Carcinogenesis Advance Access originally published online on August 1, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 24, No. 10, 1691-1694,
October 2003
© 2003 Oxford University Press
CARCINOGENESIS |
The alleles of the DNA repair gene O6-alkylguanine-DNA alkyltransferase are expressed at different levels in normal human lung tissue
1 Roy Castle International Centre for Lung Cancer Research, 200 London Road, Liverpool L3 9TA, UK, 2 Paterson Institute for Cancer Research, Christie Hospital NHS Trust, Wilmslow Road, Manchester M20 9BX, UK and 3 Institute of Human Genetics, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK
| Abstract |
|---|
|
|
|---|
O6-Alkylguanine-DNA alkyltransferase (MGMT) confers resistance to many of the mutagenic and toxic effects of certain classes of alkylating agents by repairing the DNA lesions responsible. The levels of expression of this protein are of interest in relation to the prevention and treatment of cancer in man. They vary widely between individuals, and the basis of this variation is not understood. RTPCRRFLP analysis of mRNA from normal human lung tissue reveals that the two MGMT alleles are frequently expressed at different levels, indicating that there is a genetic component to inter-individual variation of MGMT levels and that at least some of this variation maps close to or within the MGMT locus.
Abbreviations: AEI, allelic expression imbalance; MGMT, O6-alkylgua- nine-DNA alkyltransferase; NNK, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone; NNN, N-nitrosonornicotine
| Introduction |
|---|
|
|
|---|
The DNA in cells is under constant attack from an enormous variety of endogenous and exogenous agents that introduce a vast array of different types of damage into the genome. In order to maintain functional integrity, an equally impressive army of DNA damage detection and processing mechanisms has evolved. One of these systems, relevant to both carcinogenesis and cancer chemotherapy, is the DNA repair protein O6-alkylguanine-DNA alkyltransferase (MGMT). This protein operates by the stoichiometric transfer of the O6-alkyl group to a cysteine residue in its own active site (for recent reviews see refs 14). As has been clearly shown in normal, transgenic (over-expressing) and knockout rodent models, MGMT constitutes a major line of cellular defence against the toxic and carcinogenic effects of DNA alkylation at the O6 position of guanine. Mice deficient in MGMT are more susceptible both to the toxic effects of alkylating antitumour agents and to tumour induction by alkylating carcinogens (57), while in transgenic models, mice expressing increased levels of MGMT are more resistant to alkylating carcinogens (8,9) and also have a lower frequency of spontaneous tumours (10,11). In humans, MGMT is expressed at different levels in different tissues and there is considerable inter-individual variation in the activity levels in particular tissues (reviewed in ref. 3). However, the causes of inter-individual differences in expression levels are unclear, in particular, whether there is a genetic component for this variability.
In chronic smokers, the bronchial epithelium is repeatedly exposed to carcinogenic compounds present in tobacco smoke. Among these carcinogens, alkylating agents such as 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and N-nitrosonornicotine (NNN) are thought to play an important role in the damage events that can ultimately result in neoplastic transformation (12). The metabolic systems that activate and inactivate such molecules and the pathways processing the induced genetic damage are considered to be major determinants of cancer risk in smokers (13). Since NNN and NNK generate lesions in DNA that are recognized by MGMT (14), differences in MGMT activity in normal tissues may be another factor that influences inter-individual differences in susceptibility to lung cancer.
Unequal expression of the alleles of autosomal genes (allelic expression imbalance; AEI) has long been known in tumours (e.g. refs 15,16) where it reflects somatic alterations at the DNA level, such as amplification, deletions, duplications or translocations, and the deregulation of epigenetic control mechanisms. These processes are hallmarks of tumour development (17). Until recently, AEI in normal human tissues has been mainly of interest in relation to imprinting, a process in which CpG methylation is thought to play an important role but that affects comparatively few genes in humans (18). However, it is now becoming apparent that AEI in normal tissues is not a rare phenomenon: Yan et al. (19) reported AEI in half of 12 human genes they examined. They also showed that the segregation of expression patterns in pedigrees is consistent with Mendelian inheritance of alleles with low or high expression, thus indicating that AEI results from sequence variation in cis acting elements affecting expression. In the present report, we have investigated in a panel of normal human lung tissues whether or not MGMT alleles are expressed at different levels.
| Materials and methods |
|---|
|
|
|---|
Sample selection
DNA and total RNA were extracted from the histologically normal lung tissue of resectable-staged NSCLC patients as described previously (20). The use of previously collected, archived, patient-derived material for the analysis of lung cancer-related gene expression was approved by the Liverpool Research Ethics Committee (2K/007). Initially the DNA samples were screened to identify individuals heterozygous for a polymorphism in the third position of codon 53 in exon 3 of the MGMT gene (21) (dbSNP id: rs1803965). As this polymorphism is silent, it does not change the activity of the coding protein (22) and previous investigations have found no association with cancer (21,23). The C but not the T allele can be cleaved by the restriction enzyme Hpy188I.
RTPCR
Normal tissue cDNA was synthesised from 1 µl aliquot of total RNA (
35 ng) in a 20 µl poly T-primed reaction using a Promega Reverse Transcription System (as directed by the manufacturer) and was stored at -20°C. An aliquot (0.5 µl) of this target cDNA was used in RTPCR assays. Primers for MGMT (HypF: 5' gagctgtctggttgtgagcag 3' and HpyR: 5' gggctggtggaaataggcatt 3') and for KRAS (KRASF: 5' gcttcattaatttgtttcacacca 3' and KRASR: 5' aagttatggaattccttttattgaaacatc 3') were positioned such that the product obtained was cDNA specific. This was verified experimentally by test amplifications of cDNA and genomic DNA targets. A stock reaction mix was prepared according to the number of tubes +1 consisting of, per tube: 42 µl distilled water, 5 µl of 10x Taq reaction buffer, 0.5 µl of each primer, 0.5 µl of a 250 mM dNTP mix and 1.25 U of Roche Taq polymerase. The stock mix was vortexed after Taq addition and 49 µl added to each tube. Reactions were immediately transferred to a Perkin Elmer 9600 thermocycler and heated at 94°C for 2 min, followed by 32 cycles of 58°C for 1 min, 74°C for 1 min, and 94°C for 1 min, and finally 58°C for 2 min and 74°C for 10 min. PCR products were visualised by UV illumination of 2.5% TBE agarose gels containing 0.5 µg/ml ethidium bromide.
PCR
PCR set-up and cycling conditions (30 cycles) were identical to those used in the RTPCR assays with the exception of the particular target (in this case genomic DNA) and primer positioning. Amplification of MGMT exon 3 was carried out using primers HpyDF (5' agacgtgtgtgcccatgaagt 3'; located in intron 2) and HpyR (5' gggctggtggaaataggcatt 3').
RFLPRTPCR and RFLPPCR analyses
Ten microlitres of each PCR product (
0.5 µg) was digested with the 3 U of the particular restriction endonuclease (NEB) necessary to visualize the cSNP under analysis, in 40 µl reactions (manufacturer's 1x buffer) at 37°C for 2 h. Digests were visualized by gel electrophoresis and relative allelic expression quantified by running 1 µl aliquots of the digest on an Agilent 2100 bioanalyser (Agilent Technologies Wokingham, UK) across a DNA 1000 LabChip®.
| Results |
|---|
|
|
|---|
Fifteen of the 83 individuals included in the analysis were found to be heterozygous. For 12 of these normal tissue samples, the corresponding total RNA was also available and was used to determine the relative transcript levels of the two MGMT alleles.
Marked differences in the relative abundance of the MGMT transcripts encoded by the two MGMT alleles were observed in seven of 12 patients (Figure 1) as exemplified by samples 267, 279 and 282 (Figure 1A). The extent of the differences were up to >4-fold (Figure 2) and this is considerably higher than the average reported by Yan et al. (19) for the genes that they examined.
|
|
In order to assess if the imbalance was in any way a technical artifact, a consequence of the materials and/or methods used in our study, we examined the expression of the two alleles of the unrelated gene KRAS2. In contrast to the observation with MGMT, the KRAS2 gene demonstrated no allelic imbalance of expression (Figure 1B), in 13 informative normal pulmonary tissue samples. This observation emphasizes the large differences seen in the MGMT alleles.
| Discussion |
|---|
|
|
|---|
In the present report, marked differences in the expression levels of the two MGMT alleles have been found in the normal lung. To our knowledge, this is the first report of AEI in MGMT normal human tissues.
The basis of allelic expression differences could be the clonal expansion of a cell carrying a mutation in one allele. However, this seems unlikely as in each case the clone would need to have given rise to histologically normal lung structures and moreover, a similar phenomenon would need to have occurred at high frequency in the patients examined. Another possibility is that the observed AEI is exclusively due to epigenetic modifications of cis acting elements, as observed in imprinted genes (18). This cannot be excluded without examining the segregation of allelic expression levels in families. However, imprinting has not been described for genes in 10q26, the chromosomal region where MGMT is located, nor in the syntenic mouse region. Therefore, the most probable cause for the differences in allelic expression are (germ-line) sequence differences between alleles.
As MGMT expression in tumours can differ substantially from that of surrounding normal tissue (3), it would be interesting to know whether AEI occurs in tumours and how it relates to the patterns observed in normal tissue. However, since, as pointed out in the Introduction, allelic expression patterns in tumours reflect genetic and epigenetic aberrations occurring during tumour development, differences in expression pattern between normal tissues and matching malignant lesions might be anticipated. Analysis of allelic imbalance in tumours is thus unlikely to shed additional light on the processes governing inter-individual differences in normal tissues.
There are several mechanisms by which sequence variation within a gene can influence its transcript levels. These include variations in sequence motifs that directly affect transcription factor binding and/or message processing. There is extensive evidence, mainly from malignant tissues and immortalized cell lines, that CpG methylation of the promoter and of sequences outside the promoter region can affect MGMT expression (2426; reviewed in refs 1,4). However, there is no evidence that this occurs in an allele-specific manner or for the general relevance of such mechanisms in normal tissues. The polymorphism used to show AEI does not affect coding and is thus unable to influence the functional activity of the protein (22), although it is possible that it might affect the efficiency of MGMT mRNA transcription and or processing. However, it seems more probable that the marker reflects the presence of another polymorphism that does affect mRNA expression or processing and therefore the functional activity of the MGMT gene. The fact that the same marker allele was over- and under-represented in different samples indicates that such determinants of allele specific differences in expression are not in strong linkage disequilibrium with the marker used.
Our results indicate, for the first time, that there is genetic component to inter-individual variation of MGMT levels in normal human tissues. It is probable that at least some of the sequence variation involved is located close to or within the MGMT locus and that it acts in cis. Since MGMT protects cells against the toxic and mutagenic effects of DNA guanine O6-alkylation damage, differences in expression levels in normal tissues may significantly contribute to cancer risk. They may also play a role in the toxicities in normal tissues that determine the success or failure of anticancer drug therapies that involve O6-alkylating agents.
| Notes |
|---|
4 To whom correspondence should be addressed Email: gmargison{at}picr.man.ac.uk
| Acknowledgments |
|---|
This work was funded by the Roy Castle Lung Cancer Foundation and Cancer Research-UK.
| References |
|---|
|
|
|---|
- Pegg,A.E. (2000) Repair of O6-alkylguanine by alkyltransferases. Mutat. Res., 462, 83100.[CrossRef][ISI][Medline]
- Kaina,B. and Christmann,M. (2002) DNA repair in resistance to alkylating anticancer drugs. Int. J. Clin. Pharm. Ther., 40, 354367.[ISI][Medline]
- Margison,G.P., Povey,A.C., Kaina,B. and Santibáñez-Koref,M.F. (2003) Variability and regulation of O6-alkylguanine-DNA alkyltransferase. Carcinogenesis, 24, 625635.
[Abstract/Free Full Text] - Margison,G.P. and Santibáñez-Koref,M.F. (2002) O6-Alkylguanine-DNA alkyltransferase: role in carcinogenesis and chemotherapy. Bioessays, 24, 255266.[CrossRef][ISI][Medline]
- Tsuzuki,T., Sakumi,K., Shiraishi,A., Kawate,H., Igarashi,H., Iwakuma,T., Tominaga,Y., Zhang,S., Shimizu,S. and Ishikawa,T. (1996) Targeted disruption of the DNA repair methyltransferase gene renders mice hypersensitive to alkylating agents. Carcinogenesis, 17, 12151220.
[Abstract/Free Full Text] - Sakumi,K., Shiraishi,A., Shimizu,S., Tsuzuki,T., Ishikawa,T. and Sekiguchi,M. (1997) Methylnitrosourea-induced tumourigenesis in MGMT gene knockout mice. Cancer Res., 57, 24152418.
[Abstract/Free Full Text] - Kawate,H., Sakumi,K., Tsuzuki,T., Nakatsuru,Y., Ishikawa,T., Takahashi,S., Takano,H., Noda,T. and Sekiguchi,M. (1998) Separation of killing and tumorigenic effects of an alkylating agent in mice defective in two of the DNA repair genes. Proc. Natl Acad. Sci. USA, 95, 51165120.
[Abstract/Free Full Text] - Dumenco,L.L., Allay,E., Norton,K. and Gerson,S.L. (1993) The prevention of thymic lymphomas in transgenic mice by human O6-alkylguanine-DNA alkyltransferase. Science, 259, 219222.
[Abstract/Free Full Text] - Nakatsuru,Y., Matsukuma,S., Nemoto,N., Sugano,H., Sekiguchi,M. and Ishikawa,T. (1993) O6-Methylguanine-DNA methyltransferase protects against nitrosamine-induced hepatocarcinogenesis. Proc. Natl Acad. Sci. USA, 90, 64686472.
[Abstract/Free Full Text] - Zhou,Z.Q., Manguino,D., Kewitt,K., Intano,G.W., McMahan,C.A., Herbert,D.C., Hanes,M., Reddick,R., Ikeno,Y. and Walter,C.A. (2001) Spontaneous hepatocellular carcinoma is reduced in transgenic mice overexpressing human O6-methylguanine-DNA methyltransferase. Proc. Natl Acad. Sci. USA, 98, 1256612571.
[Abstract/Free Full Text] - Qin,X., Zhang,S., Matsukuma,S., Zarkovic,M., Shimizu,S., Ishikawa,T. and Nakatsuru,Y. (2000) Protection against malignant progression of spontaneously developing liver tumors in transgenic mice expressing O6-methylguanine-DNA methyltransferase. Jpn. J. Cancer Res., 91, 10851089.[CrossRef][ISI]
- Hecht,S.S. (1999) Tobacco smoke carcinogens and lung cancer. J. Natl Cancer Inst., 91, 11941210.
[Abstract/Free Full Text] - Hecht,S.S. (2002) Cigarette smoking and lung cancer: chemical mechanisms and approaches to prevention. Lancet Oncol., 3, 461469.[CrossRef][ISI][Medline]
- Peterson,L.A., Liu,X.K. and Hecht,S.S. (1993) Pyridyloxobutyl DNA adducts inhibit the repair of O6-methylguanine. Cancer Res., 53, 27802785.
[Abstract/Free Full Text] - Betticher,D.C., Thatcher,N., Altermatt,H.J., Hoban,P., Ryder,W.D.J. and Heighway,J. (1995) Alternative splicing produces a novel cyclin D1 transcript. Oncogene, 11, 10051011.[ISI][Medline]
- Ratschiller,D., Heighway,J., Gugger,M., Kappeler,A., Pirnia,F., Schmid,R., Borner,M.M. and Betticher,D.C. (2003) Cyclin D1 overexpression in bronchial epithelia of patients with lung cancer is associated with smoking and predicts survival. J. Clin. Oncol., 20, 20852093.
- Lengauer,C., Kinzler,K.W. and Vogelstein,B. (1998) Genetic instabilities in human cancers. Nature, 396, 643649[CrossRef][Medline]
- Oakey,R.J. and Beechey,C.V. (2002) Imprinted genes: identification by chromosome rearrangements and post-genomic strategies. Trends Genet., 18, 359366.[CrossRef][ISI][Medline]
- Yan,H., Yuan,W., Velculescu,V.E., Vogelstein,B. and Kinzler,K.W. (2002) Allelic variation in human gene expression. Science, 297, 1143.
[Free Full Text] - Heighway,J., Betticher,D., Knapp,T. and Hoban,P. (2003) Comparative multiplex PCR and allele-specific expression analysis in human lung cancer. Tools to facilitate target identification. Methods Mol. Med., 75, 291304.[Medline]
- Otsuka,M., Abe,M., Nakabeppu,Y., Sekiguchi,M. and Suzuki,T. (1996) Polymorphisms in the human O6-methylguanine-DNA methyltransferase gene detected by PCR-SSCP analysis. Pharmacogenetics, 6, 361363.[CrossRef][ISI][Medline]
- Inoui,R., Abe,M., Nakabeppu,Y., Sekiguchi,M., Mori,T. and Suzuki,T. (2000) Characterisation of human polymorphic DNA repair methyltransferase. Pharmacogenetics, 10, 5966.[CrossRef][ISI][Medline]
- Egyhazi,S., Ma,S., Smoczynski,K., Hansson,J., Platz,A. and Ringborg,U. (2002) Novel O6-methylguanine-DNA methyltransferase SNPs: a frequency comparison of patients with familial melanoma and healthy individuals in Sweden. Hum. Mutat., 20, 408409.[Medline]
- Danam,R.P., Howell,S.R., Remack,J.S. and Brent,T.P. (2001) Heterogeneous methylation of the O6-methylguanine-DNA methyltransferase promoter in immortalized IMR90 cell lines. Int. J. Oncol., 18, 11871193.[ISI][Medline]
- Esteller,M., Hamilton,S.R., Burger,P.C., Baylin,S.B. and Herman,J.G. (1999) Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res., 59, 793797.
[Abstract/Free Full Text] - Esteller,M., Gaidano,G., Goodman,S.N. et al. (2002) Hypermethylation of the DNA repair gene O6-methylguanine-DNA methyltransferase and survival of patients with diffuse large B-cell lymphoma. J. Natl Cancer Inst., 94, 2632.
[Abstract/Free Full Text] - Heighway,J. (1991) DdeI polymorphism within sequence encoding 3' untranslated region of c-Ki-ras2 (KRAS2). Nucleic Acids Res., 19, 5092.
[Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. J. Hung, M. Baragatti, D. Thomas, J. McKay, N. Szeszenia-Dabrowska, D. Zaridze, J. Lissowska, P. Rudnai, E. Fabianova, D. Mates, et al. Inherited Predisposition of Lung Cancer: A Hierarchical Modeling Approach to DNA Repair and Cell Cycle Control Pathways Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2736 - 2744. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Margison, J. Heighway, S. Pearson, G. McGown, M. R. Thorncroft, A. J. Watson, K. L. Harrison, S. J. Lewis, K. Rohde, P. V. Barber, et al. Quantitative trait locus analysis reveals two intragenic sites that influence O6-alkylguanine-DNA alkyltransferase activity in peripheral blood mononuclear cells Carcinogenesis, August 1, 2005; 26(8): 1473 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Huang, A. F. Olshan, S. M. Schwartz, S. I. Berndt, C. Chen, V. Llaca, S. J. Chanock, J. F. Fraumeni Jr., and R. B. Hayes Selected Genetic Polymorphisms in MGMT, XRCC1, XPD, and XRCC3 and Risk of Head and Neck Cancer: A Pooled Analysis Cancer Epidemiol. Biomarkers Prev., July 1, 2005; 14(7): 1747 - 1753. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



