Carcinogenesis Advance Access originally published online on March 28, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 24, No. 5, 827-834,
May 2003
© 2003 Oxford University Press
CANCER BIOLOGY |
AMPK-ß1 subunit is a p53-independent stress responsive protein that inhibits tumor cell growth upon forced expression
1 Cancer Molecular Sciences, Pfizer Global Research and Development, Ann Arbor Laboratories, 2800 Plymouth Road, Ann Arbor, MI 48105, USA
2 Department of Radiation Oncology, University of Michigan, Ann Arbor MI 48109, USA
3 To whom correspondence should be addressed Email: yi.sun{at}pfizer.com
| Abstract |
|---|
|
|
|---|
In an effort to search for genes responsible for cell growth arrest and/or apoptosis associated with p53 signaling pathways, we profiled a human lung carcinoma line H1299, expressing a temperature-sensitive p53 (V138) against Affymetric human U95Av2 GeneChip A, consisting of 12 000 genes. 133 genes were identified that were either induced or repressed in response to p53-dependent cell growth arrest and apoptotic conditions. Among them, the ß1 subunit, but not other subunits of the AMP-activated protein kinase (AMPK) was strongly induced. The p53 consensus binding site search in the AMPK-ß1 promoter and the first intron identified four such putative sites. However, p53 failed to bind to any of these sites as assayed by in vitro gel retardation and in vivo chromatin immunoprecipitation. Furthermore, northern analysis showed that induction of this gene is independent of p53, as increased expression of the gene was observed in p53 null H1299/Neo control cells when the temperature was shifted to 32°C. Moreover, a DNA damaging agent, etoposide, also induced ß1 subunit expression in multiple human tumor cells, regardless of p53 status. Thus, the ß1 subunit of AMPK is not a p53 downstream target gene, but can be induced by cold shock or the chemotherapeutic drug, etoposide in a p53-independent manner. To determine the biological significance of AMPK-ß1 induction, we over-expressed the gene in two tumor cell lines, H1299 and U2-OS. In both lines, forced AMPK-ß1 expression inhibits tumor cell growth, suggesting that AMPK-ß1 induction may facilitate stress-induced growth inhibition and cell killing.
Abbreviations: AMPK, AMP-activated protein kinase.
| Introduction |
|---|
|
|
|---|
It is well known that the main functions of the p53 tumor suppressor are to induce cell growth arrest and apoptosis in response to cellular stress or DNA damage, depending upon severity of the damage and the cell context (1,2). These p53 functions are mainly mediated through transactivation as well as transrepression of its downstream target genes (3,4). For example, p53-induced growth arrest is achieved mainly by transactivation of Waf-1/p21 (for G1 arrest) (5), of 14-3-3
(for G2 arrest) (6) and of PTGF-ß (7). p53-induced apoptosis, on the other hand, is mediated by activation of genes involved in the mitochondrial pathway, such as Bax, Noxa, PUMA, p53AIP and PIGs, and in death receptor pathways such as KILLER/DR5, Fas, PIDD (4,814). Other p53 inducible genes that promote apoptosis include PERP (15), and APAF-1 (16). In addition, p53 represses some survival genes such as Bcl-2 and insulin-like growth factor receptor-1 (1719) to facilitate apoptosis induction. Although the mechanism by which p53 mediates transrepression is still not very clear (20), p53-induced transactivation is mediated by direct binding of p53 to its consensus sequence, consisting of two repeats of 10-bp motif 5'PuPuPuC(A/T)(T/A)GPyPyPy-3' separated by 013 nucleotides and located in the promoter region or the introns of a target gene (21). Therefore, the presence of such elements either in the promoter region or in an intron of a gene would suggest a possibility that the gene is subject to p53 up-regulation.
AMPK is a heterotrimeric protein consisting of one catalytic subunit (
) and two non-catalytic subunits (ß and
) (22,23). Two isoforms of
and ß subunits (
1 and
2, and ß1 and ß2), and three isoforms of the
subunit (
1,
2 and
3) have been identified (24,25). AMPK is a primary sensor of cellular energy changes (26). In response to environmental stresses that cause ATP depletion in cells, the kinase activity of AMPK is instantly induced and the increased activity either inhibits ATP consuming pathways or promotes ATP producing pathways (23). Three mechanisms were identified that contribute to the activation of the kinase: (i) a direct allosteric activation; (ii) activation through phosphorylation by an upstream kinase and (iii) maintaining the activity through inhibition of dephosphorylation (23). The ß1 subunit of AMPK binds to two other subunits,
and
in a 1:1:1 ratio and serves as a bridge between them to form a stable trimeric complex (23,27). In addition, some recent results suggested that the ß subunit might modulate the kinase activity through regulation of cellular localization of the enzyme (28). In the present study, we showed that the ß1 subunit, but not other subunits, can be transcripitionally upregulated by cold shock and a DNA damaging agent, etoposide, and such induction is independent of p53. Significantly, forced expression of AMPK-ß1 inhibits tumor cell growth.
| Materials and methods |
|---|
|
|
|---|
Cell culture and treatment
H1299/V138, a human lung carcinoma line transfected with a temperature-sensitive mutant p53 (containing an alanine-to-valine mutation at codon 138) and its vector control (H1299/Neo) were kindly provided by Dr Jiandong Chen at the H.Lee Moffitt Cancer Center and Research Institute (29). The H460 lung carcinoma line and H460/E6 (stably transfected with the human papilloma virus E6 gene) were obtained from Dr Wafik El-Deiry at the University of Pennsylvania. All other cell lines used in the study were purchased from ATCC. The parental lung carcinoma H1299 and H2009, cervical carcinoma HeLa and osteosarcoma U2OS cell lines were grown at 10% Dulbecco's modified Eagle's medium (Invitrogen, NY), whereas H1299/V138, H1299/Neo and H460/E6 cells were cultured in 10% DMEM plus 0.75 mg/ml G418. Etoposide (Sigma, MO) was made as 25 mM stock in DMSO and used at a final concentration of 25 µM. To activate p53, cells were treated with etoposide for different periods of time. To change p53 conformation, the culture temperature for H1299/V138 and H1299/Neo was either 39°C (non-permissive for wild-type p53 conformation) or 32°C (permissive for wild-type p53).
Affymetrix chip profiling
H1299/V138 and H1299/Neo cells were grown at 37°C to
70% confluency and shifted to either 32 or 39°C for 6, 16 or 24 h in the absence or presence of 25 µM etoposide. Total RNA was isolated, cRNA synthesized and subject to chip hybridization as detailed previously (30) using Affymetrix human U95Av2 GeneChip A, consisting of 12 000 human genes (Affymetrix, Santa Clara, CA). Scanned output files were analysed using Genechip 3.3 software (Affymetrix). The expression value for each gene was determined by calculating the average differences of the probe pairs. Fold change was expressed by dividing the expression value of each treatment to that of the corresponding control in each group as shown in Table I.
|
Search for potential p53 binding sites in AMPK-ß1 promoter and the first intron
The chromosomal location of the AMPK-ß1 gene was found and the evidence viewer from NCBI was used to determine the location of the first exon and intron of the gene within its contig. Using NCBI's sequence viewer, the location of the gene closest to the 5' end of the gene was also determined. Using the map viewer linked to the evidence viewer page, a region of each contig was selected that covered from the end of the closest upstream gene to the end of intron 1. Fasta files for the region was uploaded into Unix, converted to a GCG file, and searched for p53 binding sites using the GCG program Findpatterns. A search was performed, allowing three mismatches, for the p53 consensus binding site, RRRCWWGYYY(N){0,13}RRRCWWGYYY.
Electrophoretic mobility shift assay
The EMSA was performed as described previously (31,32). Briefly, DNAprotein binding reactions were carried out in 20 µl of final volume containing 20 mM HEPES, pH 7.9, 1 mM dithiothreitol, 3.5 mM MgCl2, 100 mM KCl, 0.03% (v/v) Nonidet P-40 (NP-40), 10% (v/v) glycerol, 1 µg of poly (dIdC), and either partially purified p53 protein or p53-containing nuclear extracts. Reactions were carried out for 10 min, followed by the addition of 1 ng of 32P-labeled p53 binding sites of PTGF promoter (7), or putative p53 binding oligonucleotides found in the promoter as well as the first intron of AMPK-ß1 gene. Following an additional 30 min incubation, the entire reaction mixture was loaded onto a native 4% polyacrylamide gel. The electrophoresis was conducted at room temperature until the bromophenol blue dye reached the bottom of the gel. After electrophoresis, the DNAprotein complexes were visualized by autoradiography. For competition experiments, a molar excess of unlabeled oligonucleotide was added to the reaction mixture 10 min before the addition of 32P-labeled probe. For super-shift analysis, 1 µg of anti-p53 antibody Ab-1 or DO-1 was added to the reaction mixture and incubated for 20 min before the addition of 32P-labeled oligonucleotide.
ChIPPCR
Chromatin immunoprecipitation analysis to assess potential in vivo binding of p53 with AMPK-ß1 subunit was performed as described (33,34). Briefly, subconfluent cells (107108 cells) were fixed by 1% formaldehyde and neutralized by 0.125 M glycine. Cells were harvested after PBS washes and the cell pellet was resuspended in lysis buffer [150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris (pH 7.5), 5 mM EDTA], containing 0.1 mg/ml sonicated ssDNA and protease inhibitors. The cell lysate was sonicated at maximal setting (Sonifier 450, Branson Ultrasonics, State) for 12 s x six times to yield chromatin fragments of
6001000 bp. Debris was pelleted by centrifugation for 10 min at 15 000 g. An aliquot of supernatant was saved for total input chromatin controls and the rest of the extract was pre-cleared with 50 µl of protein Gagarose (Santa Cruz) for 1 h at 4°C, and was then immunoprecipitated with 3 µg of p53 antibody (FL-391, Santa Cruz) by rocking overnight at 4°C. The immunocomplex was washed with the lysis buffer and IP washing buffer (100 mM Tris pH 7.5, 350 mM NaCl, 1% NP-40 and 0.1 mg/ml ssDNA), and eluted with IP elution buffer (50 mM NaHCO3, 1% SDS, freshly made). DNAprotein cross-linking was disrupted by 5 M NaCl and DNA was then precipitated by ethanol and used as template for PCR amplification. The primer sequences and their amplifying regions are given below. The primers are in italics, and the putative p53 binding sites are underlined with core sequences in bold.
Mdm2
GGTTGACTCAGCTTTTCCTCTTGAGCTGGTCAAGTTCAGACACGTTCCGAAACTGCAGTAAAAGGAGTTAAGTCCTGACTTGTCT-CCAGCTGGGGCTATTTAAACCATGCATTTTCC.
AMPK-p1
CAAGCCTATGAAGTAGGTGTTATTTTTGTTCCCATTTCACA-AAAGAAGAGACTAAGGTGACAGTTACTAAATGGTAAAGCCAGAA-TCTGAACATGGCCAGGCTGAATTCAGAGCTCCTGCCCTTGAACTTG-TTCTCTCACTTGCTTCCGGACCTTGCAATATCATAGACA.
AMPK-p2-4 (AMPK-p2-4 contains three putative over-lapping p53 binding sites)
GTCCGTCGTTGACTAAGACATCATGCACATGACTGTACTTCA-AATCTTGCTTGATTAAGGGAGGAACATGACATTAAGCTAGTCTTGGATTCGTAGTAGCCCCTT
GAPDH
GTATTCCCCCAGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGTGAGTGGAAGACAGAA.
cDNA cloning and northern analysis
Fifteen micrograms of total RNA was subjected to northern analysis as detailed previously (35). The probes for AMPK-ß1 and GAPDH were made by RTPCR (36). Primers for AMPK-ß1 were AMPK01 5'-ATGGGCAATACCAGCAGTGA-3' and AMPK02 5'-TCATATGGGCTTGTATAACA-3' that generated a 700 bp fragment. Primers for GAPDH were 5'-CGAGATCCCTCCAAAATCAA-3' and 5'-TGTGGTCATGAGTCCTTCCA-3'. These two fragments after sequencing confirmation were used as the northern probes. To generate AMPK-ß1 expressing vector that encodes the entire open reading frame with a FLAG-tag attached in the C-terminus, the primers of AMPK03 and AMPK04 were used. Their sequences are: AMPK03: 5'-CCCAAGCTTGGGCCACCATGGGCAATACCAGCAGTGA-3' and AMPK04: 5'-GCTCTAGAGCTCACTTGTCATCGTCGTCCTTGTAGTCTATGGGCTTGTATAACAAGGTG-3', which contained a FLAG-tag encoding sequence. The PCR fragments were then subcloned into TA pCR2.1 vectors (Invitrogen) and subject to DNA sequencing confirmation. The fragment generated by AMPK03/04 primers was then digested with HindIII, gel-purified and subcloned into pcDNA3 vector.
Western analysis
H1299-neo cells were either cold shocked and treated with etoposide or in combination for 6 or 24 h. Cell lysates were prepared and subject to western analysis as described previously (37), using Anti-AMPK-ß1 antibody (Upstate, VA, 1:100 dilution) and anti-ß actin antibody (Sigma).
Transient DNA transfection and tumor growth suppression assays
Subconfluent HeLa and H2009 cells were transiently transfected with plasmids expressing wild-type p53, p53 mutant-273, along with the vector control using LipofectAMINE reagent (Invitrogen) according to the protocol supplied by the manufacturer. Cells were harvested 38 h post-transfection, RNA isolated and subjected to northern analysis. To determine effect of AMPK-ß1 expression on tumor cell growth, subconfluent H1299 and U2-OS cells were transfected with AMPK-ß1 expressing vector, pcDNA3-AMPK-ß1, along with the pcDNA3 vector control using LipofectAMINE reagent. Twenty-four hours post-transfection, cells were trypsinized. One aliquot was saved for western blot using Anti-FLAG antibody (Sigma) to determine AMPK-ß1 expression, another aliquot was plated into 100 mm dish and subject to G418 (600 µg/ml) selection for 23 weeks. The stable colonies were stained with 50% methanol/10% acetic acid/0.25% Coomassie Blue and counted (38).
| Results |
|---|
|
|
|---|
Chip profiling identified AMPK-ß1 subunit as a p53 responsive gene
To search for genes responsive to p53-induced growth arrest and/or apoptosis, an Affymetrix Genechip consisting of 12 000 genes (Affymetrix, Human U295 Genechip A) was used to profile human H1299-Val138 cells expressing a temperature-sensitive p53 mutant. The cells grew normally at 39°C where p53 adapts a mutant conformation, but underwent growth arrest at 32°C where p53 adapts a wild-type conformation or apoptosis if exposed to DNA damaging agents, such as etoposide (29,39). H1299/Neo cells that neither underwent growth arrest nor apoptosis after exposure to etoposide at 32°C were used as controls. 131 genes were identified as being either induced or repressed in response to p53-induced cell growth arrest and/or apoptosis (Y.Sun et al., unpublished data). Among these differentially expressed genes, a gene encoding the ß1 subunit of the AMP-activated protein kinase (AMPK-ß1) was greatly induced by up to 8-fold when H1299/V138 cells were grown at 32°C under growth arrested condition. The elevated level was further increased up to 30-fold in the presence of etoposide that induces apoptosis (Table I). The level of AMPK-ß1 was also induced slightly (up to 23 fold) in H1299/Neo cells under same conditions. We also examined potential changes in expression of other AMPK subunits and found no change in any of other subunits (Table I). The results suggested that AMPK-ß1 could possibly be a p53 inducible gene.
p53 failed to bind to putative p53 binding sites in the AMPK-ß1 promoter and intron 1
Typically, p53 inducible target genes contain a p53 consensus-binding site either in the gene promoter or the introns (3). We first mapped the genomic structure of the AMPK-ß1 gene by searching Genbank using AMPK-ß1 cDNA (accession no. NM_006253) as described in the Materials and methods. As shown in Figure 1A, the AMPK-ß1 gene consists of seven exons and six introns. A search for potential p53 binding sites, allowing three mismatches was conducted in the gene promoter and the first intron. One putative p53 site (p1) in the promoter (nucleotides 1649 to 1617) and three over-lapping sites (p24) in the intron (nucleotides 39453983; 39634003 and 39844015, respectively) were identified. To determine potential binding of p53 to these sites, we performed gel mobility shifts using nuclear extracts prepared from H1299/V138 cells grown at 32°C in the presence of etoposide. One known p53 binding element located in the promoter of the PTGF-ß gene was used as a positive control (7). As shown in Figure 1B, p53 binds specifically to PTGF-ß site, but not to any of the putative sites found in the AMPK-ß1 gene. In addition, partially purified p53 (31) or nuclear p53 prepared from etoposide-treated H460 cells also failed to bind to these sites (data not shown), indicating a lack of p53 binding to these sites in vitro. We next performed chromatin imunoprecipitation assays to determine whether p53 binds to these sites in vivo. As shown in Figure 1C, p53 binds to its consensus sequence found in the Mdm2 gene when it adapts a wild-type conformation (32°C) in the presence of etoposide. None of AMPK-ß1 sites showed any significant binding to p53 in either growth conditions. Furthermore, no signal difference among various treatments was observed using GAPDH as a non-specific binding control. Taken together, p53 does not bind to the putative sites found in the AMPK-ß1 gene, implying that its induction is unlikely to be controlled by p53.
|
Cold shock or DNA damage induces AMPK-ß1 expression
Meanwhile, we attempted to verify chip results shown in Table I by northern analysis using AMPK-ß1 cDNA as a probe. As shown in Figure 2A, expression of AMPK-ß1 was undetectable when cells were grown at 39°C (lanes 17). A significant induction, as early as 6 h post-temperature shift from 3932°C (cold shock), was observed (lanes 810). Combination of cold shock with treatment of DNA damaging agent, etoposide further increased its expression level (lanes 1113). These results confirmed the chip observation that expression of AMPK-ß1 was induced under growth arrested and apoptosis conditions. Since chip profiling did show a slight induction of AMPK-ß1 in p53-null H1299/Neo cells, we next examined if induction was a cellular response to temperature shift, regardless of p53 status. The analogous northern analysis was performed and shown in Figure 2B. Either temperature shift from 39 to 32°C or etoposide treatment caused a remarkable induction of expression, occurring as early as 6 h (compare lanes 1 and 2 versus 36). Furthermore, the induction levels caused by cold shock and etoposide appears to be additive because their combination caused an even higher level of induction (compare lanes 4 and 6 versus 8). We also noticed that the induction level in H1299/Neo cells was comparable with those observed in the H1299/V138 cells, suggesting that cold shock or DNA damaging agent induces AMPK-ß1 expression, respectively, and independent of p53. To determine whether induction of AMPK-ß1 mRNA by cold shock or DNA damage increases protein expression, we performed a western blot analysis using an AMPK-ß1 antibody (Figure 2C). H1299-neo cells were treated with cold shock (lanes 3 and 4), etoposide (lanes 5 and 6) or in combination (lanes 7 and 8). Although prolonged heat shock (39°C for 24 h, lane 2) appeared to increase AMPKß protein up to 2-fold, the protein levels were largely in agreement with northern mRNA expression (Figure 2B). The cold shock increased protein level up to 3-fold, whereas etoposide induces protein level slightly (up to 2-fold). The combination of cold shock and etoposide increased protein level up to 4-fold, showing again an additive effect of two stresses on AMPK-ß1 expression.
|
Induction of AMPK-ß1 by etoposide is independent of p53
We further investigated AMPK-ß1 induction by etoposide in other human tumor models, differing in their p53 status. Wild-type p53-containing H460 lung carcinoma cells and p53-null corresponding H460/E6 cells were treated with etoposide for a period up to 24 h, followed by RNA isolation and northern analysis. As shown in Figure 3A, endogenous expression level was very low in both lines. However, expression was significantly induced as early as 6 h and elevated level sustained up to 24 h in both lines. The results clearly demonstrated that AMPK-ß1 is induced by etoposide, but independently of p53. Finally, we determined whether over-expression of p53 itself would induce AMPK-ß1 expression. HeLa and H2009 cells were transiently transfected with either wild-type or a mutant p53, followed by northern analysis. As shown in Figure 3B, basal AMPK-ß1 level was detectable in both lines. However, neither wild-type nor mutant p53-273 was able to induce AMPK-ß1 expression; further confirming that p53 does not regulate AMPK-ß1 expression.
|
Over-expression of AMPK-ß1 inhibits tumor cell growth
To determine the biological significance of AMPK-ß1 induction by cold shock and DNA damage agent, we cloned AMPK-ß1 cDNA with a FLAG-tag coding sequence at the 3'-end into pcDNA3 expression vector. The construct was transfected into H1299 cells and U2-OS cells, along with the pcDNA3 vector control and expression of AMPK-ß1 protein was detected in both lines (Figure 4A, lanes 1 and 2 for H1299 and lanes 3 and 4 for U2OS). The transfected cells were subjected to G418 selection for 23 weeks and stable colonies were stained and counted. Compared with the vector control (Figure 4B, plates 1 and 3), over-expression of AMPK-ß1 significantly inhibits tumor cell growth (Figure 4B, plates 2 and 4), as demonstrated by >60% reduction of colony numbers in both H1299 and U2-OS cells (Figure 4C). The growth inhibitory activity of AMPK-ß1 in H1299 cells is similar to that of p53, a well-known tumor suppressor (unpublished observation).
|
| Discussion |
|---|
|
|
|---|
In a chip profiling assay designed to identify genes responsive to p53-induced cell growth arrest and/or apoptosis, we found that AMPK-ß1 was strongly induced under conditions in which p53 was activated. The gene appeared to be a typical p53 downstream target as several putative p53 binding sites were identified in the gene promoter and intron 1. However, further characterization revealed that p53 does not bind to these sites both in vitro and in vivo. Northern analysis indicated a p53-independent induction of AMPK-ß1 by cold shock and/or DNA damage in multiple cell models. We, therefore, concluded that cold shock as well as DNA damage, such as etoposide treatment can transcriptionally induce AMPK-ß1 expression in a p53-independent manner. Although 90% chip data can be verified and confirmed by northern analysis, as demonstrated in our previous study (30), AMPK-ß1 shown in this study is clearly an exception. This suggests that chip profiling can be misleading in some cases and northern verification followed by a detailed characterization is warranted to make a final conclusion.
Activation of AMPK is mediated mainly via a phosphorylation of a subunit by an AMP-activated upstream kinase kinase (AMPKK) as well as AMP through allosteric mechanisms (26). It has been shown previously that heat shock induced AMPK activity through the depletion of cellular ATP level (40). Most recently, AMPK activity was found to be activated by oxidative stress, such as hydrogen peroxide (41) and hyperosmotic stress (42). The activation of AMPK appears to involve at least two pathways: an increase in the AMP/ATP ratio and AMP/ATP ratio independent, but a tyrosine kinase-dependent pathway (41,42). However, there is no clear evidence to suggest that AMPK may also be regulated at the transcriptional level via its subunits in response to cellular stresses. For the first time to our knowledge, we show here that a cold shock or the DNA damage agent etoposide remarkably induce expression of AMPK-ß1, but not of any other subunits. The finding suggests a possibility that AMPK may be not only regulated through allosteric and phosphorylation mechanisms, but also controlled at the transcriptional level.
AMPK is mainly considered to be a metabolic sensor monitoring cellular energy levels. Environmental stress-induced activation of AMPK initiated appropriate energy-generating pathways, while turned off anabolic pathways that consume ATP. AMPK has recently gained much interest in the diabetes research field because activation of this kinase induces GLUT4 translocation and increases glucose uptake in muscle cells, serving as a potential new target for treatment of type 2 diabetes (43). AMPK activity could also play a role in cancer. Interestingly, a few recent reports showed that AMPK could protect astrocytes or neuronal cells from apoptosis induced by cellular stress (4446). A most recent report showed that high expression of AMPK
1 and
2 subunits correlates with cellular resistance to cell killing induced by glucose deprivation. Transfection of antisense against AMPK
subunits to resistant pancreatic cancer cells decreased expression of AMPK
1 and
2 subunits, AMPK activity and as a result, diminished their tolerance to glucose deprivation. Furthermore, AMPK antisense inhibited anchorage-independent growth as well as in vivo tumor growth of pancreatic cancer cells (47). On the other hand, AICAR (5-aminoimidazole-4-carboxamide-1-ß-D-ribofuranoside), an activator of AMPK was recently found to inhibit in vitro growth of HepG2 hepatocellular carcinoma cells. This was at least, in part, due to AMPK-induced p53-Ser15 phosphorylation, followed by p53 accumulation and p21 induction (48). We reported here that over-expression of AMPK-ß1 subunit inhibits in vitro growth of H1299 lung carcinoma cells and U2-OS ostegenic sarcoma cells. As the p53 gene is deleted in H1299, growth inhibition seen here is unlikely through p53 activation. We also measured p21 expression following AMPK-ß1 transfection and found no induction in both H1299 and U2-OS cells (data not shown). Thus, AMPK-ß1-induced growth inhibition is probably mediated through a p53/p21-independent mechanism. Finally, AMPK-ß1 induction by cold shock and a DNA damaging agent and cell growth inhibition by AMPK-ß1 expression, as shown in this study, may suggest a mechanism by which cellular stress induces expression of AMPK-ß1 which then mediates cell growth arrest and cell killing.
| Notes |
|---|
*These authors contributed equally to this work.
| Acknowledgments |
|---|
We thank Drs Mary Davis and Ming Zhang at the University of Michigan for their helpful discussions.
| References |
|---|
|
|
|---|
- Ko,L.J. and Prives,C. (1996) p53: puzzle and paradigm. Genes Dev., 10, 10541072.
[Free Full Text] - Vousden,K.H. (2000) p53: death star. Cell, 103, 691694.[CrossRef][Web of Science][Medline]
- el Deiry,W.S. (1998) Regulation of p53 downstream genes. Semin. Cancer Biol., 8, 345357.[CrossRef][Web of Science][Medline]
- Vogelstein,B., Lane,D. and Levine,A.J. (2000) Surfing the p53 network. Nature, 408, 307310.[CrossRef][Medline]
- el Deiry,W.S., Tokino,T., Velculescu,V.E., Levy,D.B., Parsons,R., Trent,J.M., Lin,D., Mercer,W.E., Kinzler,K.W. and Vogelstein,B. (1993) WAF1, a potential mediator of p53 tumor suppression. Cell, 75, 817825.[CrossRef][Web of Science][Medline]
- Hermeking,H., Lengauer,C., Polyak,K., He,T.C., Zhang,L., Thiagalingam,S., Kinzler,K.W. and Vogelstein,B. (1997) 14-3-3 sigma is a p53-regulated inhibitor of G2/M progression. Mol. Cell, 1, 311.[CrossRef][Web of Science][Medline]
- Tan,M., Wang,Y., Guan,K. and Sun,Y. (2000) PTGFß, a type ß transforming growth factor (TGFß) superfamily member, is a p53 target gene that inhibits tumor cell growth via TGFß signaling pathway. Proc. Natl Acad. Sci. USA, 97, 109114.
[Abstract/Free Full Text] - Miyashita,T. and Reed,J.C. (1995) Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell, 80, 293299.[CrossRef][Web of Science][Medline]
- Knudson,C.M., Tung,K.S., Tourtellotte,W.G., Brown,G.A. and Korsmeyer,S.J. (1995) Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science, 270, 9699.
[Abstract/Free Full Text] - Polyak,K., Xia,Y., Zweier,J.L., Kinzler,K.W. and Vogelstein,B. (1997) A model for p53-induced apoptosis [see comments]. Nature, 389, 300305.[CrossRef][Medline]
- Stewart,Z.A. and Pietenpol,J.A. (2001) p53 Signaling and cell cycle checkpoints. Chem. Res. Toxicol., 14, 243263.[CrossRef][Web of Science][Medline]
- Yu,J., Zhang,L., Hwang,P.M., Kinzler,K.W. and Vogelstein,B. (2001) PUMA induces the rapid apoptosis of colorectal cancer cells. Mol. Cell, 7, 673682.[CrossRef][Web of Science][Medline]
- Nakano,K. and Vousden,K.H. (2001) PUMA, a novel proapoptotic gene, is induced by p53. Mol. Cell, 7, 683694.[CrossRef][Web of Science][Medline]
- Oda,K., Arakawa,H., Tanaka,T., Matsuda,K., Tanikawa,C., Mori,T., Nishimori,H., Tamai,K., Tokino,T., Nakamura,Y. and Taya,Y. (2000) p53AIP1, a potential mediator of p53-dependent apoptosis and its regulation by Ser-46-phosphorylated p53. Cell, 102, 849862.[CrossRef][Web of Science][Medline]
- Attardi,L.D., Reczek,E.E., Cosmas,C., Demicco,E.G., McCurrach,M.E., Lowe,S.W. and Jacks,T. (2000) PERP, an apoptosis-associated target of p53, is a novel member of the PMP-22/gas3 family. Genes Dev., 14, 704718.
[Abstract/Free Full Text] - Moroni,M.C., Hickman,E.S., Denchi,E.L., Caprara,G., Colli,E., Cecconi,F., Muller,H. and Helin,K. (2001) Apaf-1 is a transcriptional target for E2F and p53. Nature Cell. Biol., 3, 552558.[CrossRef][Web of Science][Medline]
- Miyashita,T., Krajewski,S., Krajewska,M., Wang,H.G., Lin,H.K., Liebermann,D.A., Hoffman,B. and Reed,J.C. (1994) Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene, 9, 17991805.[Web of Science][Medline]
- Wu,Y., Mehew,J.W., Heckman,C.A., Arcinas,M. and Boxer,L.M. (2001) Negative regulation of bcl-2 expression by p53 in hematopoietic cells. Oncogene, 20, 240251.[CrossRef][Web of Science][Medline]
- Werner,H., Karnieli,E., Rauscher,F.J. and LeRoith,D. (1996) Wild-type and mutant p53 differentially regulate transcription of the insulin-like growth factor I receptor gene. Proc. Natl Acad. Sci. USA, 93, 83188323.
[Abstract/Free Full Text] - Johnson,R.A., Ince,T.A. and Scotto,K.W. (2001) Transcriptional repression by p53 through direct binding to a novel DNA element. J. Biol. Chem., 276, 2771627720.
[Abstract/Free Full Text] - el Deiry,W.S., Kern,S.E., Pietenpol,J.A., Kinzler,K.W. and Vogelstein,B. (1992) Definition of a consensus binding site for p53. Nature Genet., 1, 4549.[CrossRef][Web of Science][Medline]
- Stapleton,D., Woollatt,E., Mitchelhill,K.I., Nicholl,J.K., Fernandez,C.S., Michell,B.J., Witters,L.A., Power,D.A., Sutherland,G.R. and Kemp,B.E. (1997) AMP-activated protein kinase isoenzyme family: subunit structure and chromosomal location. FEBS Lett., 409, 452456.[CrossRef][Web of Science][Medline]
- Hardie,D.G. and Hawley,S.A. (2001) AMP-activated protein kinase: the energy charge hypothesis revisited. Bioessays, 23, 11121119.[CrossRef][Web of Science][Medline]
- Stapleton,D., Mitchelhill,K.I., Gao,G., Widmer,J., Michell,B.J., Teh,T., House,C.M., Fernandez,C.S., Cox,T., Witters,L.A. and Kemp,B.E. (1996) Mammalian AMP-activated protein kinase subfamily. J. Biol. Chem., 271, 611614.
[Abstract/Free Full Text] - Cheung,P.C., Salt,I.P., Davies,S.P., Hardie,D.G. and Carling,D. (2000) Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP binding. Biochem. J., 346 (Pt 3), 659669.[CrossRef][Web of Science][Medline]
- Hardie,D.G., Carling,D. and Carlson,M. (1998) The AMP-activated/SNF1 protein kinase subfamily: metabolic sensors of the eukaryotic cell? Annu. Rev. Biochem., 67, 821855.[CrossRef][Web of Science][Medline]
- Woods,A., Cheung,P.C., Smith,F.C., Davison,M.D., Scott,J., Beri,R.K. and Carling,D. (1996) Characterization of AMP-activated protein kinase beta and gamma subunits. Assembly of the heterotrimeric complex in vitro. J. Biol. Chem., 271, 1028210290.
[Abstract/Free Full Text] - Warden,S.M., Richardson,C., O'Donnell,J. Jr, Stapleton,D., Kemp,B.E. and Witters,L.A. (2001) Post-translational modifications of the beta-1 subunit of AMP-activated protein kinase affect enzyme activity and cellular localization. Biochem. J., 354, 275283.[CrossRef][Web of Science][Medline]
- Pochampally,R., Fodera,B., Chen,L., Lu,W. and Chen,J. (1999) Activation of an MDM2-specific caspase by p53 in the absence of apoptosis. J. Biol. Chem., 274, 1527115277.
[Abstract/Free Full Text] - Wang,Y., Rea,T., Bian,J., Gray,S. and Sun,Y. (1999) Identification of the genes responsive to etoposide-induced apoptosis: application of DNA chip technology. FEBS Lett., 445, 269273.[CrossRef][Web of Science][Medline]
- Bian,J., Jacobs,C., Wang,Y. and Sun,Y. (1996) Characterization of a putative p53 binding site in the promoter of the mouse tissue inhibitor of metalloproteinases-3 (TIMP-3) gene: TIMP-3 is not a p53 target gene. Carcinogenesis, 17, 25592562.
[Abstract/Free Full Text] - Bian,J. and Sun,Y. (1997) p53CP, a putative p53 competing protein that specifically binds to the consensus p53 DNA binding sites: a third member of the p53 family? Proc. Natl Acad. Sci. USA, 94, 1475314758.
[Abstract/Free Full Text] - Kaeser,M.D. and Iggo,R.D. (2002) From the cover: chromatin immunoprecipitation analysis fails to support the latency model for regulation of p53 DNA binding activity in vivo. Proc. Natl Acad. Sci. USA, 99, 95100.
[Abstract/Free Full Text] - Zeng,S.Y., Dai,M.-S., Keller,D.M. and Lu,H. (2002) SSRP1 functions as a co-activator of the transcriptional activator p63. EMBO J., 21, 54875497.[CrossRef][Web of Science][Medline]
- Sun,Y., Pommier,Y. and Colburn,N.H. (1992) Acquisition of a growth-inhibitory response to phorbol ester involves DNA damage. Cancer Res., 52, 19071915.
[Abstract/Free Full Text] - Sun,Y., Nakamura,K., Hegamyer,G., Dong,Z. and Colburn,N. (1993) No point mutation of Ha-ras or p53 genes expressed in preneoplastic- to-neoplastic progression as modeled in mouse JB6 cell variants. Mol. Carcinogen., 8, 4957.[Web of Science][Medline]
- Duan,H., Wang,Y., Aviram,M., Swaroop,M., Loo,J.A., Bian,J., Tian,Y., Mueller,T., Bisgaier,C.L. and Sun,Y. (1999) SAG, a novel zinc RING finger protein that protects cells from apoptosis induced by redox agents. Mol. Cell. Biol., 19, 31453155.
[Abstract/Free Full Text] - Sun,Y., Dong,Z., Nakamura,K. and Colburn,N.H. (1993) Dosage-dependent dominance over wild-type p53 of a mutant p53 isolated from nasopharyngeal carcinoma. FASEB J., 7, 944950.[Abstract]
- Li,J., Wang,Y., Sun,Y. and Lawrence,T.S. (2002) Wild-type TP53 inhibits G (2)-phase checkpoint abrogation and radiosensitization induced by PD0166285, a WEE1 kinase inhibitor. Radiat. Res., 157, 322330.[CrossRef][Web of Science][Medline]
- Corton,J.M., Gillespie,J.G. and Hardie,D.G. (1994) Role of the AMP-activated protein kinase in the cellular stress response. Curr. Biol., 4, 315324.[CrossRef][Web of Science][Medline]
- Choi,S.L., Kim,S. J., Lee,K. T., Kim,J., Mu,J., Birnbaum,M.J., Soo Kim,S. and Ha,J. (2001) The regulation of AMP-activated protein kinase by H2O2. Biochem. Biophys. Res. Commun., 287, 9297.[CrossRef][Web of Science][Medline]
- Daniel,T. and Carling,D. (2002) Expression and regulation of the AMP-activated protein kinase-SNF1 (sucrose non-fermenting 1) kinase complexes in yeast and mammalian cells: studies using chimaeric catalytic subunits. Biochem. J., 365, 629638.[Web of Science][Medline]
- Musi,N., Fujii,N., Hirshman,M.F., Ekberg,I., Froberg,S., Ljungqvist,O., Thorell,A. and Goodyear,L.J. (2001) AMP-activated protein kinase (AMPK) is activated in muscle of subjects with type 2 diabetes during exercise. Diabetes, 50, 921927.
[Abstract/Free Full Text] - Culmsee,C., Monnig,J., Kemp,B.E. and Mattson,M.P. (2001) AMP-activated protein kinase is highly expressed in neurons in the developing rat brain and promotes neuronal survival following glucose deprivation. J. Mol. Neurosci., 17, 4558.[CrossRef][Web of Science][Medline]
- Blazquez,C., Geelen,M.J., Velasco,G. and Guzman,M. (2001) The AMP-activated protein kinase prevents ceramide synthesis de novo and apoptosis in astrocytes. FEBS Lett., 489, 149153.[CrossRef][Web of Science][Medline]
- Stefanelli,C., Stanic,I., Bonavita,F., Flamigni,F., Pignatti,C., Guarnieri,C. and Caldarera,C.M. (1998) Inhibition of glucocorticoid-induced apoptosis with 5-aminoimidazole-4-carboxamide ribonucleoside, a cell-permeable activator of AMP-activated protein kinase. Biochem. Biophys. Res. Commun., 243, 821826.[CrossRef][Web of Science][Medline]
- Kato,K., Ogura,T., Kishinoto,A., Minegishi,Y., Nakajima,N., Miyazaki,M. and Esumi,H. (2002) Critical roles of AMP-activated protein kinase in constitutive tolerance of cancer cells to nutrient deprivation and tumor formation. Oncogene, 21, 60826090.[CrossRef][Web of Science][Medline]
- Imamura,K., Ogura,T., Kishimoto,A., Kaminishi,M. and Esumi,H. (2001) Cell cycle regulation via p53 phosphorylation by a 5'-AMP activated protein kinase activator, 5-aminoimidazole-4-carboxamide-1-beta-D- ribofuranoside, in a human hepatocellular carcinoma cell line. Biochem. Biophys. Res. Commun., 287, 562567[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
Z. Feng, W. Hu, E. de Stanchina, A. K. Teresky, S. Jin, S. Lowe, and A. J. Levine The Regulation of AMPK {beta}1, TSC2, and PTEN Expression by p53: Stress, Cell and Tissue Specificity, and the Role of These Gene Products in Modulating the IGF-1-AKT-mTOR Pathways Cancer Res., April 1, 2007; 67(7): 3043 - 3053. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rattan, S. Giri, A. K. Singh, and I. Singh 5-Aminoimidazole-4-carboxamide-1-{beta}-D-ribofuranoside Inhibits Cancer Cell Proliferation in Vitro and in Vivo via AMP-activated Protein Kinase J. Biol. Chem., November 25, 2005; 280(47): 39582 - 39593. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dong, B. Ko, P. Baumeister, S. Swenson, F. Costa, F. Markland, C. Stiles, J. B. Patterson, S. E. Bates, and A. S. Lee Vascular Targeting and Antiangiogenesis Agents Induce Drug Resistance Effector GRP78 within the Tumor Microenvironment Cancer Res., July 1, 2005; 65(13): 5785 - 5791. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





