U87-H-EGFP cells (Figure 5) showed a significant increase (P = 5.8 x 10-6) of 1.5-fold in MFI compared with untreated U87 H-EGFP cells. At 1 and 3 µM TSA, 3.9- and 5.8-fold increases were observed. As in the case of 5'-AZA treatment, in the parental cell line U87, which does not contain the plasmid pCMVhygroEGFP, a negligible increase in MFI, compared with untreated U87, was detected. Finally, whereas the effects on cell proliferation of 5'-AZA depended on the drug concentration and the administration time, in the case of TSA a clear inhibition of cell proliferation was noticed for all the conditions tested (data not shown).
|
|
Mathematical analysis of promoter reactivation induced by 5'-AZA and TSA
The dependence of MFI on the concentration (C) of the reactivating agent was then analyzed using newly developed mathematical equations (for details see Materials and methods) in order to precisely characterize the reactivation kinetics of 5'-AZA and TSA. Figure 6 shows both the experimental data obtained and the data fitting by our mathematical descriptions of CMV promoter reactivation in the presence of 5'-AZA and TSA. The relevant difference between equations (1) and (2) (see Materials and methods) is given by the value of the C exponent n, which is equal to 1 and 2.48 in the cases of equation (1) (5'-AZA) and equation (2) (TSA), respectively. From a mathematical point of view this indicates that CMV promoter reactivation induced by 5'-AZA follows a normal exponential law, while reactivation induced by TSA follows a so-called stretched exponential and not a pure exponential law. Thus, it can be concluded that the two chemicals have different reaction kinetics. Despite this difference, for both equations the mathematical analysis predicts that when C approaches a threshold value, a plateau level for MFI is reached and any further increase in C will not result in any substantial increase in MFI. This is exactly what we see at the experimental level in the case of 5'-AZA and TSA treatment (Figures 3 and 5), proving the accuracy of the mathematical description of the experimental data.
|
Effect of a combined administration of 5'-AZA and TSA
After demonstrating dose-dependent reactivation of the CMV promoter by 5'-AZA and TSA in our system, we investigated the combined effect of these two chemicals on rescue of the CMV promoter activity. For a comprehensive characterization of the possible interaction between the two drugs in our model, different concentrations of 5'-AZA and TSA were administered simultaneously to U87 H-EGFP cells. For this purpose, we studied the combined effects of: (i) the minimal concentration of 5'-AZA (1 µM) and TSA (0.2 µM) able to induce a significant increase in MFI compared with untreated cells; (ii) a concentration of 5'-AZA (5 µM) and TSA (1 µM) able to induce an intermediate increase in MFI; (iii) the concentration of 5'-AZA (40 µM) and TSA (3 µM) which resulted in a saturation of MFI increase. For each of the combinations tested, the effects on MFI were compared with those induced by the separate administration of each of the two drugs. As shown in Figure 7, the simultaneous administration of 1 µM 5'-AZA and 0.2 µM TSA resulted in a significant, although modest, increase in MFI (P < 0.05), compared with cells treated with each of the two agents alone. Similar results were obtained treating cells with either 5 µM 5'-AZA and 1 µM TSA or 40 µM 5'-AZA and 3 µM TSA. Notably, in all cases the simultaneous administration of the two drugs increased MFI modestly, resulting in neither a synergistic nor an additive reactivation of the CMV promoter.
|
Evaluation of the CMV promoter methylation status
It is well known that DNA methylation blocks the access of transcription factors to gene promoters and is involved in the mechanisms which lead to histone deacetylation, thus preventing gene expression. To prove that this mechanism was also responsible in our cellular model for CMV promoter silencing, the methylation status of 15 CpG sites in the promoter region was analyzed under different experimental conditions. As shown in Figure 8, the methylation status of single CpG sites of the untreated cultures and of 5'-AZA or TSA treated ones are directly compared. The overall results indicate that about half of the sites are methylated in untreated cultures. However, no single site is completely methylated, confirming the extreme variability of the methylation process. As expected, treatment with 5'-AZA strongly inhibits the methylation process, although residual methylation is present. Finally, a reduction in methylation status is not observed in cultures treated with TSA, as expected.
|
| Discussion |
|---|
|
|
|---|
DNA methylation/demethylation and histone acetylation/deacetylation processes play an important role in controlling endogenous gene expression both during (16,17) and after development (1823). We have taken advantage of the fact that these phenomena also regulate the expression of exogenous DNA transcription units to generate a cellular model which offers the possibility to study the complex mechanisms regulating DNA methylation and histone acetylation status. Our system is based on a stable transfectant of the human glioblastoma cell line U87, which was engineered to express a fusion protein of hygromycin and enhanced green fluorescence protein (H-EGFP) under control of the CMV promoter. CMV promoter activity was evaluated in the presence and absence of 5'-AZA and TSA, two inhibitors of DNA methylation and histone deacetylation, respectively.
For a detailed characterization of 5'-AZA and TSA mediated reactivation of the CMV promoter we investigated the effects of these drugs over a time period of 5 days, which represents the upper limit for the proper detection of MFI variation in our system. TSA did not show any relevant differences in the reactivation trend over time (Figure 4), whereas 5'-AZA did. In particular, an opposite behavior of the reactivation kinetics was noticed on day 1 compared with days 2 and 5 (Figure 1). On day 1, indeed, an inverse correlation between MFI and 5'-AZA concentration was detected (Figure 1B). We have demonstrated that this phenomenon is related to inhibition of DNA replication, moderate at low 5'-AZA concentration (Figure 2A, 1 µM) and severe at higher concentrations (Figure 2A, 40 µM 5'-AZA). We think that the impairment of DNA replication reduces 5'-AZA incorporation into DNA, thus interfering with its demethylating activity and therefore affecting CMV promoter reactivation. The mechanism through which 5'-AZA induced DNA replication inhibition may depend on interference with cellular metabolic pathways, such as de novo thymidylate synthesis, known to be affected by the enzymatic deamination of 5'-AZA (30). Additionally, as replication is not completely shut down, it is also possible that the inhibitory effect is mediated by the toxicity induced by the covalent link between DMNTs and the 5'-AZA incorporated into the DNA, as shown in other systems (27).
The marked reduction over time in 5'-AZA mediated DNA inhibition (see Figure 2B) made days 2 and 5 appropriate to evaluate CMV promoter reactivation. However, day 5 was excluded due to a clear MFI reduction (compare Figure 1C with D), indicative of a cessation of the 5'-AZA effect. For the same reason, day 2 was also preferred to day 5 in the case of TSA. Our data show that for both 5'-AZA and TSA, CMV promoter rescue occurs in a dose-dependent manner (Figures 3 and 5). However, reactivation kinetics differ for the two agents, as indicated by the mathematical interpretation of the experimental data (Figure 6A and B). In particular, whereas 5'-AZA reactivation follows a normal exponential law, TSA reactivation follows a so-called stretched exponential law. The mathematical system presented here can be used to describe the reactivation behavior of the CMV promoter as well as those of other promoters in other cell lines, allowing a rigorous comparison between different experimental conditions. When applied to other experimental settings, this approach should be useful to rule out whether and how the reactivation kinetics of 5'-AZA and TSA differ among different promoters and cell lines, providing new insights into DNA methylation and histone acetylation, two relevant biological processes altered in many cancer cells.
The mathematical analysis described above indicates that the TSA effect occurs over a narrower concentration range and follows a more sigmoidal curve (active concentration range 0.23 µM, Figures 5 and 6B) compared with that of 5'-AZA (active concentration range 140 µM, Figures 3 and 6A). Although several factors can account for the differences in TSA and 5'-AZA mediated reactivation of the CMV promoter, a possible explanation may reside in the fact that TSA prevents transcription by directly inhibiting deacetylation whereas 5'-AZA exerts its action in a more complex way. It acts directly, preventing the recruitment of MBD proteins, thus allowing the transcription machinery to bind to the promoter, and indirectly, preventing HDAC recruitment to the gene promoter, thus inducing histone hyperacetylation and consequently activation of transcription. It is therefore possible that the reaction kinetics shown by 5'-AZA result from a combination of these two mechanisms, thus explaining the different kinetics compared with TSA.
To further investigate the influence of 5'-AZA and TSA on CMV promoter reactivation in our cellular system, the combined effect of the two drugs was tested. As shown in Figure 7, we could detect a significant increase (P < 0.05) in MFI in cells treated with a combination of the two drugs, regardless of the concentration of each of them, compared with cells treated with one drug only. The modest increase in MFI indicates that a cooperative rather than an additive or synergistic effect takes place under our experimental conditions. These data are in contrast to the synergistic effects described for 5'-AZA and TSA in a previous work by Cameron et al. (35). This discrepancy may be due to the fact that different cell lines were used, i.e. U87 neuroblastoma cell lines in the present work and RKO colorectal carcinoma cells in Cameron's work. It is possible that U87 and RKO cells contain different amounts of each of the three classes of HDACs (4), resulting in different behavior in the presence of a HDAC inhibitor. For example, as HDAC class III is insensitive to TSA (35,36), a prevalence of this class of enzyme over the other two in our cell line would influence the overall effect of TSA. Furthermore, the acetylation status of a promoter depends not only on HDACs but also on HATs. Given the several different families of HATs (4), it is possible that a different distribution of these families of enzymes among cell lines affects acetylating capacity accordingly. A second major difference in the experimental set up between our system and that of Cameron resides in the different promoters used, i.e. the CMV promoter and MLH1 and TIMP3 promoters, respectively. In this regard, it is conceivable that HDACs and HATs, regulating histone acetylation status, and DNMT, regulating DNA methylation, may act differently on different promoters.
The data describing the effects of 5'-AZA and TSA on CMV promoter reactivation have been generated from one clone of U87 cells stably containing the H-EGFP gene. Therefore, in principle, we cannot totally exclude the influence of a clonal effect on these results. However, at least two observations indicate that the U87 H-EGFP cell clone does not substantially differ from the parental U87 cell line, thus conferring on our results a general value. First, we have evidence (data not shown) that the U87 H-EGFP cell clone behaves similarly to the parental U87 cells in terms of proliferation and cell cycle phase distribution. Secondly, the effects of 5'-AZA and TSA on cell proliferation (data not shown) are absolutely comparable between U87 and U87 H-EGFP cells, indicating comparable transcriptional effects on genes regulating cell cycle.
While 5'-AZA showed a reversible inhibition of cell proliferation (Figure 2A and B), TSA strongly inhibited U87 H-EGFP cell growth at all the concentrations and time points tested (data not shown). Since U87 cells originated from a human neuroblastoma, these observations indicate that TSA might be of therapeutic benefit for the treatment of neuroblastoma, the most common pediatric extra-cranial solid tumor (39). Although our data should be confirmed in primary tumor cells freshly isolated from patients, they corroborate the usefulness of HDAC inhibitors in the treatment of neuroblastoma (40) and, in general, the effectiveness of TSA in preventing the growth of different tumor cells (32,33,4143).
The data presented here are based on the concept that in our cellular model CMV promoter silencing is due to methylation, as reported in other cellular systems (for reviews see 79). To show that this is also the case in our system and to prove its validity, the methylation pattern of the CMV promoter was evaluated. Our data show (Figure 8) a reduction of
60% in the number of methylated sites in 5'-AZA treated cells compared with untreated cells, thus confirming the mechanism of action of 5'-AZA and the relevance of methylation as an expression inhibition mechanism in our cell system. Notably, these sites are not 100% in untreated cells. This is not surprising as we have shown that residual expression is detectable (Figure 3) in untreated U87 H-EGFP cells compared with U87 cells, compatible with partial promoter methylation. As expected, TSA treatment did not alter the percent of methylated sites in comparison with untreated cells, confirming our knowledge of its mechanism of action (35). The fact that TSA induced CMV promoter reactivation in the context of a partially methylated promoter supports the observation that decreased methylation is a prerequisite for effective transcription following histone acetylation (35). This, as well as other aspects of the mechanism of gene silencing, can be further investigated using our model, thus showing its potential as an investigational tool. Additionally, our system can be used to characterize the effects of a variety of DNA methylation and histone deacetylation inhibitory agents such as 5-methylcyosine analogs (7), butyrate, valproic acid, or pyroxamide (4), respectively. Moreover, our system is suitable to study other processes regulating promoter activation, such as histone phosphorylation and methylation (2), and, in general, the complex mechanisms regulating gene silencing. Finally, the fact that promoter reactivation can be studied by simply measuring variations in the green fluorescence intensity of the cells, without the need to perform procedures such as mRNA extraction, northern blotting and quantitative RTPCR, makes our model fast and economically advantageous.
In summary, we have shown that treatment of cells with the drugs 5'-AZA and TSA, known to inhibit DNA methylation and histone deacetylation, respectively, can rescue CMV promoter activity with different kinetics and that simultaneous inhibition of these two mechanisms results in a cooperative reactivation. The lack of a synergistic effect between 5'-AZA and TSA, as described for other cell lines, suggests a cell type-specific role for DNA methylation and histone deacetylation in the regulation of gene expression. Finally, the cell system presented here should be useful to expand our knowledge of the mechanisms regulating gene expression and to identify and characterize new anticancer drugs.
| Notes |
|---|
7 Present address: College of Pharmacy, University of Arizona, Tucson, AZ, USA
8 Present address: Heart BioSystems GmbH, Im Neuenheimer Feld 583, D-69120 Heidelberg, Germany ![]()
9 To whom correspondence should be addressed at: Department of Internal Medicine, University Hospital of Trieste, Cattinara 34149, Trieste, Italy. Tel: +39 040 3994997; Fax: +39 040 3994593; Email: ggrassi{at}units.it ![]()
* These two authors contributed equally to this paper. ![]()
| Acknowledgments |
|---|
This work was supported in part by the Fortüne Program of the Medical Faculty of the University Hospital Tübingen (951-0-0), by Telethon Grant N:1126, by Synthech srl in support of P.M. and by FIRB2001.
| References |
|---|
|
|
|---|
- Zhang,Y. and Reinberg,D. (2001) Transcription regulation by histone methylation: interplay between different covalent modifications of the core histone tails. Genes Dev., 15, 23432360.
[Free Full Text] - Strahl,B.D. and Allis,C.D. (2000) The language of covalent histone modifications. Nature, 403, 4145.[CrossRef][Medline]
- Marks,P.A., Richon,V.M., Breslow,R. and Rifkind,R.A. (2002) Histone deacetylase inhibitors as new cancer drugs. Curr. Opin. Oncol., 13, 477483.
- Marks,P.A., Rifkind,R.A., Richon,V.M., Breslow,R., Miller,T. and Kelly,W.K. (2002) Histone deacetylase and cancer: causes and therapies. Nature, 1, 194202.
- Finnin,M.S., Donigian,J.R., Cohen,A., Richon,V.M., Rifkind,R.A., Marks,P.A., Breslow,R. and Pavletich,N.P. (1999) Structures of a histone deacetylase homologue bound to the TSA and SAHA inhibitors. Nature, 401, 188193.[CrossRef][Medline]
- Robertson,K.D. (2001) DNA methylation, methyltransferases and cancer. Oncogene, 20, 31393155.[CrossRef][Web of Science][Medline]
- Santini,V., Kantarjian,H.M. and Issa,J.P. (2001) Changes in DNA methylation in neoplasia: pathophysiology and therapeutic implications. Ann. Intern. Med., 134, 573586.
[Abstract/Free Full Text] - Robertson,K.D. and Jones,P.A. (2000) DNA methylation: past, present and future directions. Carcinogenesis, 21, 461467.
[Abstract/Free Full Text] - Newell-Price,J., Clark,A.J. and King,P. (2000) DNA methylation and silencing of gene expression. Trends Endocrinol. Metab., 11, 142148.[CrossRef][Web of Science][Medline]
- Hendrich,B. and Bird,A. (1998) Identification and characterization of a family of mammalian methyl-CpG binding proteins. Mol. Cell. Biol., 18, 65386547.
[Abstract/Free Full Text] - Meehan,R.R., Lewis,J.D., McKay,S., Kleiner,E.L. and Bird,A.P. (1989) Identification of a mammalian protein that binds specifically to DNA containing methylated CpGs. Cell, 58, 499507.[CrossRef][Web of Science][Medline]
- Gray,S.G. and Ekstrom,T.J. (2001) The human histone deacetylase family. Exp. Cell Res., 262, 7583.[CrossRef][Web of Science][Medline]
- Gregory,P.D., Wagner,K. and Horz,W. (2001) Histone acetylation and chromatin remodeling. Exp. Cell Res., 265, 195202.[CrossRef][Web of Science][Medline]
- Chen,W.Y. and Townes,T.M. (2000) Molecular mechanism for silencing virally transduced genes involves histone deacetylation and chromatin condensation. Proc. Natl Acad. Sci. USA, 97, 377382.
[Abstract/Free Full Text] - Marmorstein,R. and Roth,S.Y. (2001) Histone acetyltransferases: function, structure and catalysis. Curr. Opin. Genet. Dev., 11, 155161.[CrossRef][Web of Science][Medline]
- Barlow,D.P. (1995) Gametic imprinting in mammals. Science, 270, 16101613.
[Abstract/Free Full Text] - Goto,T. and Monk,M. (1998) Regulation of X-chromosome inactivation in development in mice and humans. Microbiol. Mol. Biol. Rev., 62, 362378.
[Abstract/Free Full Text] - Mahlknecht,U. and Hoelzer,D. (2000) Histone acetylation modifiers in the pathogenesis of malignant disease. Mol. Med., 6, 623644.[Web of Science][Medline]
- Cress,W.D. and Seto,E. (2000) Histone deacetylases, transcriptional control and cancer. J. Cell. Physiol., 184, 116.[CrossRef][Web of Science][Medline]
- Baylin,S.B. and Herman,J.G. (2000) DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet., 16, 168174.[CrossRef][Web of Science][Medline]
- Jones,P.A. and Laird,P.W. (1999) Cancer epigenetics comes of age. Nature Genet., 21, 163167.[CrossRef][Web of Science][Medline]
- Stirzaker,C., Millar,D.S., Paul,C.L., Warnecke,P.M., Harrison,J., Vincent,P.C., Frommer,M. and Clark,S.J. (1997) Extensive DNA methylation spanning the Rb promoter in retinoblastoma tumors. Cancer Res., 57, 22292237.
[Abstract/Free Full Text] - Herman,J.G., Latif,F., Weng,Y., Lerman,M.I., Zbar,B., Liu,S., Samid,D., Duan,D.S., Gnarra,J.R., Linehan,W.M. et al. (1994) Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc. Natl Acad. Sci. USA, 91, 97009704.
[Abstract/Free Full Text] - Meier,J.L. (2001) Reactivation of the human cytomegalovirus major immediate-early regulatory region and viral replication in embryonal NTera2 cells: role of trichostatin A, retinoic acid and deletion of the 21-base-pair repeats and modulator. J. Virol., 75, 15811593.
[Abstract/Free Full Text] - Chen,W.Y., Bailey,E.C., McCune,S.L., Dong,J.Y. and Townes,T.M. (1997) Reactivation of silenced, virally transduced genes by inhibitors of histone deacetylase. Proc. Natl Acad. Sci. USA, 94, 57985803.
[Abstract/Free Full Text] - Loser,P., Jennings,G.S., Strauss,M. and Sandig,V. (1998) Reactivation of the previously silenced cytomegalovirus major immediate-early promoter in the mouse liver: involvement of NFkappaB. J. Virol., 72, 180190.
[Abstract/Free Full Text] - Juttermann,R., Li,E. and Jaenisch,R. (1994) Toxicity of 5-aza-2'-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation. Proc. Natl Acad. Sci. USA, 91, 1179711801.
[Abstract/Free Full Text] - Kupper,J.H., de Murcia,G. and Burkle,A. (1990) Inhibition of poly(ADP-ribosyl)ation by overexpressing the poly(ADP-ribose) polymerase DNA-binding domain in mammalian cells. J. Biol. Chem., 265, 1872118724.
[Abstract/Free Full Text] - Clark,S.J., Harrison,J., Paul,C.L. and Frommer,M. (1994) High sensitivity mapping of methylated cytosines. Nucleic Acids Res., 22, 29902997.
[Abstract/Free Full Text] - Vesely,J., Cihak,A. and Sorm,F. (1969) Collect. Czech. Chem. Commun., 34, 901909.
- Bender,C.M., Pao,M.M. and Jones,P.A. (1998) Inhibition of DNA methylation by 5-aza-2'-deoxycytidine suppresses the growth of human tumor cell lines. Cancer Res., 58, 95101.
[Abstract/Free Full Text] - Vigushin,D.M., Ali,S., Pace,P.E., Mirsaidi,N., Ito,K., Adcock,I. and Coombes,R.C. (2001) Trichostatin A is a histone deacetylase inhibitor with potent antitumor activity against breast cancer in vivo. Clin. Cancer Res., 7, 971976.
[Abstract/Free Full Text] - Saunders,N., Dicker,A., Popa,C., Jones,S. and Dahler,A. (1999) Histone deacetylase inhibitors as potential anti-skin cancer agents. Cancer Res., 59, 399404.
[Abstract/Free Full Text] - Dolbeare,F., Gratzner,H., Pallavicini,M.G. and Gray,J.W. (1983) Flow cytometric measurement of total DNA content and incorporated bromodeoxyuridine. Proc. Natl Acad. Sci. USA, 80, 55735577.
[Abstract/Free Full Text] - Cameron,E.E., Bachman,K.E., Myohanen,S., Herman,J.G. and Baylin,S.B. (1999) Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nature Genet., 21, 103107.[CrossRef][Web of Science][Medline]
- Landry,J., Sutton,A., Tafrov,S.T., Heller,R.C., Stebbins,J., Pillus,L. and Sternglanz,R. (2000) The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases. Proc. Natl Acad. Sci. USA, 97, 58075811.
[Abstract/Free Full Text] - Frye,R.A. (2000) Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins. Biochem. Biophys. Res. Commun., 273, 793798.[CrossRef][Web of Science][Medline]
- Pinto,A. and Zagonel,V. (1993) 5-Aza-2'-deoxycytidine (Decitabine) and 5-azacytidine in the treatment of acute myeloid leukemias and myelodysplastic syndromes: past, present and future trends. Leukemia, 7 (suppl. 1), 5160.[Web of Science][Medline]
- Berthold,F. (1998) Neuroblastoma: Tumor Biology and Therapy. CRC Press, Boca Raton, FL.
- Coffey,D.C., Kutko,M.C., Glick,R.D., Butler,L.M., Heller,G., Rifkind,R.A., Marks,P.A., Richon,V.M. and La Quaglia,M.P. (2001) The histone deacetylase inhibitor, CBHA, inhibits growth of human neuroblastoma xenografts in vivo, alone and synergistically with all-trans retinoic acid. Cancer Res., 61, 35913594.
[Abstract/Free Full Text] - Yoshida,M., Furumai,R., Nishiyama,M., Komatsu,Y., Nishino,N. and Horinouchi,S. (2001) Histone deacetylase as a new target for cancer chemotherapy. Cancer Chemother. Pharmacol., 48 (suppl. 1), S20S26.
- Herold,C., Ganslmayer,M., Ocker,M., Herman,M., Geerts,A., Hahn,E.G. and Schuppan,D. (2002) The histone-deacetylase inhibitor Trichostatin A blocks proliferation and triggers apoptotic programs in hepatoma cells. J. Hepatol., 36, 233240.[Web of Science][Medline]
- Greenberg,V.L., Williams,J.M., Cogswell,J.P., Mendenhall,M. and Zimmer,S.G. (2001) Histone deacetylase inhibitors promote apoptosis and differential cell cycle arrest in anaplastic thyroid cancer cells. Thyroid, 11, 315325.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. Hummel, S. Yan, Z. Li, T. K. Varghese, and M. Abecassis Transcriptional reactivation of murine cytomegalovirus ie gene expression by 5-aza-2'-deoxycytidine and trichostatin A in latently infected cells despite lack of methylation of the major immediate-early promoter J. Gen. Virol., April 1, 2007; 88(4): 1097 - 1102. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Foltz, G.-Y. Ryu, J.-G. Yoon, T. Nelson, J. Fahey, A. Frakes, H. Lee, L. Field, K. Zander, Z. Sibenaller, et al. Genome-Wide Analysis of Epigenetic Silencing Identifies BEX1 and BEX2 as Candidate Tumor Suppressor Genes in Malignant Glioma. Cancer Res., July 1, 2006; 66(13): 6665 - 6674. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. W. Poon, H. Gu, and B. Roizman ICP0 and the US3 protein kinase of herpes simplex virus 1 independently block histone deacetylation to enable gene expression PNAS, June 27, 2006; 103(26): 9993 - 9998. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Forte, M. Minieri, P. Cossa, D. Antenucci, M. Sala, V. Gnocchi, R. Fiaccavento, F. Carotenuto, P. De Vito, P. M. Baldini, et al. Hepatocyte Growth Factor Effects on Mesenchymal Stem Cells: Proliferation, Migration, and Differentiation Stem Cells, January 1, 2006; 24(1): 23 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Escher, A. Hoang, S. Georges, U. Tchoua, A. El-Osta, Z. Krozowski, and D. Sviridov Demethylation using the epigenetic modifier, 5-azacytidine, increases the efficiency of transient transfection of macrophages J. Lipid Res., February 1, 2005; 46(2): 356 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Watson, J. M. McKim, G. L. Cockerell, and J. I. Goodman The Value of DNA Methylation Analysis in Basic, Initial Toxicity Assessments Toxicol. Sci., May 1, 2004; 79(1): 178 - 188. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||















