Carcinogenesis Advance Access originally published online on September 11, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 24, No. 12, 1897-1901,
December 2003
© Oxford University Press; all rights reserved
MOLECULAR EPIDEMIOLOGY AND CANCER PREVENTION |
Hypermethylation of p16INK4a in Chinese lung cancer patients: biological and clinical implications
Department of Chemical Etiology and Carcinogenesis, Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing 100021, P.R.China
| Abstract |
|---|
|
|
|---|
Promoter hypermethylation of the p16INK4a gene was investigated in 111 cases of tumor tissue, as well as in 136 circulating plasma and 95 sputum samples from Chinese patients with primary lung cancer, using a modified protocol of semi-nested methylation-specific-PCR (MSP). The results showed hypermethylated p16 sequence in 80.2% of tumor tissues and frequencies of 75.7 and 74.7% in plasma and sputum specimens, respectively. Among the patients, 50 cases of matched plasma, sputum and tumor tissue from the same individual were analyzed. Of these, hypermethylation of the p16 promoter was detected in 84.0% of the tumor tissues, with frequencies of 72.0 and 76.0% in the corresponding plasma and sputum, respectively. Notably, only patients whose tumor tissue showed hypermethylation of p16 exhibited the same aberrant methylation in their sputum and/or plasma. Hypermethylation of p16 in sputum and plasma samples may provide a more sensitive approach to molecular diagnosis of lung cancer than relying on conventional cytological analysis. Our data show that a combination of cytological analysis of sputum and examination of p16 hypermethylation in sputum and plasma identified 92.0% (46/50) of the lung cancer patients studied, offering an effective means of early detection of lung cancer.
Abbreviations: ADC, adenocarcinoma; ASC, adenosquamous carcinoma; LCLC, large cell lung cancer; MSP, methylation-specific PCR; NSCLC, non-small cell lung cancer; SCC, squamous cell carcinoma; SCLC, small cell lung cancer; TNM, tumor-node-metastasis; TSG, tumor suppressor gene
| Introduction |
|---|
|
|
|---|
Lung cancer is now the leading cause of tumor-related death in China. Mortality from lung cancer could be greatly reduced by diagnosis and treatment at early stages of the disease. Effective screening tools for early detection of lung cancer remains a major challenge in the field, however. Biomarkers that detect lung cancer in early stages, and identify pre-tumor or early tumor lesions, enabling earlier therapeutic intervention, would be invaluable resources.
Previous studies have shown that gene mutations in K-ras and p53, and microsatellite instability, can be detected in sputum and plasma samples from lung cancer patients, implicating their potential value as molecular biomarkers for this malignancy (18). Recently, studies on epigenetic changes in lung cancer have demonstrated that a number of genes, including p16, APC, FIHT, RARß, MGMT, DAPK, CDH13, RASSF1A, TIMP-3 and GSTP1 are hypermethylated in tumor tissues (919). DNA methylation plays an essential role in normal development and maintaining genomic stability (2022). Alterations in methylation patterns frequently occur in tumor cells, and hypermethylation in the promoter region of tumor suppressor genes, associated with an epigenetically mediated gene silencing, is a common feature in human cancers (23,24). Aberrant hypermethylation of p16INK4a, a well-known tumor suppressor gene, has been reported to be an early event in lung carcinogenesis and a potential biomarker for early diagnosis (25): previous studies showed that hypermethylation of p16 could be detected in the serum and/or plasma of patients with a variety of malignancies, including lung cancer (16,2628). This epigenetic alteration was reportedly detectable in sputum samples from patients prior to clinical evidence of malignancy (29,30). A nested-PCR approach permitting improvement of the methylation-specific PCR (MSP) procedure has made this amplification method more sensitive, facilitating the detection of aberrant methylation of p16 in nanogram-quantities of DNA from lung cancer patients (29,31).
We used previously a modified semi-nested MSP for analyzing the hypermethylation status of the p16 promoter in plasma DNA derived from non-small cell lung cancer (NSCLC) patients (31). Circulating plasma and sputum from lung cancer patients are specimens that can be more readily obtained by relatively non-invasive approaches. They, however, yield very limited quantities of DNA. In the present study, an MSP approach has been applied to an increased number and more diverse cases of plasma, as well as to sputum and tumor samples from Chinese primary lung cancer patients, with the aim of further evaluating aberrant methylation of the p16 promoter as an efficient biomarker for early detection of this malignancy.
| Materials and methods |
|---|
|
|
|---|
Human tissue samples
Circulating plasma, sputum and tumor tissue were collected from lung cancer patients in the Cancer Hospital, PUMC and CAMS. Sample numbers collected were 136, 95 and 111, respectively. Plasma and sputum samples were obtained before surgery. Among the 136 plasma samples, tumor tissues were obtained following surgical resection from 111 matched patients, and 50 of these 111 cases also provided sputum samples for analysis. Informed consent from the hospital was obtained from each patient before surgery. The histological type of the tumors investigated included squamous cell carcinoma (SCC), adenocarcinoma (ADC), adenosquamous carcinoma (ASC), large cell lung cancer (LCLC) and small cell lung cancer (SCLC), which were classified according to the WHO Histological Typing of Lung Tumors, and staged following the TNM classification of malignant tumors as defined by the International Union against Cancer.
Specimen preparation and DNA isolation
To enrich for the tumor cells from sections of paraffin-embedded tumor tissue, microdissection was carried out according to the protocol described previously (31). The tumor cells collected were digested with SDS/proteinase K, and the aqueous solution was extracted with phenolchloroform. DNA was isolated by ethanol precipitation using standard protocols.
Sputum specimens, treated with CytoLyt solution and PreservCyt solution (CYTYC, Boxborough, MA, USA) according to the manufacturer's recommendation, were centrifuged (2000 r.p.m. for 10 min at 4°C) to collect cell pellets, which were then washed twice with PBS. DNA from sputum cells was obtained by the standard method noted above.
All the circulating plasma samples collected were re-centrifuged to remove contaminating lymphocytes. DNA was isolated from the supernatant (400 µl) using a QIAamp Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer's instruction (31). From the final elution 50 µl was used for the bisulfite conversion, yielding 0.51.0 µg of DNA.
p16 hypermethylation analysis
Bisulfite conversion
Conversion was carried out following the protocol of Herman et al. (32). Briefly, plasma DNA (0.51.0 µg), or sputum or tumor tissue DNA (1.02.0 µg), was treated with sodium bisulfite (Sigma, MO, USA). After purification, 0.3 M NaOH incubation and ethanol precipitation, the DNA was resuspended in 20 µl of TE, as described previously (31). All bisulfite-converted DNA samples were stored at -20°C until subsequent PCR was performed.
MSP
A modified semi-nested MSP (31) was performed in a 25 µl reaction volume to detect hypermethylation of the p16 gene. In the first PCR, 5 µl of the bisulfite-treated DNA solution (that is,
60120 ng for plasma DNA, and 120250 ng for sputum and tumor tissue DNA) was added to a mixture of 200 µM dNTPs, 0.5 µM each of sense and antisense primers (p16MS and p16MAS2, TTATTAGAGGGTGGGGCGGATCGC and CCACCTAAATCGACCTCCGACCG, respectively), 1x PCR buffer and 2 U of Taq polymerase (Promega, WI, USA). The second PCR used 1 µl of 10-fold diluted products from the first PCR as the template, and the PCR reagents described above together with the specific antisense primer p16MAS1 (GACCCCGAACCGCGACCGTAA). Both PCR reactions consisted of 40 cycles at 95°C (30 s), 64/67°C (60 s), 72°C (60 s), with an initial denaturation at 95°C for 3 min and a final elongation at 72°C for 10 min.
To control for bisulfite conversion, all modified DNA was also amplified using the primers (p16US, p16UAS2 and p16UAS1) for unmethylated p16 sequence, under the same conditions described in reference (31).
DNA from a prostate cancer cell line, TSU-PR1, which contains methylated p16 (33), was used as a positive control for the MSP. Each of the PCR amplifications was repeated at least once to confirm the result.
Statistical analysis
2 test or Fisher's exact test was applied in statistical comparisons, and the statistic software SPSS 1.0 was run for analyzing the correlations between p16 hypermethylation and clinicopathological parameters.
| Results |
|---|
|
|
|---|
Efficiency test of semi-nested MSP
In this study, we evaluated efficiency of the modified semi-nested MSP used in examining plasma as well as sputum samples from cases of SCC and ADC, which represented clear clinical disease stages. The data derived from analyzing the plasma samples have proved our previous assumption that this modification significantly increased the sensitivity of the technique for all clinical stages (31). In the present investigation, the detectable frequency of hypermethylated p16 was increased from 50.7 (the first PCR) to 79.1% (the second PCR) in 67 cases of SCC (P = 0.0006), and from 36.6 (the first PCR) to 63.4% (the second PCR) in 41 cases of ADC (P = 0.0151) (data not shown). With sputum from 42 cases of SCC and 30 of ADC, the frequency was increased from 66.7 (the first PCR) to 81.0% (the second PCR) in the SCC (P = 0.1365), and from 43.3 (the first PCR) to 66.7% (the second PCR) in the ADC (P = 0.0693), as given in Tables I and II. By cytological analysis for sputum samples, only 54.8% of the SCC (P = 0.0102) and 33.3% of the ADC (P = 0.0098) had been detected, respectively.
|
|
Sequencing of the semi-nested PCR product from the p16 methylation-positive plasma samples confirmed the presence of 11 methylated CpG dinucleotides in the DNA lying between the sense and anti-sense primers (data not shown).
Methylation of p16 in different specimens of lung cancer patients
In order to examine the methylation status of the p16 promoter region in patient materials, a total of 111, 136 and 95 samples of tumor tissue, plasma and sputum, respectively, from primary lung cancer patients were analyzed. Hypermethylated p16 was detected in 80.2% of the tumor tissues, and in 75.7 and 74.7% in the plasma and sputum specimens, respectively. For each kind of specimen, there was no obvious difference in frequencies among different histological tumor types (P = 0.3857, 0.1244 and 0.3801 for the tumor tissue, plasma and sputum, respectively), as shown in Table III.
|
Methylation of p16 in tumor, plasma and sputum samples from the same patient
We examined p16 methylation in 50 cases where tumor tissue, plasma and sputum samples were all available from the same patient. Among them, the frequencies for hypermethylation of p16 were 84.0% in the tumor tissue, and 72.0 and 76.0% in the corresponding plasma and sputum specimens, respectively. Aberrant methylation of p16 was detected in all of the tumor and plasma samples derived from ASC, LCLC and SCLC patients examined. A lower frequency was observed in specimens from ADC patients. With regard to SCC, one of the major histological types of NSCLC, hypermethylation of p16 was more frequently identified in sputum samples than in the corresponding plasma (81.8 and 65.2%, respectively), but with no statistical significance (P = 0.2963). The data are summarized in Table IV, and representative pictures of agarose gel electrophoresis of the semi-nested MSP products for p16 are shown in Figure 1.
|
|
| Discussion |
|---|
|
|
|---|
As an important tumor suppressor gene, p16 inactivation has been observed in over 50% of primary lung cancers (3436). Homozygous deletion, with a highly variable frequency of 948% (3639), has been reported to be involved in loss of the gene expression in the tumors, while mutations were detected with a relatively low frequency of 06% (4042). Recently, hypermethylation of the p16 promoter, related to loss of the gene expression (43), has been reported to be an early event in lung cancer and a potential biomarker for early detection of this disease (25). Previous studies in our laboratory using tumor tissues derived from Chinese primary lung cancer patients indicated that loss of heterozygosity and aberrant methylation of p16 were the main mechanisms of p16 inactivation, while homozygous deletion accounted for only 7.7% of the cases with negative p16 expression (44). In that investigation, we also used immunohistochemical staining to correlate the MSP results with protein data. We found that most of those tumor tissues expressed no or negligible P16 protein. The data implicated a significant role for hypermethylated p16 in lung carcinogenesis. Further, several studies, including ours, have shown that this epigenetic alteration can be detected in circulating plasma/serum and sputum specimens of lung cancer patients (16,2931). Hypermethylation of p16 in sputum samples may occur before any clinical evidence of tumor, and serve as an indicator of pre-cancerous lesion or of an increased risk of lung cancer developing (29,30).
Here, the modified semi-nested MSP developed was used to identify hypermethylation within the p16 promoter region in a large number and diverse specimens, including samples from tumor tissue, circulating plasma and sputum, collected from primary lung cancer patients. We compared results from a first PCR to those obtained from a second PCR to test the efficiency of this technique. Our data further confirmed that semi-nested MSP is a highly sensitive method for detecting this epigenetic alteration even with nanogram-quantities of DNA. The results from samples of plasma paired with tumor tissue are similar to those obtained in our previous study (31), showing that this approach is not only sensitive, but also reproducible.
Notably, in 42 cases where p16 hypermethylation was observed in tumor tissues and the corresponding sputum and/or plasma samples, only 16 (38.1%, P < 0.0001) cases were identified with cancer cells by conventional cytological examination on sputum samples (data not shown). The results suggest that compared with cytological analysis, detection of p16 hypermethylation in both sputum and plasma could prove a more sensitive and specific method for molecular diagnosis of the disease. It must be noted, however, that in eight cases where no detectable p16 hypermethylation was observed in any sample, four of them were identified as positive by sputum cytological analysis. This implicates a role for a combination of conventional cytological examination and the molecular (MSP) analysis as being a preferred approach for early detection of lung cancer.
In our study, from 50 patients, tumor tissue, plasma and sputum were all available for the investigation. Notably, in all the cases where tumor tissue had hypermethylated p16, aberrant methylation was also observed in their sputum and/or plasma specimens, whereas no hypermethylation of p16 was detected in the sputum and plasma from the patients whose tumor sample lacked this epigenetic alteration (data not shown). The results indicate that the semi-nested MSP is not only a sensitive, but also a specific approach, having a potential predictive role for lung cancer. Taken it as a whole, there was no obvious difference (P = 0.3448) for the frequencies of hypermethylated p16 gene, among those three kinds of samples from the 50 cases investigated.
SCC and ADC, which are the major histological types of NSCLC, accounted for 78.0% (39/50) of the 50 cases where all three kinds of specimen were analyzed in this work (see Table IV). In the SCC cases, hypermethylation was more frequently detected in the sputum than in the plasma (81.8 and 68.2%, respectively), whereas with ADC, the frequencies were both 58.8% in sputum and plasma samples, but the correlation between the results was not perfect, implying that detection of hypermethylated p16 in combined clinical specimens may be needed to increase the efficiency of this molecular approach, particularly in cases where the levels of DNA are low. Aberrant methylation of p16 was detected in all of the tumor and plasma samples from the 11 patients with other histological types (including four ASC, one LCLC and six SCLC). However, with such limited case numbers, we cannot state with confidence that detecting this marker in plasma and sputum is diagnostic for these histological types.
Our data from both the present study (see Table III) and previous investigation (31) demonstrated that in the tumor tissues, no statistically significant differences are observed among histological types or clinical stages, indicating that p16 hypermethylation is a common and early event during lung carcinogenesis in general. The frequency of p16 hypermethylation, in this study, was high as compared with reports involving Western cases (9,16,29,30). In addition to etiological factors, racial differences might play a factor in the high rate of p16 hypermethylation observed in the Chinese lung cancers.
As a control for our work, we also analyzed 25 plasma samples from healthy individuals using the same semi-nested MSP protocol. There was no PCR product obtained in any case. When wild-type p16 primers were used, PCR products still were not observed (data not shown). The results suggest that the quantity of DNA in circulating plasma from healthy individuals is below the level detectable by the semi-nested MSP protocol we used.
The work reported in this paper is the first part of a series of studies we hope to perform. We propose in future to analyze plasma and sputum samples derived from age/sex matched, smoking/non-smoking non-cancer individuals and non- lung-cancer patients, to evaluate the utility of the methods now developed for screening lung cancers. Subject to the validation, p16 hypermethylation may prove an effective biomarker for early detection of lung cancers. Molecular analysis of sputum and circulating plasma for this marker, assuming the next stage studies support this hypothesis, would provide a useful approach for screening high-risk populations for earlier diagnosis and therapeutic intervention of this important malignant disease.
| Notes |
|---|
1 Present address: Department of Hygiene Toxicology, Preventive Medicine College, Third Military Medical University, Chongqing 400038, P.R.China
2 To whom correspondence should be addressed Email: yngao{at}pubem.cicams.ac.cn ![]()
* These authors contributed equally to the work. ![]()
| Acknowledgments |
|---|
We are grateful to Dr Jin Jen (NIH, USA) for kindly providing the PCR primers used for MSP, and to Professor Beverly Griffin (Imperial College, London, UK) for continued support. This work was supported by the State Key Programme of Basic Research (Project No. G1998051207) and the National Key Technologies R & D Programme (Project No. 2002BA711A06), Ministry of Science and Technology, P.R.China.
| References |
|---|
|
|
|---|
- Somers,V.A., Pietersen,A.M., Theunissen,P.H. and Thunnissen,F.B. (1998) Detection of K-ras point mutations in sputum from patients with adenocarcinoma of the lung by point-EXACCT. J. Clin. Oncol., 16, 30613068.
[Abstract/Free Full Text] - Chen,J.T., Ho,W.L., Cheng,Y.W. and Lee,H. (2000) Detection of p53 mutations in sputum smears precedes diagnosis of non-small cell lung carcinoma. Anticancer Res., 20, 26872690.[ISI][Medline]
- Behn,M., Thiede,C., Neubauer,A., Pankow,W. and Schuermann,M. (2000) Facilitated detection of oncogene mutations from exfoliated tissue material by a PNA-mediated enriched PCR protocol. J. Pathol., 190, 6975.[CrossRef][ISI][Medline]
- Miozzo,M., Sozzi,G., Musso,K., Pilotti,S., Incarbone,M., Pastorino,U. and Pierotti,M.A. (1996) Microsatellite alterations in bronchial and sputum specimens of lung cancer patients. Cancer Res., 56, 22852288.
[Abstract/Free Full Text] - Silva,J.M., Gonzalez,R., Dominguez,G., Garcia,J.M., Espana,P. and Bonilla,F. (1999) TP53 gene mutations in plasma DNA of cancer patients. Genes Chromosomes Cancer, 24, 160161.[CrossRef][ISI][Medline]
- Gonzalez,R., Silva,J.M., Sanchez,A. et al. (2000) Microsatellite alterations and TP53 mutations in plasma DNA of small-cell lung cancer patients: follow-up study and prognostic significance. Ann. Oncol., 11, 10971104.
[Abstract/Free Full Text] - Cuda,G., Gallelli,A., Nistico,A., Tassone,P., Barbieri,V., Tagliaferri,P.S., Costanzo,F.S., Tranfa,C.M. and Venuta,S. (2000) Detection of microsatellite instability and loss of heterozygosity in serum DNA of small and non-small cell lung cancer patients: a tool for early diagnosis? Lung Cancer, 30, 211214.[CrossRef][ISI][Medline]
- Sozzi,G., Musso,K., Ratcliffe,C., Goldstraw,P., Pierotti,M.A. and Pastorino,U. (1999) Detection of microsatellite alterations in plasma DNA of non-small cell lung cancer patients: a prospect for early diagnosis. Clin. Cancer Res., 5, 26892692.
[Abstract/Free Full Text] - Merlo,A., Herman,J.G., Mao,L., Lee,D.J., Gabrielson,E., Burge,P.C., Baylin,S.B. and Sidransky,D. (1995) 5' CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nature Med., 1, 686692.[CrossRef][ISI][Medline]
- Virmani,A.K., Rathi,A., Sathyanarayana,U.G. et al. (2001) Aberrant methylation of the adenomatous polyposis coli (APC) gene promoter 1A in breast and lung carcinomas. Clin. Cancer Res., 7, 19982004.
[Abstract/Free Full Text] - Brabender,J., Usadel,H., Danenberg,K.D. et al. (2001) Adenomatous polyposis coli gene promoter hypermethylation in non-small cell lung cancer is associated with survival. Oncogene, 20, 35283532.[CrossRef][ISI][Medline]
- Zochbauer-Muller,S., Fong,K.M., Maitra,A., Lam,S., Geradts,J., Ashfaq,R., Virmani,A.K., Milchgrub,S., Gazdar,A.F. and Minna,J.D. (2001) 5' CpG island methylation of the FHIT gene is correlated with loss of gene expression in lung and breast cancer. Cancer Res., 61, 35813585.
[Abstract/Free Full Text] - Virmani,A.K., Rathi,A., Zochbauer-Muller,S. et al. (2000) Promoter methylation and silencing of the retinoic acid receptor-beta gene in lung carcinomas. J. Natl Cancer Inst., 92, 13031307.
[Abstract/Free Full Text] - Esteller,M., Hamilton,S.R., Burger,P.C., Baylin,S.B. and Herman,J.G. (1999) Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res., 59, 793797.
[Abstract/Free Full Text] - Tang,X., Khuri,F.R., Lee,J.J., Kemp,B.L., Liu,D., Hong,W.K. and Mao,L. (2000) Hypermethylation of the death-associated protein (DAP) kinase promoter and aggressiveness in stage I non-small-cell lung cancer. J. Natl Cancer Inst., 92, 15111516.
[Abstract/Free Full Text] - Esteller,M., Sanchez-Cespedes,M., Rosell,R., Sidransky,D., Baylin,S.B. and Herman,J.G. (1999) Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients. Cancer Res., 59, 6770.
[Abstract/Free Full Text] - Sato,M., Mori,Y., Sakurada,A., Fujimura,S. and Horii,A. (1998) The H-cadherin (CDH13) gene is inactivated in human lung cancer. Hum. Genet., 103, 96101.[CrossRef][ISI][Medline]
- Burbee,D.G., Forgacs,E., Zochbauer-Muller,S. et al. (2001) Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J. Natl Cancer Inst., 93, 691699.
[Abstract/Free Full Text] - Bachman,K.E., Herman,J.G., Corn,P.G., Merlo,A., Costello,J.F., Cavenee,W.K., Baylin,S.B. and Graff,J.R. (1999) Methylation-associated silencing of the tissue inhibitor of metalloproteinase-3 gene suggest a suppressor role in kidney, brain and other human cancers. Cancer Res., 59, 798802.
[Abstract/Free Full Text] - Monk,M. (1995) Epigenetic programming of differential gene expression in development and evolution. Dev. Genet., 17, 188197.[CrossRef][ISI][Medline]
- Turker,M.S. and Bestor,T.H. (1997) Formation of methylation patterns in the mammalian genome. Mutat. Res., 386, 119130.[CrossRef][ISI][Medline]
- Paulsen,M. and Ferguson-Smith,A.C. (2001) DNA methylation in genomic imprinting, development and disease. J. Pathol., 195, 97110.[CrossRef][ISI][Medline]
- Baylin,S.B., Herman,J.G., Graff,J.R., Vertino,P.M. and Issa,J.P. (1998) Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72, 141196.[ISI][Medline]
- Gray,S.G., Eriksson,T. and Ekstrom,T.J. (1999) Methylation, gene expression and the chromatin connection in cancer. Int. J. Mol. Med., 4, 333350.[ISI][Medline]
- Belinsky,S.A., Nikula,K.J., Palmisano,W.A., Michels,R., Saccomanno,G., Gabrielson,E., Baylin,S.B. and Herman,J.G. (1998) Aberrant methylation of p16INK4a is an early event in lung cancer and a potential biomarker for early diagnosis. Proc. Natl Acad. Sci. USA, 95, 1189111896.
[Abstract/Free Full Text] - Hibi,K., Taguchi,M., Nakayama,H., Takase,T., Kasai,Y., Ito,K., Akiyama,S. and Nakao,A. (2001) Molecular detection of p16 promoter methylation in the serum of patients with esophageal squamous cell carcinoma. Clin. Cancer Res., 7, 31353138.
[Abstract/Free Full Text] - Sanchez-Cespedes,M., Esteller,M., Wu,L., Nawroz-Danish,H., Yoo,G.H., Koch,W.M., Jen,J., Herman,J.G. and Sidransky,D. (2000) Gene promoter hypermethylation in tumors and serum of head and neck cancer patients. Cancer Res., 60, 892895.
[Abstract/Free Full Text] - Wong,I.H., Lo,Y.M., Zhang,J., Liew,C.T., Ng,M.H., Wong,N., Lai,P.B., Lau,W.Y., Hjelm,N.M. and Johnson,P.J. (1999) Detection of aberrant p16 methylation in the plasma and serum of liver cancer patients. Cancer Res., 59, 7173.
[Abstract/Free Full Text] - Palmisano,W.A., Divine,K.K., Saccomanno,G., Gilliland,F.D., Baylin,S.B., Herman,J.G. and Belinsky,S.A. (2000) Predicting lung cancer by detecting aberrant promoter methylation in sputum. Cancer Res., 60, 59545958.
[Abstract/Free Full Text] - Kersting,M., Friedl,C., Kraus,A., Behn,M., Pankow,W. and Schuermann,M. (2000) Differential frequencies of p16INK4a promoter hypermethylation, p53 mutation and K-ras mutation in exfoliative material mark the development of lung cancer in symptomatic chronic smokers. J. Clin. Oncol., 18, 32213229.
[Abstract/Free Full Text] - An,Q., Liu Y., Gao,Y.N., Huang,J.F., Fong,X.L., Li,L., Zhang,D.C. and Cheng,S.J. (2003) Detection of p16 hypermethylation in circulating plasma DNA of non-small cell lung cancer patients. Cancer Lett., 188(12), 109114.
- Herman,J.G., Graff,J.T., Myohanen,S., Nelkin,B.D. and Baylin,S.B. (1996) Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl Acad. Sci. USA, 93, 98219826.
[Abstract/Free Full Text] - Jarrard,D.F., Bova,G.S., Ewing,C.M., Pin,S.S., Nguyen,S.H., Baylin,S.B., Cairns,P., Sidransky,D., Herman,J.G. and Isaacs,W.B. (1997) Deletional, mutational and methylation analyses of CDKN2 (p16/MTS1) in primary and metastastic prostate cancer. Genes Chromosomes Cancer, 19, 9096.[CrossRef][ISI][Medline]
- Kratzke,R.A., Greatens,T.M., Rubins,J.B., Maddaus,M.A., Niewoehner,D.E., Niehans,G.A. and Geradts,J. (1996) Rb and p16INK4a expression in resected non-small cell lung tumors. Cancer Res., 56, 34153420.
[Abstract/Free Full Text] - Brambilla,E., Moro,D., Gazzeri,S. and Brambilla,C. (1999) Alterations of expression of Rb, p16 (INK4A) and cyclin D1 in non-small cell lung carcinoma and their clinical significance. J. Pathol., 188, 351360.[CrossRef][ISI][Medline]
- Sanchez-Cespedes,M., Reed,A.L., Buta,M., Wu,L., Westra,W.H., Herman,J.G., Yang,S.C., Jen,J. and Sidransky,D. (1999) Inactivation of the INK4A/ARF locus frequently coexists with TP53 mutations in non-small cell lung cancer. Oncogene, 18, 58435849.[CrossRef][ISI][Medline]
- De Vos,S., Miller,C.W., Takeuchi,S., Gombart,A.F., Cho,S.K. and Koeffler,H.P. (1995) Alterations of CDKN2 (p16) in non-small cell lung cancer. Genes Chromosomes Cancer, 14, 164170.[ISI][Medline]
- Schmid,M., Malicki,D., Nobori,T., Rosenbach,M.D., Campbell,K., Carson,D.A. and Carrera,C.J. (1998) Homozygous deletions of methylthioadenosine phosphorylase (MTAP) are more frequent than p16INK4A (CDKN2) homozygous deletions in primary non-small cell lung cancers (NSCLC). Oncogene, 17, 26692675.[CrossRef][ISI][Medline]
- Gazzeri,S., Gouyer,V., Vour'ch,C., Brambilla,C. and Brambilla,E. (1998) Mechanisms of p16INK4a inactivation in non small-cell lung cancers. Oncogene, 16, 497504.[CrossRef][ISI][Medline]
- Marchetti,A., Buttitta,F., Pellegrini,S., Bertacca,G., Chella,A., Carnicelli,V., Tognoni,V., Filardo,A., Angeletti,C.A. and Bevilacqua,G. (1997) Alterations of P16 (MTS1) in node-positive non-small cell lung carcinomas. J. Pathol., 181, 178182.[CrossRef][ISI][Medline]
- Rusin,M.R., Okamoto,A., Chorazy,M. et al. (1996) Intragenic mutations of the p16 (INK4), p15 (INK4B) and p18 genes in primary non-small-cell lung cancers. Int. J. Cancer, 65, 734739.[CrossRef][ISI][Medline]
- Betticher,D.C., White,G.R., Vonlanthen,S., Liu,X., Kappeler,A., Altermatt,H.J., Thatcher,N. and Heighway,J. (1997) G1 control gene status is frequently altered in resectable non-small cell lung cancer. Int. J. Cancer, 74, 556562.[CrossRef][ISI][Medline]
- Myohanen,S.K., Baylin,S.B. and Herman,J.G. (1998) Hypermethylation can selectively silence individual p16ink4A alleles in neoplasia. Cancer Res., 58, 591593.
[Abstract/Free Full Text] - An,Q., Dong,X.Y., Zhang,J.J., Li,L., Liu,L.Y., Zhang,D.C., Li,L., Cheng,S.J. and Gao,Y.N. (2001) Studies on inactivation of p16/CDKN2 gene in non-small-cell lung cancer. Chin. J. Cancer, 20, 591594.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K. Miyamoto and T. Ushijima Diagnostic and Therapeutic Applications of Epigenetics Jpn. J. Clin. Oncol., June 1, 2005; 35(6): 293 - 301. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

