Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wolter, F.
Right arrow Articles by Stein, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolter, F.
Right arrow Articles by Stein, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 24, No. 3, 469-474, March 2003
© 2003 Oxford University Press


MOLECULAR EPIDEMIOLOGY AND CANCER PREVENTION

Resveratrol-induced modification of polyamine metabolism is accompanied by induction of c-Fos

Freya Wolter, Lyudmila Turchanowa and Jürgen Stein1

Second Department of Medicine, J. W. Goethe University, 60590 Frankfurt/Main, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The objective of the current study was to investigate the effect of resveratrol, a naturally occurring polyphenol with cancer chemopreventive properties, on polyamine metabolism in the human colonic adenocarcinoma cell line Caco-2. We demonstrated that inhibition of ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis, was due to attenuated ODC protein and mRNA levels (50–200 µM). The naturally occurring resveratrol analog piceatannol (100 µM) also diminished ODC activity, protein and mRNA levels, whereas the green tea polyphenol ()-epigallocatechin gallate (EGCG; 100 µM) exerted only weak effects on ODC. The transcription factor c-Myc, a positive regulator of the odc gene was attenuated by resveratrol treatment and to a lesser extent by piceatannol and EGCG. S-Adenosylmethionine decarboxylase, an enzyme that synthesizes higher polyamines, was concomitantly inhibited by resveratrol and piceatannol treatment, whereas EGCG did not affect its activity. In addition resveratrol, piceatannol and EGCG enhanced spermidine/spermine N1-acetyltransferase activity, an enzyme that degrades polyamines in cooperation with polyamine oxidase. Intracellular levels of spermine and spermidine were not affected, whereas putrescine and N8-acetylspermidine concentrations increased after incubation with resveratrol. These events were paralleled by an increase of the activator protein-1 constituents c-Fos and c-Jun. Whereas DNA-binding activity of c-Jun remained unchanged, DNA-binding activity of c-Fos was significantly enhanced by resveratrol and piceatannol, but inhibited by EGCG. The data suggest that growth arrest by resveratrol is accompanied by inhibition of polyamine synthesis and increased polyamine catabolism. C-Fos seems to play a role in this context. Effects of piceatannol on polyamine synthesis were similar, but not as potent as those exerted by resveratrol.

Abbreviations: AP-1, activator protein-1; EGCG, ()-epigallocatechin gallate; ODC, ornithine decarboxylase; SAMDC, S-adenosylmethionine decarboxylase; SSAT, spermidine/spermine N1-acetyltransferase.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The cellular polyamines spermidine and spermine, as well as their precursor putrescine are essential for growth and DNA synthesis (1–3). Increases in the levels of these polycations are generally associated with cell proliferation and cell transformation induced by growth factors (4), carcinogens (5) or oncogenes (6). Therefore, polyamine metabolism is considered to represent an attractive target for both cancer chemotherapy and chemoprevention. Ornithine decarboxylase (ODC) and S-adenosylmethionine decarboxylase (SAMDC) are the key enzymes in polyamine biosynthesis. Inhibition of ODC by DL-{alpha}-difluoromethylornithine has been shown to decrease mucosal growth in vivo and in vitro (7,8). Catabolism, excretion or reconversion of higher polyamines is preceded by acetylation through spermidine/spermine N1-acetyltransferase (SSAT), the rate-limiting enzyme in polyamine catabolism, which can be induced by reactive oxygen species (9–11). In combined action with polyamine oxidase (PAO) it converts spermine to spermidine and the latter to putrescine.

Resveratrol (trans-3,4',5-trihydroxystilbene) is a plant polyphenol naturally occurring in grapes, red wine and peanuts (12,13) with chemopreventive properties (14). The red wine polyphenol has been demonstrated to inhibit ODC activity and progression of the cell cycle in Caco-2 colorectal cancer cells (15). In previous studies we have shown that this cell-cycle arrest is accompanied by reduced cyclin D1 and cyclin-dependent kinase (cdk)4 levels (16). The number of aberrant crypt foci in azoxymethane-induced carcinogenesis of the rat colon is significantly reduced by treatment with resveratrol (17). In the ApcMin-mouse model for familiar adenomatous polyposis oral application of resveratrol reduced adenomas by 70% (18). The natural resveratrol analog piceatannol (trans-3,4,3',5'-tetrahydroxystilbene) also inhibits cell-cycle progression with decreased cyclin D1 and cdk4 levels of colorectal carcinoma cell lines (19). It has been demonstrated to inhibit formation of 7,12-dimethylbenz[a]anthracene-induced pre-neoplastic lesions in a mouse mammary gland model. In contrast to resveratrol it does not significantly inhibit cyclooxygenase activities (20). The underlying molecular mechanisms for the antineoplastic effects of resveratrol and piceatannol have not been fully clarified.

The objective of the present study was to further elucidate the effect of resveratrol on polyamine metabolism and to test whether the analog piceatannol exerts the same effects as resveratrol. These results were compared with the effects of (–)-epigallocatechin gallate (EGCG), a green tea polyphenol implied in chemoprevention (21), to evaluate the specificity of the data obtained with the stilbenes.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell culture
The human colon cancer cell line Caco-2 was obtained from the American Type Culture Collection (ATCC, Rockville, MD). Caco-2 cells of passages 45–55 were cultured in Dulbecco’s modified Eagle medium, supplemented with 10% fetal calf serum, penicillin (1000 U/l) and streptomycin (1 mg/l) and incubated at 37°C under an atmosphere of 5% CO2 in air. All cell culture reagents were obtained from Life Technologies (Eggenstein, Germany). Stock solutions of resveratrol (Sigma, Deisenhofen, Germany) and piceatannol (Alexis Biochemicals, Grünberg, Germany) were prepared in dimethyl sulfoxide (DMSO). EGCG (Sigma) was diluted in phosphate-buffered saline (PBS). The compounds were directly added to cell cultures at a concentration of 100 µM for piceatannol and EGCG and at concentrations ranging from 50 to 200 µM for resveratrol, whereas untreated cells received the solvent alone (<=0.1% DMSO). Cytotoxicity was excluded by lactate dehydrogenase release assay (Roche Molecular Biochemicals, Mannheim, Germany).

Western blot analysis
Cells were plated in 80 cm2 flasks and incubated with plant polyphenols for 24 h. Western blot analysis using total protein extracts from cultured cells was performed as described previously (16). Protein content was quantified with the Bio-Rad (Bio-Rad Laboratories, München, Germany) colorimetric assay. Reprobing of blots for expression of actin was done routinely. Antibodies against c-Myc and c-Fos were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), anti-ODC was purchased from Sigma and anti-c-Jun from BD Transduction Laboratories (Heidelberg, Germany).

Reverse transcriptase–PCR
Cells were seeded in 6-well plates, allowed to attach overnight and treated with polyphenols for 24 h. RNA was isolated from cells by lysis in RNAzol B (Tel-Test, Friendswood, TX) followed by phenol extraction and ethanol precipitation. Reverse transcription of total cellular RNA was carried out using Superscript II RNase H reverse transcriptase (Life Technologies, Karlsruhe, Germany) and random hexanucleotide primers (Promega, Madison, WI). PCR was performed on the cDNA using the following sense and antisense primers, respectively (primers were custom-synthesized by Biospring, Frankfurt, Germany): ODC: AATCAACCCAGCGTTGGACAA and ACATCACATAGTAGATCGTCG; GAPDH: ATCTTCCAGGAGCGAGATCC and ACCACTGACACGTTGGCAGT. Thermal cycling was performed as follows: denaturation at 95°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 90 s. Thirty-five cycles were performed. Primers were used at a final concentration of 10 µM each, dNTPs at 500 µM (Eurogentec, Seraing, Belgium), and MgCl2 at 3 mM. Five units of Taq DNA Polymerase were used per 50 µl reaction. Ten microlitres of PCR product were electrophoresed on a 2% agarose gel containing ethidium bromide and visualized by UV illumination.

ODC and SAMDC activity
The activities of the enzymes ODC and SAMDC were assayed with a radiometric technique in which the amount of 14CO2 liberated from DL-[1-14C]ornithine (207.2x104 MBq/mol, Amersham Pharmacia Biotech, Freiburg, Germany) or S-adenosyl[carboxyl-14C]-L-methionine (222x104 MBq/mol, Amersham Pharmacia Biotech) was estimated, as described previously (22). Briefly, after treatment was carried out as described above, the cell culture dishes were placed on ice; the monolayers were washed three times with cold PBS, and the cells were harvested by scraping in homogenizing buffer (50 mM Tris buffer, pH 7.2, 5 mM DTT, 100 µM EGTA), sonicated and centrifuged at 15 000 g at 4°C for 10 min. 100 µl of the supernatant were incubated in a stoppered tube with 74 µM DL-[1-14C]ornithine in the presence of pyridoxal-5-phosphate for 60 min at 37°C. For the SAMDC assay, instead of DL-[1-14C]ornithine, S-adenosyl[carboxyl-14C]-L-methionine was used and putrescine instead of pyridoxal-5-phosphate. 14CO2 liberated by the decarboxylation of ornithine or S-adenosylmethionine and trapped on filters impregnated with benzethonium hydroxide was measured by liquid scintillation spectroscopy. The supernatant was assayed for protein as described in the western blot analysis section. ODC and SAMDC activity are expressed in picomole of released CO2 per hour per milligram of protein. Controls always included samples for measurement of non-enzymatic release of 14CO2.

SSAT activity
Cells were washed twice with cold homogenizing buffer (10 mM Tris–HCl, pH 7.5, 2.5 mM DTT, 1 mM EDTA), harvested by scraping, disrupted by sonification and centrifuged at 15 000 g at 4°C for 15 min. Sixty microlitre aliquots of the supernatant were incubated with 0.3 µM spermidine, 10 µM Tris–HCl (pH 7.8), and 3,7 kBq [acetyl-3H]CoA (495.8x106 MBq/mol, Moravek, Brea, CA) at 37°C for 10 min. The reaction was terminated by chilling and the addition of 20 µl of 1 M NH2OH. Subsequently, samples were centrifuged at 15 000 g for 5 min. Thirty microlitres of the supernatant were spotted onto a Whatman P81 paper disc (2.4 cm in diameter). The paper disc was washed with aqua dest. and ethanol on a filter, dried and transferred to a vial containing 3 ml of scintillation cocktail (Packard Biosciences, Groningen, The Netherlands). Radioactivity was measured in a liquid scintillation counter (Packard Instruments, Meridien, CT). Controls included samples for measurements of non-enzymatic incorporation of [acetyl-3H]CoA into monoacetylspermidine. For all treatments tested the assay was repeated without addition of spermidine, to estimate unspecific acetylation by other enzymes than SSAT. These values were subtracted from the results obtained from the SSAT-activity measurements. SSAT activity is expressed in fmol of synthesized [acetyl-3H]spermidine per minute per milligram protein.

Determination of polyamines with HPLC
Twenty-four hours after plating in 6-well plates, resveratrol was added in FCS-free medium. After an incubation period of 24 h, cells were washed with cold PBS and harvested by scraping. Cells were sonicated and centrifuged at 10 000 g for 10 min. Aliquots of the supernatant were used for protein determination. 0.2 M perchloric acid was added to the remaining supernatant. Polyamines were analyzed by the HPLC method according to Hyvonen et al. (23). Separation was carried out on a Hypersil (ODS 3 µm) 150x3 mm column (MZ analytical, Mainz, Germany) by isocratic elution with 0.1% potassium phosphate plus 0.01 M sodium octane sulfonate with acetonitrile (10:3, v/v) and a flow rate of 0.8 ml/min.

Activator protein-1 (AP-1) activation assay
Cells were plated in 80 cm2 flasks and incubated with substances for 24 h. Nuclear extracts from total protein were prepared with a nuclear extract kit (Active Motif, Rixensart, Belgium). Twenty micrograms of nuclear protein were either used for TransAM c-Fos or TransAM c-Jun transcription factor assay kit (Active Motif). Activity of the transcription factors was determined according to the manufacturers instructions. AP-1 from nuclear cell extracts specifically binds to an oligonucleotide containing a 12-O-tetradecanoylphorbol-13-acetate-responsive element that is attached to a 96-well plate. By using an antibody directed against either c-Fos or phosphorylated c-Jun, the AP-1 dimer bound to the oligonucleotide is detected. A secondary antibody conjugated to horseradish peroxidase provides colorimetric visualisation. Absorbance was determined with a microplate reader (Tecan, Crailshaim, Germany).

Statistical analysis
Data were expressed as means ± SD. Differences between two values were tested for statistical significance using the Student’s unpaired t-test (SigmaStat, SPSS, Chicago, IL). A P value <0.05 was considered to indicate a significant difference.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
As demonstrated earlier (15), resveratrol inhibits ODC, the key enzyme in polyamine synthesis. At a concentration of 100 µM resveratrol reduced ODC activity to 40% of control values (Figure 1AGo). Compared with the effects of resveratrol, inhibition of ODC by EGCG was moderate with a reduction to 69% versus control, whereas piceatannol (200 µM) reduced ODC activity to 47% of the control. Diminished ODC activity after treatment with resveratrol or piceatannol was accompanied by reduced ODC protein levels, as monitored by western blotting (Figure 1BGo). EGCG treatment did not affect ODC expression. To evaluate whether attenuation of ODC was caused on the level of transcription, odc mRNA was determined with PCR (Figure 1CGo). Treatment with resveratrol attenuated odc mRNA in a concentration-dependent manner. Piceatannol and EGCG exerted only weak effects on odc mRNA. As shown in Figure 2Go the polyamine-synthesizing enzyme SAMDC was also inhibited in a dose-dependent manner by treatment with resveratrol (54% of control with 100 µM). 200 µM piceatannol diminished SAMDC activity to 74% of control, whereas EGCG had no impact on SAMDC.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1. Influence of resveratrol on ODC in Caco-2 cells. Cells were treated for 24 h with resveratrol, piceatannol (pic) or EGCG. ODC activity (A) of Caco-2 cells was determined by 14CO2-release from labelled ornithine. Results (means ± SD, n = 4) are expressed in enzyme units (picomole of released CO2) per milligram cellular protein per hour. **P < 0.001 versus control (con). To determine ODC protein expression in Caco-2 cells volumes of whole cell extracts containing 20 µg of protein were separated and electrophoretically blotted (B). Total RNA from Caco-2 cells was analyzed by reverse transcriptase–polymerase chain reaction for odc-mRNA content and gapdh was used as a control for initial RNA loading (C).

 


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. Influence of resveratrol on SAMDC activity in Caco-2 cells. Cells were treated for 24 h with resveratrol, piceatannol or EGCG. SAMDC activitiy of Caco-2 cells was determined by 14CO2-release from labelled S-adenosylmethionine. Results (means ± SD, n = 4) are expressed in enzyme units (picomole of released CO2) per milligram cellular protein per hour. #P < 0.05, **P < 0.001 versus control (con).

 
The transcription factor c-Myc is known to be an activator of the odc promoter. Therefore we determined whether the oncoprotein is influenced by treatment with resveratrol. As shown in Figure 3Go performance of western blot revealed diminished intracellular levels of the oncoprotein in a dose-dependent manner. Piceatannol was almost as effective as resveratrol in attenuating c-Myc expression, whereas the effect of EGCG was less pronounced.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Western blot of c-Myc in Caco-2 cells. Caco-2 cells treated with resveratrol, EGCG or piceatannol (pic) for 24 h were harvested, subjected to western blotting and compared with controls (con).

 
SSAT activity was measured to evaluate whether polyamine degradation is also modulated by resveratrol (Figure 4AGo). Addition of resveratrol (100 µM) increased SSAT activity to 217% of control value. Piceatannol (200 µM) and EGCG (100 µM) augmented SSAT activity to 211 and 181% of control, respectively. In accordance with these results we could show that the intracellular polyamine concentrations changed after incubation with resveratrol (Figure 4BGo). There was an increase in putrescine (651% of control with 200 µM resveratrol) and N8-acetylspermidine (242% of control with 200 µM resveratrol), which are markers for enhanced SSAT activity.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. SSAT activity of Caco-2 cells was determined to monitor polyamine catabolism (A). Cells were incubated in the absence or presence of resveratrol, piceatannol or EGCG for 24 h, and SSAT activity was determined by formation of [acetyl-3H]spermidine after the addition of labelled acetyl-CoA. Values are means ± SD, n = 4, #P < 0.05, *P < 0.01, **P < 0.001 versus control (con). (B) shows intracellular polyamine concentrations of Caco-2 cells treated with increasing concentrations of resveratrol for 24 h. Measurements were performed with HPLC and values were related to protein content of the cells. Values are means ± SD, n = 3, *P < 0.01 versus control (con).

 
As shown in Figure 5Go, resveratrol and piceatannol, but not EGCG were found to augment the abundance of c-Fos protein in Caco-2 cells. To determine whether this upregulation was accompanied by enhanced AP-1 activity, an AP-1 DNA-binding activity assay was performed. Both stilbenes, resveratrol as well as piceatannol, markedly increased DNA binding of c-Fos. The effect of resveratrol was most prominent with a concentration of 100 µM (362% of control values). Piceatannol induced c-Fos binding to 216% of control values. Moreover, this binding was specific, because addition of wild-type oligonucleotides containing the AP-1-binding motif, but not of a mutated oligonucleotide prevented DNA binding of AP-1 from nuclear cell extracts. EGCG significantly inhibited c-Fos DNA binding (80% compared with controls). Figure 6Go reveals that protein levels of c-Jun decreased after treatment with 50 µM resveratrol, but increased with higher concentrations of resveratrol, after addition of piceatannol and EGCG. The DNA-binding activity of c-Jun was not influenced by incubation with resveratrol, piceatannol or EGCG.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5. Protein expression and DNA-binding activity of AP-1 constituent c-Fos after treatment of Caco-2 cells with resveratrol, piceatannol or EGCG. Treated Caco-2 cells were harvested after 24 h. Equal volumes of whole cell extracts containing 20 µg of protein were separated and electrophoretically blotted to detect c-Fos protein expression, a representative blot is shown. The arrow points to the 60 kDa band of c-Fos, bands at 57 and 62 kDa can also be seen and are due to posttranslational modifications (A). The blots were evaluated densitometrically and results are expressed as per cent of controls. Values are means ± SD, n = 3, #P < 0.05 versus control (con). Treated cells were subjected to an AP-1 DNA-binding assay (C). Equal volumes of nuclear extracts from Caco-2 cells containing 20 µg of protein were used and binding activity was determined according to the kit protocol. Values are means ± SD, n = 3, **P < 0.001 versus control (con).

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6. Protein expression and DNA-binding activity of AP-1 constituent c-Jun after treatment of Caco-2 cells with resveratrol, piceatannol (pic) or EGCG. Treated Caco-2 cells were harvested after 24 h. Equal volumes of whole cell extracts containing 20 µg of protein were separated and electrophoretically blotted to detect c-Jun protein expression, a representative blot is shown (A). The blots were evaluated densitometrically and results are expressed as per cent of controls. Values are means ± SD, n = 3, *P < 0.01, **P < 0.001 versus control (con). Treated cells were subjected to an AP-1 DNA-binding assay (C). Equal volumes of nuclear extracts from Caco-2 cells containing 20 µg of protein were used and binding activity was determined according to the kit protocol. Values are means±SD, n = 3, compared to control (con), no significant changes in c-Jun DNA binding could be detected.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The present study demonstrates that resveratrol modifies polyamine homeostasis on the level of synthesis as well as on the level of degradation of polyamines. As already shown by others (15), resveratrol significantly inhibited ODC activity. In addition, we could demonstrate that this effect was accompanied by reduced protein and mRNA expression of odc. Transcription of the human odc gene is directly mediated by the Myc/Max transcriptional complex (24). In order to evaluate whether c-Myc is involved in resveratrol-induced growth inhibition, c-Myc protein content was determined. Resveratrol attenuated levels of the transcription factor, implying that downregulation of ODC might be mediated by reduction of c-Myc levels. Deregulation of c-myc with prolonged half-life has been implicated in a number of malignancies including tumors of the colon (25), classifying it as an oncogene. Constitutive expression of c-Myc has a profound effect on the cell cycle. C-Myc represents a therapeutic target of chemoprevention and its down-regulation might contribute to the cell-cycle inhibitory effect exerted by resveratrol.

In contrast to an earlier published study, which investigated the effects of resveratrol on polyamine metabolism (15), a concomitant and dose-dependent (50–200 µM) inhibition of SAMDC activity, an enzyme involved in spermidine and spermine synthesis was observed. Whereas we observed an increase in putrescine and N8-acetylspermidine concentrations, no significant changes in polyamine content of Caco-2 cells after treatment of cells with 25 µM resveratrol for 24 h was detected by Schneider et al. An explanation for these conflicting results could be the difference of concentrations used (15).

Furthermore, resveratrol potently upregulated SSAT activity in Caco-2 colon cancer cells. SSAT acetylates spermidine and spermine, which can either be secreted from the cell or are degraded by PAO forming putrescine or spermidine. Vujcic et al. postulated, that induction of SSAT can negatively affect cell growth (26). Accumulation of SSAT mRNA is accompanied by augmented intracellular putrescine levels (27). After treatment of Caco-2 cells with resveratrol an increased intracellular concentration of putrescine, the result of enhanced SSAT activity, was confirmed. Accumulation of N8-acetylspermidine, a sign for active polyamine catabolism could also be monitored, whereas the concentration of spermidine and spermine were not influenced significantly, which might be due to an increased uptake of polyamines. Putrescine is also a product of polyamine catabolism, mediated by SSAT and PAO and is an effective inhibitor of ODC activity in IEC-6 intestinal crypt cells (28,29). It has been stated previously that whereas spermidine induces c-Myc, c-Fos is preferentially induced by putrescine (30). Elevated protein levels of c-Fos were observed together with an increased DNA-binding activity of c-Fos after treatment with resveratrol. This leads us to hypothesize, that the increase in c-Fos might be due to enhanced putrescine levels. C-Fos is part of the dimeric transcription factor AP-1, which is composed of members of c-Jun and c-Fos families that bind the AP-1 site as either homo- or heterodimers. There is increasing evidence that the AP-1 complex plays an important role not only in proliferation but also in differentiation of several cell types. In Caco-2 cells the chemopreventive agent 1,25-dihydroxyvitamin D3 stimulates cell differentiation, which is dependent on AP-1 (31). Butyrate is also considered to represent a chemopreventive substance and triggers differentiation. Concomitantly the short chain fatty acid (SCFA) butyrate rapidly induces c-Fos at a post-translational level (32). EGCG inhibits AP-1 activity of transformed keratinocytes induced by UV irradiation (33,34), whereas it increases AP-1-dependent gene expression in normal keratinocytes (35) and augments protein levels of AP-1 constituents in HepG2 cells (36). It has also been shown, that AP-1 activation occurs during differentiation of Caco-2 cells, before alkaline phosphatase and disaccharidase activities increase (37). The data imply that AP-1 is not only associated with tumorigenesis, but also with differentiation and/or growth inhibition. Resveratrol alone does not induce differentiation of Caco-2 cells (15), whereas, when applied in combination with butyrate, significantly enhances the differentiation induced by the SCFA (38). Resveratrol has been demonstrated to inhibit AP-1 activation by tumor necrosis factor (39), UV irradiation, and by phorbol 12-myristate 13-acetate (40). This suggests that the induction of AP-1 by resveratrol could be limited to processes of growth inhibition and that resveratrol is able to inhibit AP-1 activation when it is associated with hyperproliferation.

Although the natural resveratrol analog piceatannol also inhibited polyamine synthesis, it had only a significant influence on SSAT activity at concentrations of 200 µM. We demonstrated recently that the growth inhibiting effect of piceatannol is not as pronounced as that of resveratrol (19). In order to test specificity of these results all experiments were also performed with EGCG, the most abundant polyphenol in green tea, because ODC-inhibition by EGCG has been demonstrated earlier (41).

Taken together our findings demonstrate that resveratrol not only impairs polyamine synthesis and decreases the oncoprotein c-Myc, but also increases polyamine catabolism by SSAT. At the same time induction of c-Fos and its DNA-binding activity take place. Modulation of polyamine homeostasis seems to be an additional target of the antiproliferative effects of resveratrol. In this context resveratrol is more potent than EGCG. The mechanism of the growth inhibitory action of resveratrol seems to differ from that of the green tea polyphenol, because effects on c-Fos activity differed. The impact of piceatannol on polyamine synthesis was similar to that of resveratrol, although less pronounced.


    Notes
 
1 To whom correspondence should be addressed Email: j.stein{at}em.uni-frankfurt.de Back


    Acknowledgments
 
This work was supported by the Else Kröner-Fresenius-Foundation, Bad Homburg, Germany.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Cohen,S.S. (1998) A Guide to the Polyamines. Oxford University Press, Oxford.
  2. Marquet,R. and Houssier,C. (1988) Different binding modes of spermine to A-T and G-C base pairs modulate the bending and stiffening of the DNA double helix. Biochem. Pharmacol., 37, 1857–1858.[Medline]
  3. McLean,M.J. and Well,R.D. (1988) The role of sequence in the stabilization of left-handed DNA helices in vitro and in vivo. Biochim. Biophys. Acta, 950, 243–254.[Medline]
  4. Bauske,R., Milovic,V., Turchanowa,L. and Stein,J. (2000) EGF-stimulated polyamine accumulation in the colon carcinoma cell line, Caco-2. Digestion, 61, 230–236.[Medline]
  5. Milovic,V., Stein,J., Odera,G., Gilani,S and Murphy,G.M. (2000) Low-dose deoxycholic acid stimulates putrescine uptake in colon cancer cells. Cancer Lett., 154, 195–200.[CrossRef][Medline]
  6. Pegg,A.E. (1988) Polyamine metabolism and its importance in neoplastic growth and a target for chemotherapy. Cancer Res., 48, 759–774.[Abstract/Free Full Text]
  7. Wang,J.Y., McCormack,S.A., Viar,M.J., Wang,H., Tzen,C.Y., Scott,R.E. and Johnson,L.R. (1993) Decreased expression of protooncogenes c-fos, c-myc, and c-jun following polyamine depletion in IEC-6 cells. Am. J. Physiol., 265, G331–G338.
  8. Wang,J.Y., McCormack,S.A., Viar,M.J. and Johnson,L.R. (1991) Stimulation of proximal small intestinal mucosal growth by luminal polyamines. Am. J. Physiol., 261, G504–G511.
  9. Seiler,N., Bolkenius,F.N. and Rennert,O.M. (1981) Interconversion, catabolism and elimination of the polyamines. Med. Biol., 59, 334–346.[Web of Science][Medline]
  10. Ragione,F.D. and Pegg,A.E. (1982) Purification and characterization of spermidine/spermine N1-acetyltransferase from rat liver. Biochemistry, 21, 6152–6158.[CrossRef][Medline]
  11. Chopra,S. and Wallace,H.M. (1998) Induction of spermidine/spermine N1-acetyltransferase in human cancer cells in response to increased production of reactive oxygen species. Biochem. Pharmacol., 55, 1119–1123.[CrossRef][Web of Science][Medline]
  12. Soleas,G.J., Diamandis,E.P. and Goldberg,D.M. (1997) Resveratrol: a molecule whose time has come? And gone? Clin. Biochem., 30, 91–113.[CrossRef][Web of Science][Medline]
  13. Sanders,T.H., McMichael,R.W. Jr and Hendrix,K.W. (2000) Occurrence of resveratrol in edible peanuts. J. Agric. Food Chem., 48, 1243–1246.[CrossRef][Medline]
  14. Jang,M., Cai,L., Udeani,G.O., Slowing,K.V. et al. (1997) Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science, 275, 218–220.[Abstract/Free Full Text]
  15. Schneider,Y., Vincent,F., Duranton,B., Badolo,L., Gossé,F., Bergmann,C., Seiler,N. and Raul,F. (2000) Anti-proliferative effect of resveratrol, a natural component of grapes and wine, on human colonic cancer cells. Cancer Lett., 158, 85–91.[CrossRef][Web of Science][Medline]
  16. Wolter,F., Akoglu,B., Clausnitzer,A. and Stein,J. (2001) Downregulation of the cyclin D1/Cdk4 complex occurs during resveratrol-induced cell cycle arrest in colon cancer cell lines. J. Nutr., 131, 2197–2203.[Abstract/Free Full Text]
  17. Tessitore,L., Davit,A., Sarotto,I. and Caderni,G. (2000) Resveratrol depresses the growth of colorectal aberrant crypt foci by affecting bax and p21(CIP) expression. Carcinogenesis, 21, 1619–1622.[Abstract/Free Full Text]
  18. Schneider,Y., Duranton,B., Gossé,F., Schleiffer,R., Seiler,N. and Raul,F. (2001) Resveratrol inhibits intestinal tumorigenesis and modulates host-defense-related gene expression in an animal model of human familial adenomatous polyposis. Nutr. Cancer, 39, 102–107.[CrossRef][Web of Science][Medline]
  19. Wolter,F., Clausnitzer,A., Akoglu,B. and Stein,J. (2002) Piceatannol, a natural analog of resveratrol, inhibits progression through the S phase of the cell cycle in colorectal cancer cell lines. J. Nutr., 132, 298–302.[Abstract/Free Full Text]
  20. Waffo-Teguo,P., Hawthorne,M.E., Cuendet,M., Merillon,J.M., Kinghorn,A.D., Pezzuto,J.M. and Mehta,R.G. (2001) Potential cancer-chemopreventive activities of wine stilbenoids and flavans extracted from grape (Vitis vinifera) cell cultures. Nutr. Cancer, 40, 173–179.[CrossRef][Medline]
  21. Yang,C.S. (1997) Inhibition of carcinogenesis by tea. Nature, 389, 134–135.[CrossRef][Medline]
  22. Milovic,V., Turchanowa,L., Khomutov,A.R., Khomutov,R.M., Caspary,W.F. and Stein,J. (2001) Hydroxylamine-containing inhibitors of polyamine biosynthesis and impairment of colon cancer cell growth. Biochem. Pharmacol., 61, 199–206.[CrossRef][Medline]
  23. Hyvonen,T., Keinanen,T.A., Khomutov,R., Khomutov,R.M. and Eloranta,T.O. (1992) Monitoring of the uptake and metabolism of aminooxy analogues of polyamines in cultured cells by high-performance liquid chromatography. J. Chromatogr., 547, 17–21.
  24. Pena,A., Reddy,C.D., Wu,S., Hickok,N.J., Reddy,E.P., Yumet,G., Soprano,D.R. and Soprano,K.J. (1993) Regulation of human ornithine decarboxylase expression by the MYC/MAX protein complex. J. Biol. Chem., 268, 27277–27285.[Abstract/Free Full Text]
  25. Marcu,K.B., Bossone,S.A. and Patel,A.J. (1992) Myc function and regulation. Annu. Rev. Biochem., 61, 809–860.[CrossRef][Web of Science][Medline]
  26. Vujcic,S., Halmekyto,M., Diegelman,P., Gan,G., Kramer,D.L., Janne,J. and Porter,C.W. (2000) Effects of conditional overexpression of spermidine/spermine N1-acetyltransferase on polyamine pool dynamics, cell growth, and sensitivity to polyamine analogs. J. Biol. Chem., 275, 38319–38328.[Abstract/Free Full Text]
  27. Ichimura,S., Hamana,K. and Nenoi,M. (1998) Significant increases in the steady states of putrescine and spermidine/spermine N1-acetyltransferase mRNA in HeLa cells accompanied by growth effect. Biochem. Biophys. Res. Commun., 243, 518–521.[Medline]
  28. Ginty,D.D., Marlowe,M., Pekala,P.H. and Seidel,E.R. (1990) Multiple pathways for the regulation of ornithine decarboxylase in intestinal epithelial cells. Am. J. Physiol., 258, G454–G460.[Medline]
  29. Iwami,K., Wang,J.Y., Jain,R., McCormack,S. and Johnson,L.R. (1990) Intestinal ornithine decarboxylase: half-life and regulation by putrescine. Am. J. Physiol., 258, G308–G315.[Medline]
  30. Tabib,A. and Bachrach,U. (1999) Role of polyamines in mediating malignant transformation and oncogene expression. Int. J. Biochem. Cell Biol., 31, 1289–1295.[CrossRef][Web of Science][Medline]
  31. Chen,A., Davis,B.H., Bissonnette,M., Scaglione-Sewell,B. and Brasitus,T.A. (1999) 1,25-Dihydroxyvitamin D3 stimulates activator protein-1-dependent Caco-2 cell differentiation. J. Biol. Chem., 274, 35505–35513.[Abstract/Free Full Text]
  32. Souleimani,A. and Asselin,C. (1993) Regulation of c-fos expression by sodium butyrate in the human colon carcinoma cell line Caco-2. Biochem. Biophys. Res. Commun., 193, 330–336.[CrossRef][Web of Science][Medline]
  33. Barthelman,M., Bair,W.B. 3rd, Stickland,K.K., Chen,W., Timmermann,B.N., Valcic,S., Dong,Z. and Bowden,G.T. (1998) (–)-Epigallocatechin-3-gallate inhibition of ultraviolet B-induced AP-1 activity. Carcinogenesis, 19, 2201–2204.[Abstract/Free Full Text]
  34. Chen,W., Dong,Z., Valcic,S., Timmermann,B.N. and Bowden,G.T. (1999) Inhibition of ultraviolet B-induced c-fos gene expression and p38 mitogen-activated protein kinase activation by (–)-epigallocatechin gallate in a human keratinocyte cell line. Mol. Carcinogen., 24, 79–84.[CrossRef][Web of Science][Medline]
  35. Balasubramanian,S., Efimova,T. and Eckert,R.L. (2002) Green tea polyphenol stimulates a ras, MEKK1, MEK3, and p38 cascade to increase activator protein 1 factor-dependent involucrin gene expression in normal human keratinocytes. J. Biol. Chem., 277, 1828–1836.[Abstract/Free Full Text]
  36. Yu,R., Jiao,J.J., Duh,J.L., Gudehithlu,K., Tan,T.H. and Kong,A.N. (1997) Activation of mitogen-activated protein kinases by green tea polyphenols: potential signaling pathways in the regulation of antioxidant-responsive element-mediated phase II enzyme gene expression. Carcinogenesis, 18, 451–456.[Abstract/Free Full Text]
  37. Ding,Q., Dong,Z. and Evers,M. (1999) Enterocyte-like differentiation of the Caco-2 intestinal cell line is associated with increases in AP-1 protein binding. Life Sci., 64, 175–182.[Medline]
  38. Wolter,F. and Stein,J. (2002) Resveratrol enhances the differentiation induced by butyrate in Caco-2 colon cancer cells. J. Nutr., 132, 2082–2086.[Abstract/Free Full Text]
  39. Manna,S.K., Mukhopadhyay,A. and Aggarwal,B.B. (2000) Resveratrol suppresses TNF-induced activation of nuclear factors NF-kB, activator protein-1, and apoptosis: potential role of reactive oxygen intermediates and lipid peroxidation. J. Immunol., 164, 6509–6519.[Abstract/Free Full Text]
  40. Yu,R., Hebbar,V., Kim,D.W., Mandlekar,S., Pezzuto,J.M. and Kong,A.T. (2001) Resveratrol inhibits phorbol ester and UV-induced activator protein 1 activation by interfering with mitogen-activated protein kinase pathways. Mol. Pharmacol., 60, 217–224.[Abstract/Free Full Text]
  41. Bachrach,U. and Wang,Y.C. (2002) Cancer therapy and prevention by green tea: role of ornithine decarboxylase. Amino Acids, 22, 1–13.[CrossRef][Web of Science][Medline]
Received June 12, 2002; revised November 26, 2002; accepted November 27, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Evid Based Complement Alternat MedHome page
K. Chatelain, S. Phippen, J. McCabe, C. A. Teeters, S. O'Malley, and K. Kingsley
Cranberry and Grape Seed Extracts Inhibit the Proliferative Phenotype of Oral Squamous Cell Carcinomas
Evid. Based Complement. Altern. Med., July 23, 2008; (2008) nen047v1.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Ulrich, S. M. Loitsch, O. Rau, A. von Knethen, B. Brune, M. Schubert-Zsilavecz, and J. M. Stein
Peroxisome Proliferator-Activated Receptor {gamma} as a Molecular Target of Resveratrol-Induced Modulation of Polyamine Metabolism.
Cancer Res., July 15, 2006; 66(14): 7348 - 7354.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. M. Tucker, J. T. Murphy, N. Kisiel, P. Diegelman, K. W. Barbour, C. Davis, M. Medda, L. Alhonen, J. Janne, D. L. Kramer, et al.
Potent Modulation of Intestinal Tumorigenesis in Apcmin/+ Mice by the Polyamine Catabolic Enzyme Spermidine/Spermine N1-acetyltransferase
Cancer Res., June 15, 2005; 65(12): 5390 - 5398.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
F. Wolter, S. Ulrich, and J. Stein
Molecular Mechanisms of the Chemopreventive Effects of Resveratrol and Its Analogs in Colorectal Cancer: Key Role of Polyamines?
J. Nutr., December 1, 2004; 134(12): 3219 - 3222.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
J. Leiro, E. Cano, F. M. Ubeira, F. Orallo, and M. L. Sanmartin
In Vitro Effects of Resveratrol on the Viability and Infectivity of the Microsporidian Encephalitozoon cuniculi
Antimicrob. Agents Chemother., July 1, 2004; 48(7): 2497 - 2501.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wolter, F.
Right arrow Articles by Stein, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolter, F.
Right arrow Articles by Stein, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?