Skip Navigation


Carcinogenesis Advance Access originally published online on August 29, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
24/11/1717    most recent
bgg131v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Bull, A. W.
Right arrow Articles by Rafter, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bull, A. W.
Right arrow Articles by Rafter, J. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 24, No. 11, 1717-1722, November 2003
© 2003 Oxford University Press


CANCER BIOLOGY

Activation of PPAR {gamma} in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR {gamma}

Arthur W. Bull1,4, Knut R. Steffensen2, Jörg Leers2 and Joseph J. Rafter3

1 Oakland University, Department of Chemistry, Rochester MI 48309-4477, USA, 2 Center for Biotechnology, Karolinska Institute, NOVUM, 141 86 Huddinge, Sweden and 3 Department of Medical Nutrition, Karolinska Institute, NOVUM, 141 86 Huddinge, Sweden


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The nuclear hormone receptor peroxisome proliferator-activated receptor (PPAR) {gamma} plays an important role in the differentiation of intestinal cells and other tissues. Real-time PCR examination of PPAR mRNA for {gamma}1, {gamma}2 and {gamma}3, in Caco-2 and HCT-116 colon cell lines showed that {gamma}3 is the most abundant message in both lines. Treatment of Caco-2 cells with sodium butyrate, which induces cell differentiation, also leads to an increase in all three PPAR mRNAs. In contrast, treatment of HCT-116 cells with sodium butyrate, which does not lead to differentiation of these cells, causes a decrease in the amount of all three PPAR mRNAs. Furthermore, the amount of PPAR mRNA is greater in Caco-2 cells than in HCT-116 cells at all times examined. As several oxidative metabolites of linoleic acid, including 13-hydroxyoctadecadienoic acid (13-HODE) and 13-oxooctadecadienoic acid (13-OXO) have been shown to bind PPAR, and there is a strong positive correlation between enzymes for metabolism of linoleate oxidation products, intestinal cell differentiation and the distribution of PPAR, we also performed a detailed investigation of the activation of PPAR {gamma} by 13-HODE and 13-OXO. For these experiments, Caco-2 and HCT-116 cells were transfected with constructs containing PPAR {gamma}1 or {gamma}2 then a PPRE-luc reporter construct. Exposure of transfected cells to micromolar concentrations of 13-HODE or 13-OXO produced concentration-dependent increases in luciferase activity. In addition, the two linoleate metabolites activate endogenous PPAR in these cell lines transfected with only PPRE-luc. The data substantiate the contention that oxidation products of linoleic acid are metabolically produced endogenous ligands for PPAR {gamma} and that PPAR {gamma} plays an important role in the differentiation of intestinal cells.

Abbreviations: 13-HODE, 13-hydroxyoctadecadienoic acid; 13-OXO, 13-oxooctadecadienoic acid; PPAR, peroxisome proliferator-activated receptor


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Peroxisome proliferator-activated receptor {gamma} (PPAR) is a ligand-activated nuclear receptor that has been shown to be important for the differentiation of intestinal epithelial cells, adipocytes and other cell types (15). There are at least two isoforms of PPAR {gamma} protein in human colon cells and there are three or more different mRNAs that code for these two proteins (69). To date no functional difference between the two isoforms of PPAR has been identified and the significance of the different mRNAs also remains to be determined, although tissue-specific expression patterns have been observed.

In intestinal tissue, activation of PPAR generally induces differentiation, although in Min mice, which are predisposed to the development of intestinal neoplasia, activation of PPAR {gamma} leads to a slight increase in tumorigenesis (1015). This apparent contradiction has been partly explained by the recent demonstration of a link between the functions of PPAR, beta-catenin and APC. In particular, mutations in the APC gene destroy the ability of PPAR activation to decrease beta-catenin and inhibit colon tumorigenesis (16). Thus, as a clarification of the role of PPAR in intestinal cell regulation begins to emerge, the identification of endogenous activators of this nuclear receptor take on greater importance.

There is some discussion in the literature concerning endogenous ligands for PPAR although it is known that certain fatty acids and their oxidation products are capable of binding and activating PPARs (4,5,1720). In particular, it has been shown that the oxidative metabolism of linoleic acid produces several bioactive metabolites that bind to PPAR (18). Furthermore, in colon cells there is a strong positive correlation between the distribution of PPAR and the enzymes responsible for the metabolism of linoleic acid (1,2,21,22). These relationships have led some to suggest that the connection between high dietary fat and enhanced intestinal tumorigenesis is mediated in part through PPAR-dependent processes.

At least two PPAR ligands are produced during the oxidative metabolism of linoleic acid. The initial reactions in this pathway lead to the production of 13-hydroxyoctadecadienoic acid (13-HODE), which has been linked to cell proliferation (23,24). Secondary metabolism of 13-HODE by 13-HODE dehydrogenase yields the 2,4-dienone 13-oxooctadecadienoic acid (13-OXO), which is also a ligand for PPAR {gamma} (18). Thus, the fact that the enzyme 13-HODE dehydrogenase and PPAR are expressed at higher levels in differentiated cells appears to be more than a coincidence.

In the present work we have examined the distribution of PPAR {gamma}1, {gamma}2 and {gamma}3 mRNA in colon cancer cell lines under conditions of induced and spontaneous differentiation. In addition, the ability of two metabolites of linoleic acid, 13-HODE and (13-OXO) to activate PPAR has been investigated. The results provide further evidence of the relationship between PPAR and intestinal cell differentiation, and support the suggestion that metabolically generated oxidative metabolites of linoleic acid function as endogenous ligands for PPAR.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell culture
Human tumor cell lines Caco-2 and HCT-116 were purchased from the ATCC (Manassas VA 20110) and were used for all experiments described. Caco-2 cells were maintained in DMEM with 20% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin and 100 µg/ml streptomycin in a humidified atmosphere of 95% air, 5% CO2 at 37°C. HCT-116 cells were maintained in DMEM with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin in a humidified atmosphere of 95% air, 5% CO2 at 37°C. All cells were given fresh medium every other day and subcultured weekly. When described below, some cells were given media containing 4 mM sodium butyrate for various lengths of time.

Compounds
The linoleate metabolites 13-HODE and 13-OXO were prepared as described previously; the compounds were delivered as stock solutions in ethanol (25). BRL 49653 was delivered as a stock solution in DMSO (26). Control cultures received an equivalent volume of the appropriate vehicle.

Transfection and luciferase assay
The PPRE-TK-luc reporter was constructed by ligating the pre-ligated dimer of the annealed oligonucleotides AGCTTCTGAACTAGGGCAAAGTTGAG and TCGACTCAACTTTGCCCTAGTTCAGA into a Sal1 digested derivative of the pGL3-Basic reporter vector containing the thymidine kinase promoter (27,28). The binding site used has been shown to be preferentially bound by PPAR/RXR heterodimers but not by RXR homodimers (29).

Transfections with the PPRE-luc reporter vector and the PPAR expression vector were accomplished with the use of the Lipofectamine PLUS reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Approximately 3.5 x 104 cells were plated in each well of a 24-well plate in antibiotic-free medium and allowed to grow overnight to ~70% confluence. For transfection, the medium was replaced with serum-free medium (200 µl) and each well was treated with 0.4 µg of each DNA for 5–6 h, then complete medium containing the respective ligand at the appropriate concentration was added and the cells were incubated for an additional 36 h prior to luciferase assays. Three wells were transfected for each condition or construct and all experiments were repeated at least twice. For treatment of Caco-2 cells with PPAR ligands, the serum content of the medium was reduced to 10%. As a positive control for transfection and PPAR activation, all experiments also included a series of wells treated with BRL 49653.

For luciferase activity assays the GenGlow kit from Thermo Labsystems (Helsinki, Finland) was used. Briefly, the medium was removed, cells were rinsed with phosphate-buffered saline and lysed by incubation for 30 min at 4°C in 40 mM Tris–acetate buffer, pH 8.0, containing 10 mM EDTA, 10% glycerol (v/v) and 1% Triton X. Cell extracts were clarified by brief centrifugation, then aliquots of 30–50 µl were transferred to non-transparent 96-well plates prior to addition of luciferin and ATP. Luminescence was determined using an automatic luminometer, Lucy 2 (Anthos Labtec Instruments, Salzburg, Austria). Protein concentration in the lysates was determined by the method of Bradford and the relative luminescence measured was expressed as luminescence/mg protein (30). For comparison, the control cultures were set to a value of 1 and other cultures are expressed as fold increase in luminescence/mg protein over control. As a positive control for transfection efficiency, in each experiment, a set of wells was also treated with 5 µM BRL 49653. Triplicate wells were prepared for each condition and each experiment was repeated at least twice.

mRNA quantification and real-time PCR of PPAR
For preparation of mRNA, cells were grown in T-25 flasks as described above. Cells were harvested and total RNA samples were purified using the RNeasy mini kit, (Qiagen, Valencia, CA). The isolated RNA was checked for integrity by agarose gel electrophoresis. Samples of 1 µg RNA were treated with DNase (Invitrogen, amplification grade) before reverse transcription into cDNA by Superscript II (Invitrogen) using degenerated oligo dT (a mix of TTTTTTTTTTTTTTTTTTT-A/G/C) according to the company's instructions. Generally, cDNA from 50 ng RNA (0.5 ng for detection of 18S RNA) was applied for quantification of gene expression by Taqman® real-time RT–PCR (Applied Biosystems, Foster City, CA) using the direct comparative method for data analysis. Primer/probe sequences are given in Table I. The commercially available reaction mixture for 18S (Applied Biosystems) was used as a standard for normalization of mRNA levels in all experiments. The relative efficiency of all target and reference amplicons was assayed by dilution analysis and found to be equal.


View this table:
[in this window]
[in a new window]
 
Table I. Primer and probes

 
Western blot analysis
For analysis of PPAR expression in control and transfected cells, nuclear extracts were prepared by differential centrifugation prior to SDS–polyacrylamide gel electrophoresis. The protein concentrations of the extracts were measured by the method of Bradford (30). Equal amounts of extract (4 µg protein) were loaded in each lane and separated on a 10% SDS–polyacrylamide gel. For blotting, the primary antibody against PPAR {gamma}1,2 (BIOMOL, Plymouth Meeting, PA) was used at a 1:2000 dilution and the secondary antibody was anti-rabbit IgG coupled to horseradish peroxidase (Amersham, Biosciences, Piscataway, NJ) at a 1:20 000 dilution. Spots were visualized by the Supersignal chemiluminescent substrate kit (Pierce Biotechnology Inc., Rockford, IL).

Alkaline phosphatase
The activity of alkaline phosphatase as a marker of differentiation was assayed by monitoring the hydrolysis of p-nitrophenyl phosphate spectrophotometrically at 405 nm and pH 10.4.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
RT–PCR examination of PPAR mRNA
To determine the isoforms of PPAR produced by Caco-2 and HCT-116 cells, total RNA was prepared and real-time quantitative PCR was used to profile expression levels of PPARs {gamma}1, {gamma}2 and {gamma}3. The three probes are directed to Exon A1 ({gamma}1), Exon B ({gamma}2) and Exon A2 ({gamma}1 and {gamma}3). The expression of PPAR mRNA was examined in control cultures and cultures that had been grown in 4 mM sodium butyrate for 3 days to induce differentiation (13). As shown in Table II, the most abundant PPAR message in Caco-2 cells is {gamma} 3, which is ~100-fold more abundant than either {gamma}2 or {gamma}1. Growth of Caco-2 cells in sodium butyrate induces the production of all three species of PPAR mRNA by 3- to 6-fold over the 3 days of the experiment.


View this table:
[in this window]
[in a new window]
 
Table II. PPAR {gamma} target gene expression in Caco-2 cells

 
The analysis of PPAR gene expression in HCT-116 cells is presented in Table III. As for the Caco-2 cells, the HCT-116 cells were grown in the presence of 4 mM sodium butyrate for 3 days. Sodium butyrate reversibly inhibits the growth of HCT-116 cells but they do not differentiate (31). The relative abundance of PPAR messages in HCT-116 cells is similar to that in Caco-2 cells. In particular, the {gamma}3 isoform is most abundant, although the difference between this form and the other PPAR isoforms is less dramatic than in Caco-2 cells. However, the response of HCT-116 cells to butyrate is distinctly different than that of Caco-2 cells, in particular, growth of HCT-116 cells in sodium butyrate leads to a reduction in the level of all forms of PPAR message.


View this table:
[in this window]
[in a new window]
 
Table III. PPAR {gamma} target gene expression in HCT-116 cells

 
As shown in Table IV, a comparison of the relative levels of each PPAR isoform in Caco-2 and HCT-116 cells at 3 days of culture shows that Caco-2 cells have between 3- and 239-fold ({gamma}1) higher levels of PPAR {gamma} mRNA than HCT-116 cells. With respect to the most abundant PPAR mRNA, {gamma}3, the differences between Caco-2 and HCT-116 cells are also significant. The differences observed are consistent with the relative degree of differentiation of the two cell lines.


View this table:
[in this window]
[in a new window]
 
Table IV. Relative PPAR mRNA levels in HCT-116 and Caco-2 cells

 
Given that Caco-2 cells undergo either butyrate-induced or spontaneous differentiation, experiments were performed to monitor changes in PPAR message in these two situations as the mechanism of differentiation may differ between spontaneous and chemically induced processes. Caco-2 cells were grown for 26 days in control medium or in the presence of 4 mM sodium butyrate. Cultures were harvested weekly and the level of PPAR mRNA was determined by real-time PCR as described above. To assess the degree of differentiation, the well-characterized marker of Caco-2 differentiation, alkaline phosphatase, was measured on parallel cultures.

The cells grown in control medium quickly became superconfluent whereas the butyrate-treated cells did not increase in cell number but did produce a large amount of extracellular-matrix material. The analysis of PPAR mRNA levels and alkaline phosphatase activity is presented in Table V. The relative abundance of individual PPAR mRNA species is similar to the previous experiment (Table II) with PPAR {gamma}3 being most abundant. However, the difference between the amount of {gamma}3 and the other two isoforms is not as great. Long-term treatment with sodium butyrate increases the level of PPAR {gamma}2 and {gamma}3, although it is noteworthy that the increase is not dramatically different than that which occurs during spontaneous differentiation. The increased differentiation of the Caco-2 cells during long-term culture is also reflected in the level of alkaline phosphatase activity, although in contrast to PPAR levels, growth in 4 mM butyrate has dramatic effects on the level of enzyme activity when compared with the control cultures.


View this table:
[in this window]
[in a new window]
 
Table V. PPAR {gamma} target gene expression and alkaline phosphatase activity in long term Caco-2 cells

 
Activation of PPAR by oxidized linoleate
Since PPAR {gamma} mRNA is strongly linked to the differentiation of colon tumor cell lines, a series of experiments was performed to examine the ability of the linoleate oxidation products, 13-HODE and 13-OXO, to activate PPAR. For these experiments, HCT 116 cells were transfected with a PPRE-luc reporter vector and either PPAR {gamma}1 or PPAR {gamma}2 expression vectors. After a 6 h transfection, the cells were given media containing various concentrations of 13-HODE or 13-OXO and luminescence was measured 36 h later. The results are presented in Figure 1. Both 13-HODE and 13-OXO produce concentration-dependent increases in luciferase activity. The activation of PPAR by the linoleate oxidation products was as strong as that with BRL although the maximal activation occurred at higher concentrations. Similar results were obtained when Caco-2 cells were used for transfection although the fold increase in luciferase activity upon treatment with 13-HODE or 13-OXO was less than that observed in HCT-116 cells (Figure 1). On the other hand, in the doubly transfected Caco-2 cells, BRL was significantly more effective than the linoleate oxidation products. There does not appear to be a significant difference in the activation of PPAR {gamma}1 and {gamma}2 by 13-HODE and 13-OXO, although, in general, {gamma}1 was slightly more responsive than {gamma}2.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. Activation of PPAR by 13-HODE and 13-OXO in HCT-116 and Caco-2 cells transfected with PPAR {gamma} plus PPRE-luc reporter constructs. The fold increase over control for Caco 2 cells transfected with PPAR {gamma}1 and treated with 5 µM BRL is 6.6.

 
Additional experiments were performed to determine whether 13-HODE and 13-OXO are capable of activating endogenous PPAR isoforms in Caco-2 and HCT-116 cells. For these experiments, cells were grown in the presence of 4 mM sodium butyrate to modulate the levels of PPAR. As shown above and elsewhere, Caco-2 cells grown in butyrate undergo differentiation and an increase in PPAR levels, whereas, HCT-116 cells are reversibly growth inhibited but do not undergo differentiation (13,31). Control cultures were grown in the same media without butyrate. After 4 days, cells were transfected with PPRE-luc reporter vector, treated with the indicated concentrations of 13-HODE or 13-OXO, and assayed for luciferase activity. The results for HCT-116 cells are presented in Figure 2, while those for Caco-2 cells are presented in Figure 3.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. Effect of 13-HODE and 13-OXO on endogenous PPAR in HCT-116 cells transfected with PPRE-luc reporter construct. Some cultures were grown in the presence of 4 mM sodium butyrate for 4 days before transfection with PPRE-luc.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. Effect of 13-HODE and 13-OXO on endogenous PPAR in Caco-2 cells transfected with PPRE-luc reporter construct. Some cultures were grown in the presence of 4 mM sodium butyrate for 4 days before transfection with PPRE-luc.

 
In HCT 116 cells, both butyrate treated and control cells demonstrate activation of PPRE-luc upon exposure to 13-HODE or 13-OXO. There are no clear differences between butyrate treated and control cells and both metabolites exhibited similar levels of activation. On the other hand, in Caco-2 cells the ability of 13-OXO to activate PPRE-luc reporter vector is reduced in butyrate treated cultures compared with controls; this effect was reproduced in subsequent experiments and may be related to the metabolic distribution of 13-OXO in butyrate treated Caco-2 cells or to higher levels of endogenous PPAR ligands including 13-OXO.

Western analysis of PPAR expression
To assess the expression of PPAR {gamma} in cells transfected with the PPAR constructs, HCT-116 cells were transfected, grown for 36 h and then nuclear extracts were prepared for western blot analysis. As shown in Figure 4, there is detectable expression of PPAR in untransfected cells while in the transfected cells the level of PPAR protein is increased by transfection.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Western blot analysis of PPAR {gamma}1 and {gamma}2 protein in nuclear extracts of HCT-116 cells transfected with PPAR {gamma}1 and {gamma}2 expression vectors.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
There is a large body of evidence that PPAR {gamma} is important for the differentiation of intestinal epithelial cells (1,2,1013,32). In the present work we have shown that the levels of PPAR {gamma}1, {gamma}2 and {gamma}3 mRNAs increase during both butyrate-induced and spontaneous differentiation in Caco-2 colon tumor cells but not in undifferentiated HCT-116 cells. In addition, we have closely examined the activation of PPAR {gamma}1 and {gamma}2 by two endogenous, metabolically produced, metabolites of linoleic acid.

The distribution of PPAR mRNA in Caco-2 and HCT-116 cells is dominated by the {gamma}3 isoform. Furthermore, in Caco-2 cells this isoform is increased by treatment with the differentiation inducer sodium butyrate. Under basal conditions PPAR {gamma}3 mRNA is over 100-fold more abundant than the mRNAs for {gamma}1 and {gamma}2 while during butyrate-induced differentiation the {gamma}3 isoform can be >600-fold increased over the other two. Therefore, as a practical matter, the {gamma}3 message is most likely responsible for production of the PPAR activated by 13-HODE and 13-OXO in these two cell lines. It is certainly possible that other fatty acids and PPAR ligands activate proteins translated from the {gamma}1 and {gamma}2 isoforms.

In addition to differences in PPAR isoform distributions in a given cell line under various growth conditions, there are differences between Caco-2 and HCT-116 cells that are also noteworthy. Caco-2 cells undergo differentiation in the presence of sodium butyrate whereas HCT-116 cells do not show this response (13,31). Accordingly, the relative amount of PPAR mRNA is much greater in Caco-2 than in HCT-116 cells, and the changes induced by sodium butyrate in the two cell lines are consistent with the role of this nuclear receptor in cell differentiation. Specifically, Caco-2 PPAR mRNA increases in response to butyrate whereas the levels of PPAR mRNA in HCT-116 cells actually decrease when the cells are grown in the presence of sodium butyrate. However, in all cases, the {gamma}3 form is by far the most abundant.

The fact that no significant functional differences have been detected between the two species of PPAR protein suggests that control over the regulation of transcription and translation is of major importance to PPAR-dependent cellular outcomes. The high levels of PPAR {gamma}3 message in the two cell lines studied herein is in support of this suggestion, as is the recent report showing an increase in PPAR {alpha} and {gamma} protein during Caco-2 cell differentiation (33). Thus, gaining an understanding of the mechanisms controlling the {gamma}3 isoform of PPAR mRNA will yield significant insight into the regulation of cellular differentiation processes.

In addition to the control of the production of PPAR itself, the metabolic production of activators of the protein will obviously exert a major influence over cell differentiation. Among the most widely studied ligands for PPAR are ‘naturally occurring’ but non-enzymatically produced lipid oxidation products including 15-deoxy-{Delta}12,14-PGJ2 and compounds associated with the oxidation of LDL (3,17,18,34). However, it seems unlikely that control of an important cellular process would be achieved through non-enzymatic production of activators. Thus, the search for endogenous, metabolically produced activators of PPAR is clearly important. To that end, we have examined the activation of PPAR by 13-HODE and 13-OXO, two enzymatically produced oxidation products of linoleic acid whose metabolic pathways are relatively well characterized (21,25,3537). Both the synthesis and excretion of 13-HODE and 13-OXO are under cellular control and 13-OXO is also one of the relatively few examples of an endogenous substrate for glutathione transferases (37,38). The activation of PPAR by 13-HODE and 13-OXO reported herein is consistent with earlier reports that the enzyme responsible for the production of 13-OXO from 13-HODE, 13-HODE dehydrogenase, is involved in intestinal cell differentiation and that the distribution of 13-HODE dehydrogenase and PPAR {gamma} are similar within intestinal villi and crypts (1,21,22).

In both Caco-2 and HCT-116 cells, 13-HODE and 13-OXO activate PPAR at relatively low micromolar concentrations. These compounds activate PPAR transfected into the cells as well as the endogenous receptor. No dramatic difference between the two ligands was observed, although previous reports have suggested that 13-OXO is a stronger ligand for the ligand-binding domain of PPAR {gamma} (18). The activation of PPAR by these fatty acid metabolites occurs at somewhat higher concentrations than those for the synthetic ligand BRL 49653; however, the multiple metabolic pathways open to the endogenous ligands could reduce the effective concentrations of exogenously applied compounds. On the other hand, compartmentation of metabolic generation in intact cells could increase delivery of the endogenous activators to the PPAR protein.

The results of the present experiments have provided insight into the role of PPAR {gamma} in cell differentiation. The most abundant species of PPAR mRNA in Caco-2 and HCT-116 cells was shown to be the {gamma}3 isoform and higher levels are found in more differentiated cells. In addition, we have shown that 13-HODE and 13-OXO, enzymatically generated metabolites of linoleic acid, can serve as endogenous activators of both PPAR {gamma}1 and {gamma}2. The data are consistent with the previously reported correlations between the oxidative metabolism of linoleic acid and cell differentiation and thus, add support to the growing recognition of the important cell regulatory role played by oxidative metabolites of linoleic acid. It remains to be seen if these relationships provide a link between the levels of dietary linoleic acid and the development of colon tumorigenesis.


    Notes
 
4 To whom correspondence should be addressed Email: abull{at}oakland.edu Back


    Acknowledgments
 
We thank Farasat Zaman and Julie Poposki for technical assistance and Stephen A.Kliewer of the Glaxo Research Institute for the gift of BRL 49653. This work was supported by a grant from the Swedish Cancer Society (J.J.R.). Additional support came from the Norwegian Cancer Society (A97030/002 to K.R.S.), the National Cancer Institute of the USA (76420 to A.W.B.), and the Research Excellence Fund of Oakland University.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Lefebvre,A.-M., Paulweber,B., Fajas,L. et al. (1999) Peroxisome proliferator-activated receptor gamma is induced during differentiation of colon epithelium cells. J. Endocrinol., 162, 331–340.[Abstract]
  2. Mansen,A., Guardiola-Diaz,H., Rafter,J., Branting,C. and Gustafsson,J.-A. (1996) Expression of the peroxisome proliferator-activated receptor (PPAR) in the mouse colonic mucosa. Biochem. Biophys. Res. Comm., 222, 844–851.[CrossRef][Web of Science][Medline]
  3. Rosen,E.D. and Spiegelman,B.M. (2001) PPAR{gamma}: a nuclear regulator of metabolism, differentiation and cell growth. J. Biol. Chem., 276, 37731–37734.[Free Full Text]
  4. Vanden Heuvel,J.P. (1999) Peroxisome proliferator-activated receptors: a critical link among fatty acids, gene expression and carcinogenesis. J. Nutr., 129, 575S–580S.[Web of Science]
  5. Kliewer,S.A., Lenhard,J.M., Willson,T.M., Patel,I., Morris,D.C. and Lehmann,J.M. (1995) A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation. Cell, 83, 813–819.[CrossRef][Web of Science][Medline]
  6. Zhu,Y., Qi,C., Korenberg,J.R., Chen,X.-N., Noya,D., Rao,M.S. and Reddy,J.K. (1995) Structural organization of mouse peroxisome proliferator-activated receptor {gamma} (mPPAR{gamma}) gene: alternative promoter use and different splicing yield two mPPAR{gamma} isoforms. Proc. Natl Acad. Sci. USA, 92, 7921–7925.[Abstract/Free Full Text]
  7. Fajas,L., Auboeuf,D., Raspe,E. et al. (1997) The organization, promoter analysis and expression of the human PPAR gamma gene. J. Biol. Chem., 272, 18779–18789.[Abstract/Free Full Text]
  8. Fajas,L., Fruchart,J.-C. and Auwerx,J. (1998) PPAR{gamma}3 mRNA: a distinct PPAR {gamma} mRNA subtype transcribed from an independent promoter. FEBS Lett., 438, 55–60.[CrossRef][Web of Science][Medline]
  9. Zhou,J., Wilson,K.M. and Medh,J.D. (2002) Genetic analysis of four novel peroxisome proliferator activated receptor-{gamma} splice variants in monkey macrophages. Biochem. Biophys. Res. Comm., 293, 274–283.[CrossRef][Web of Science][Medline]
  10. Brockman,J.A., Gupta,R.A. and DuBois,R.N. (1998) Activation of PPAR gamma leads to inhibition of anchorage-independent growth of human colorectal cancer cells. Gastroenterology, 115, 1049–1055.[CrossRef][Web of Science][Medline]
  11. Sarraf,P., Mueller,E., Jones,D. et al. (1998) Differentiation and reversal of malignant changes in colon cancer through PPAR gamma. Nature Med., 4, 1046–1052.[CrossRef][Web of Science][Medline]
  12. Kitamura,S., Miyazaki,Y., Shinomura,Y., Kondo,S., Kanayama,S. and Matsuzawa,Y. (1999) Peroxisome proliferator-activated receptor gamma induces growth arrest and differentiation markers of human colon cancer cells. Jpn. J. Cancer Res., 90, 75–80.[CrossRef][Web of Science]
  13. Wächtershäuser,A., Loitsch,S.M. and Stein,J. (2000) PPAR-gamma is selectively upregulated in Caco-2 cells by butyrate. Biochem. Biophys. Res. Comm., 272, 380–385.[CrossRef][Web of Science][Medline]
  14. Lefebvre,A.-M., Chen,I., Desreumaux,P., Najib,J., Fruchart,J.-C., Geboes,K., Briggs,M., Heyman,R. and Auwerx,J. (1998) Activation of the peroxisome proliferator-activated receptor gamma promotes the development of colon tumors in C57BL/6 J-APCmin/+mice. Nature Med., 4, 1053–1057.[CrossRef][Web of Science][Medline]
  15. Saez,E., Tontonoz,P., Nelson,M.C., Alvarez,J.G.A., U,T.M., Baird,S.M., Thomazy,V.A. and Evans,R.M. (1998) Activators of the nuclear receptor PPAR gamma enhance colon polyp formation. Nature Med., 4, 1058–1061.[CrossRef][Web of Science][Medline]
  16. Girnun,G.D., Smith,W.M., Drori,S. et al. (2002) APC-dependent suppression of colon carcinogenesis by PPAR{gamma}. Proc. Natl Acad. Sci. USA, 99, 13771–13776.[Abstract/Free Full Text]
  17. Forman,B.M., Tontonoz,P., Chen,J., Brun,R.P., Spiegelman,B.M. and Evans,R.M. (1995) 15-Deoxy-{Delta}12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR{gamma}. Cell, 83, 803–812.[CrossRef][Web of Science][Medline]
  18. Nagy,L., Tontonoz,P., Alvarez,J.G.A., Chen,H. and Evans,R.M. (1998) Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR gamma. Cell, 93, 229–240.[CrossRef][Web of Science][Medline]
  19. Kliewer,S.A., Sundseth,S.S., Jones,S.A. et al. (1997) Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors {alpha} and {gamma}. Proc. Natl Acad. Sci. USA, 94, 4318–4323.[Abstract/Free Full Text]
  20. Forman,B.M., Chen,J. and Evans,R.M. (1997) Hypolipidemic drugs, polyunsaturated fatty acids and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc. Natl Acad. Sci., 94, 4312–4317.[Abstract/Free Full Text]
  21. Bull,A.W., Branting,C., Bronstein,J.C., Blackburn,M.L. and Rafter,J.J. (1993) Increases in 13-hydroxyoctadecadienoic acid (13-HODE) dehydrogenase activity during differentiation of cultured cells. Carcinogenesis, 14, 2239–2243.[Abstract/Free Full Text]
  22. Bronstein,J.C. and Bull,A.W. (1993) The correlation between 13-hydroxyoctadecadienoate dehydrogenase (13-HODE dehydrogenase) and intestinal cell differentiation. Prostaglandins, 46, 387–395.[CrossRef][Web of Science][Medline]
  23. Glasgow,W.C. and Eling,T.E. (1994) Structure-activity relationship for potentiation of EGF-dependent mitogenesis by oxygenated metabolites of linoleic acid. Arch. Bioch. Biophys., 311, 286–292.[CrossRef][Web of Science][Medline]
  24. Sauer,L.A., Dauchy,R.T., Blask,D.E., Armstrong,B.J. and Scalici,S. (1999) 13-Hydroxyoctadecadienoic acid is the mitogenic signal for linoleic acid-dependent growth in rat hepatoma 7288CTC in vivo. Cancer Res., 59, 4688–4692.[Abstract/Free Full Text]
  25. Bull,A.W. and Bronstein,J.C. (1990) Production of unsaturated carbonyl compounds during metabolism of hydroperoxy fatty acids by colonic homogenates. Carcinogenesis, 11, 1699–1704.[Abstract/Free Full Text]
  26. Oakes,N.D., Kennedy,C.J., Jenkins,A.B., Laybutt,D.R., Cisholm,D.J. and Draegen,E.W. (1994) A new antidiabetic agent, BRL-49653, reduces lipid availability and improves insulin action and glucoregulation in the rat. Diabetes, 43, 1203–1210.[Abstract]
  27. Wiebel,F.F., Steffensen,K.R., Treuter,E., Feltkamp,D. and Gustafsson,J.A. (1999) Ligand-independent coregulator recruitment by the triply activatable OR1/retiinoid X receptor-alpha nuclear receptor heterodimer. Mol. Endocrin., 13, 1105–1118.[Abstract/Free Full Text]
  28. Shinar,D.M., Endo,N., Rutledge,S.J., Vogel,R., Rodan,G.A. and Schmidt,A. (1994) NER, a new member of the gene family encoding the human steroid-hormone nuclear receptor. Gene, 147, 273–276.[CrossRef][Web of Science][Medline]
  29. Palmer,C.N.A., Hsu,M.H., Griffin,K.J. and Johnson,E.F. (1995) Novel sequence determinants in peroxisome proliferator signaling. J. Biol. Chem., 270, 16114–16121.[Abstract/Free Full Text]
  30. Bradford,M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248–254.[CrossRef][Web of Science][Medline]
  31. Bordonaro,M., Lazarova,D.L., Augenlicht,L.H. and Sartorelli,A.C. (2002) Cell type- and promoter-dependent modulation of the Wnt signaling pathway by sodium butyrate. Int. J. Cancer, 97, 42–51.[CrossRef][Web of Science][Medline]
  32. Kohno,H., Yoshitani,S., Takashima,S., Okumura,A., Hosokawa,M., Yamaguchi,H. and Tanaka,T. (2001) Troglitazone, a ligand for peroxisome proliferator-activated receptor {gamma}, inhibits chemically-induced aberant crypt foci in rats. Jpn. J. Cancer Res., 92, 396–403.[CrossRef][Web of Science]
  33. Huin,C., Schohn,H., Hatier,R., Bentejac,M., Antunes,L., Plenat,F., Bugaut,M. and Dauca,M. (2002) Expression of peroxisome proliferator-activated receptors alpha and gamma in differentiating human colon carcinoma Caco-2 cells. Biol. Cell, 94, 15–27.[CrossRef][Web of Science][Medline]
  34. Schild,R.L., Schaiff,W.T., Carlson,M.G., Cronbach,E.J., Nelson,D.M. and Sadovsky,Y. (2002) The activity of PPAR{gamma} in primary human trophoblasts is enhanced by oxidized lipids. J. Clin. Endocrinol. Metab., 87, 1105–1110.[Abstract/Free Full Text]
  35. Eling,T.E. and Glasgow,W.C. (1994) Cellular proliferation and lipid metabolism: importance of lipoxygenases in modulating epidermal growth factor-dependent mitogenesis. Cancer Metast. Rev., 13, 397–410.[CrossRef][Web of Science][Medline]
  36. Podgorski,I. and Bull,A.W. (2001) Energy-dependent export of the 13-oxooctadecadienoic acid-glutathione conjugate from HT-29 cells and plasma membrane vesicles. Biochim. Biophys. Acta, 1533, 55–65.[Medline]
  37. Bull,A.W., Seeley,S.K., Geno,J.L. and Mannervik,B. (2002) Conjugation of the linoleic acid oxidation product, 13-oxooctadeca-9,11-dienoic acid, a bioactive endogenous substrate for mammalian glutathione transferase. Biochim. Biophys. Acta, 1571, 77–82.[Medline]
  38. Wang,W. and Ballatori,N. (1998) Endogenous glutathione conjugates: occurrence and biological functions. Pharm. Rev., 50, 335–355.[Abstract/Free Full Text]
Received November 29, 2002; revised July 16, 2003; accepted July 24, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. J. Bajwa, J. W. Lee, D. S. Straus, and C. Lytle
Activation of PPAR{gamma} by rosiglitazone attenuates intestinal Cl- secretion
Am J Physiol Gastrointest Liver Physiol, July 1, 2009; 297(1): G82 - G89.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
R Marion-Letellier, P Dechelotte, M Iacucci, and S Ghosh
Dietary modulation of peroxisome proliferator-activated receptor gamma
Gut, April 1, 2009; 58(4): 586 - 593.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. R. Daniel, M. L. McCullough, R. C. Patel, E. J. Jacobs, W. D. Flanders, M. J. Thun, and E. E. Calle
Dietary Intake of {omega}-6 and {omega}-3 Fatty Acids and Risk of Colorectal Cancer in a Prospective Cohort of U.S. Men and Women
Cancer Epidemiol. Biomarkers Prev., February 1, 2009; 18(2): 516 - 525.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. L. Christianson, S. Nicoloro, J. Straubhaar, and M. P. Czech
Stearoyl-CoA Desaturase 2 Is Required for Peroxisome Proliferator-activated Receptor {gamma} Expression and Adipogenesis in Cultured 3T3-L1 Cells
J. Biol. Chem., February 1, 2008; 283(5): 2906 - 2916.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. N. Hall, H. Campos, H. Li, H. D. Sesso, M. J. Stampfer, W. C. Willett, and J. Ma
Blood Levels of Long-Chain Polyunsaturated Fatty Acids, Aspirin, and the Risk of Colorectal Cancer
Cancer Epidemiol. Biomarkers Prev., February 1, 2007; 16(2): 314 - 321.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
A. Klopotek, F. Hirche, and K. Eder
PPAR{gamma} Ligand Troglitazone Lowers Cholesterol Synthesis in HepG2 and Caco-2 Cells via a Reduced Concentration of Nuclear SREBP-2
Experimental Biology and Medicine, September 1, 2006; 231(8): 1365 - 1372.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W.-P. Koh, J.-M. Yuan, D. Van Den Berg, S. A. Ingles, and M. C. Yu
Peroxisome proliferator-activated receptor (PPAR) {gamma} gene polymorphisms and colorectal cancer risk among Chinese in Singapore
Carcinogenesis, September 1, 2006; 27(9): 1797 - 1802.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
G. Reiterer, M. Toborek, and B. Hennig
Quercetin Protects Against Linoleic Acid-Induced Porcine Endothelial Cell Dysfunction
J. Nutr., April 1, 2004; 134(4): 771 - 775.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
24/11/1717    most recent
bgg131v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Bull, A. W.
Right arrow Articles by Rafter, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bull, A. W.
Right arrow Articles by Rafter, J. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?