Skip Navigation


Carcinogenesis Advance Access originally published online on April 24, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
24/6/1059    most recent
bgg063v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ledda-Columbano, G. M.
Right arrow Articles by Columbano, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ledda-Columbano, G. M.
Right arrow Articles by Columbano, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 24, No. 6, 1059-1065, June 2003
© 2003 Oxford University Press


CANCER BIOLOGY

Sex difference in the proliferative response of mouse hepatocytes to treatment with the CAR ligand, TCPOBOP

Giovanna M. Ledda-Columbano1, Monica Pibiri, Danilo Concas, Francesca Molotzu, Gabriella Simbula, Costanza Cossu and Amedeo Columbano

Department of Toxicology, Oncology and Molecular Pathology Unit, University of Cagliari, Via Porcell 4, 09124 Cagliari, Italy

1 To whom correspondence should be addressed Email: gmledda{at}unica.it


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The nuclear receptor Constitutive Androstane Receptor (CAR) binds DNA as a heterodimer with the retinoic-X receptor and activates gene transcription. Previously, in vitro studies have shown that the testosterone metabolites, androstanol and androstenol, inhibit the constitutive transcriptional activity of CAR, suggesting that differences might exist in the response to CAR-mediated gene activation between different sexes. In this study, we have analyzed the response of female and male CD-1 mice to stimulation of hepatocyte proliferation caused by the CAR ligand TCPOBOP. Results showed that the labelling index of female hepatocytes at 24, 30 and 36 h after treatment was much higher than that found in males. The higher proliferative activity of female hepatocytes was associated with increased hepatic levels of cyclin D1, cyclin A, E2F and enhanced phosphorylation of pRb and p107. The increased mitogenic response of females was associated with higher mRNA levels of CYP2B10, a known target of CAR. Administration of androstanol to TCPOBOP-treated mice caused a reduction of labelling index, which was accompanied by a decrease of CYP2B10 and CAR mRNA levels. In conclusion, the results show that, in addition to microsomal detoxification, another biological response elicited by the CAR ligand TCPOBOP, namely, hepatocyte proliferation, occurs at higher levels in female than male mice, suggesting that CAR transcriptional activity in males is partially counteracted by physiological higher levels of testosterone metabolites such as androstanol and androstenol.

Abbreviations: BrdU, bromodeoxyuridine; CAR, constitutive androstane receptor; CIPRO, ciprofibrate; PB, phenobarbital; TCPOBOP, 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The induction of P450 s (CYP) and other drug-metabolizing enzymes by xenobiotic chemicals is a common cellular defence mechanism against the toxicity and carcinogenicity of foreign compounds (1). Increased expression of specific CYP genes in response to particular xenobiotics is a central component of this defence, although such induction can also increase production of toxic and carcinogenic metabolites (1,2). One of the two major groups of CYP inducers, typified by phenobarbital (PB), consists of a series of structurally diverse xenobiotic chemicals that induces a subset of CYP genes within the CYP2A, 2B, 2C and 3A superfamilies, with the CYP2B genes being most effectively up-regulated (36). Recently, it has been shown that the Constitutive Androstane Receptor (CAR), a nuclear receptor of the steroid/thyroid receptor superfamily, mediates the effects of PB-like inducers on regulation of the CYP2B genes (79). CAR is abundantly expressed in liver tissue and, as a heterodimer with retinoic X-receptor (RXR), activates gene transcription by binding to a nuclear receptor binding DR-4 motif. While CAR-mediated transcription of CYP2B genes can be further induced by PB and the halogenated hydrocarbon TCPOBOP (8,9), in vitro studies have shown that CAR-mediated constitutive activity on gene transcription can be inhibited by the testosterone metabolites androstanol and androstenol (10): although the exact mechanism by which these steroids inhibit CAR activity is not known, it is believed that androstanes bind directly to the CAR–RXR heterodimer, causing dissociation from the SRC co-activator (10). Based on these observations, it is possible to hypothesize that some biological effects induced by CAR ligands in vivo might be different among the sexes, the males probably being the less responsive due to their higher physiological levels of circulating testosterone metabolites. In this study we have examined and compared the proliferative response of female and male mouse liver occurring after treatment with the powerful CAR agonist and non-genotoxic hepatocarcinogen TCPOBOP (11,12). Moreover, we have also investigated the effect of the CAR inverse agonist, androstanol, on CAR-mediated hepatocyte proliferation. The results show that a single administration of TCPOBOP is much more effective in inducing proliferation of hepatocytes in females compared with male mice. Accordingly, transcription of the CYP2B10 gene, a known target of CAR, was higher in females than males. The difference in the proliferative response between female and male mice appears to be specific for the CAR ligand TCPOBOP, as treatment with the hepatomitogen ciprofibrate, a ligand of the nuclear receptor PPAR{alpha}, caused a similar extent of proliferation in both female and male hepatocytes. Moreover, administration of androstanol to TCPOBOP-treated male mice caused a further decrease of the labelling index and of hepatic CYP2B10 mRNA levels, supporting the concepts that many CAR-mediated biological effects in vivo may be inhibited by the presence of testosterone metabolites.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Animals
Female and male CD-1 mice (7–8 weeks old) purchased from Charles River (Milano, Italy) were used in these experiments. The animals were fed a laboratory chow diet provided by Ditta Mucedola (Settimo Milanese, Italy) and had free access to food and water. We followed Guidelines for the Care and Use of Laboratory Animals during the investigation. All experiments were performed in a temperature-controlled room with alternating 12 h dark/light cycles. Hepatocyte proliferation was induced by gavage treatment with the mitogen 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) (a gift of Dr B.A.Diwan, Frederick Cancer Center, MD), at a dosage of 3 mg/kg body wt, dissolved in dimethyl sulphoxide–corn oil solution. Controls received an equivalent amount of the vehicle. The effect of androstanol on hepatocyte proliferation was determined by treating the mice with seven i.p. injections of 3{alpha}-hydroxy-5{alpha}–androstanol (30 mg/kg, Steraloids, Newport, RI), dissolved in dimethyl sulphoxide–corn oil solution, 48, 24 and 1 h before TCPOBOP and 4, 8, 24 and 30 h afterwards. Three additional groups of mice received TCPOBOP alone, androstanol alone or oil, respectively. In another set of experiments, ciprofibrate (CIPRO, a gift from Sanofi Winthrop, Guilford, UK) was fed in the diet at a concentration of 0.025% and mice were killed 24, 48, 72 and 96 h thereafter. For determination of hepatocyte proliferation, bromodeoxyuridine (BrdU, 100 mg/kg, Sigma Chemicals, St Louis, MO) was administered intraperitoneally 2 h before killing the animals, or it was given continuously in drinking water (1 mg/ml). Immediately after death, liver sections were fixed in 10% buffered formalin and processed for staining with hematoxylin–eosin or immunohistochemistry. The remaining liver was snap-frozen in liquid nitrogen and kept at -80°C until use.

Immunohistochemistry
For determination of hepatocyte proliferation, mouse monoclonal anti-BrdU antibody was obtained from Becton Dickinson (Becton Dickinson, San Jose, CA) and the peroxidase method was used to stain BrdU-positive hepatocytes. Peroxidase goat anti-mouse immunoglobulin was obtained from Dako (Dako EnVision+TM Peroxidase Mouse, Dako, Carpinteria, CA). Four micron thick sections were deparaffinized, treated with 2 N HCl for 1 h, then with 0.1% trypsin type II (crude from porcine pancreas, Sigma, Milano, Italy) for 20 min and treated sequentially with normal goat serum 1:10 (Dako), mouse anti-BrdU 1:100 and Dako EnVision+TM Peroxidase Mouse ready-to-use. The sites of peroxidase binding were detected by 3,3'-diaminobenzidine. The labelling index was expressed as number of BrdU-positive nuclei/100 nuclei. Results are expressed as means ± SE of four to five mice per group. At least 2000 hepatocyte nuclei per liver were scored.

Northern blot analysis
Twenty to thirty micrograms of heat-denatured total RNA per lane was loaded on a 1% agarose/formaldeyde gel containing ethydium bromide for RNA detection at a UV lamp, and were blotted on Hybond-XL-membrane (Amersham, Buckinghamshire, UK). RNA concentration was determined spectrophotometrically at 260 nm. The gels were stained with ethidium bromide and photographed to check the quantity and quality of nucleic acids. In all cases the lanes contained similar amounts of RNA. The following 32P-labelled probes were used for hybridization: cyp2b10, CAR and cyclin D1. For cyp2b10, pUC13 plasmid, containing an EcoR1 fragment (a kind gift from Dr Negishi) was utilized; probe for CAR was prepared by RT–PCR with mouse liver total RNA using Superscript (Invitrogen, San Giuliano Milanese, Italy). PCR primers for CAR were forward AGTCGATCCTCCACTTCCAT and reverse ACTGCAAATCTCCCCGAGCAGCGG. For cyclin D1, a pcBZ054 plasmid containing a 1.3 kb, EcoR1 fragment, was used; DNA probes were labelled with [{alpha}-32P]dCTP by random priming (Random Priming DNA labeling Kit, Boheringer Mannheim, Germany). Membranes were exposed to autoradiographic film (Eastman Kodak, Rochester, NY).

Western blot analysis
Total cell extracts were prepared from frozen livers powdered in liquid nitrogen-cold mortar. Equal amounts of powder from different animals were resuspended in 1 ml Triton Lysis Buffer (1% Triton X-100, 50 mM Tris–HCl pH 7.4, 135 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 10 mM NAF, 5 mM iodoacetic acid, 10 µg/ml each of aprotinin, pepstatin and leupeptin). Several protease inhibitors were added to the isolation buffer to minimize protein degradation during the isolation protocol. Extracts were incubated for 30 min on ice, centrifuged at 12 000 r.p.m. at 4°C and the supernatants recovered. All inhibitors used were purchased from Boheringer Mannheim GmbH with the following exception: PMSF, NaF and DTT were purchased from Sigma Chemical and iodoacetic acid from ICN Biomedicals (Irvine, CA). The protein concentration of the resulting total extracts was determined according to Bradford (13) using bovine serum albumin as standard (DC Protein Assay, Bio-Rad Laboratories, CA). Nuclear extracts were prepared for the analysis of pRb, E2F, p107 and p130. For immunoblot analysis equal amounts (from 100 to 150 µg/lane) of proteins were electrophoresed on SDS 12 or 8% polyacrylamide gels. Acrylamide and bis-acrylamide were purchased from ICN Biomedicals. After gel electrotransfer onto nitrocellulose membranes (MSI), to ensure equivalent protein loading and transfer in all lanes, the membranes and the gels were stained with 0.5% (wt/vol) Ponceau S red (ICN Biomedicals) in 1% acetic acid, and with Coomassie Blue (ICN Biomedicals) in 10% acetic acid, respectively. Before staining, gels were fixed in 25% (v/v) isopropanol and 10% (v/v) acetic acid (Sigma Chemicals). After blocking in TBS containing 0.05% Tween 20 (Sigma Chemicals) and 5% non-fat dry milk, membranes were washed in TBS-T and then incubated with the appropriate primary antibodies diluted in blocking buffer. Whenever possible, the same membrane was used for detection of the expression of different proteins. Depending on the origin of primary antibody, filters were incubated at room temperature with either anti-mouse, anti-rabbit or anti-rat horseradish peroxidase conjugated IgG (Santa Cruz Biotechnology, CA). Immunoreactive bands were identified with chemiluminescence detection system, as described by the manufacturer (Supersignal Substrate, Pierce, Rockford, IL). When necessary, antibodies were removed from filters by 30 min incubation at 60°C in stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris–HCl, pH 7.6) and the membranes reblotted as above.

Antibodies
For immunoblotting experiments mouse monoclonal antibodies directed against p27 (Anti-Kip1/p27, Transduction Laboratories, Lexington, KY) and Cyclin D1 (72-13 G, Santa Cruz Biotechnology) were used; rabbit polyclonal antibodies against Cyclin A (C-19), Cyclin D3 (C-16), Cyclin E (M-20), p130 (C-20) and the goat polyclonal antibody against E2F-1 (C-20) and p107 (C-18) were from Santa Cruz. The rabbit polyclonal antibody against phospho-Rb (Ser 780) was from Cell Signaling Technology, Beverly, MA.

Statistical analysis
Comparison between the two groups was performed by Student's t test.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
CAR activates expression of murine CYP2B genes by binding to a PB response element identified upstream of the gene (14). CAR-mediated activity on gene transcription is induced by xenobiotics, such as PB and TCPOBOP (8,9). Accordingly, while expression of CYP2B10 gene was almost undetectable in the liver of untreated mice, mRNA levels were strongly induced 4, 24 and 30 h after a single exposure to TCPOBOP (Figure 1); the hepatic levels of CYP2B10 were more elevated in the liver from female mice compared with males (Figure 1), suggesting that inducibility of CYP2B10 by xenobiotics in mice is sexually dimorphic. These results support previous findings by Yoshinari et al. (15) who demonstrated, in rat liver, a sex-related difference in the capability of another CAR activator, PB, to induce CYP2B1. As TCPOBOP is a powerful liver mitogen in mice (16,17), we have investigated whether the mitogenic activity of TCPOBOP could also be different between the two sexes. Female and male mice treated with a single dose of TCPOBOP were killed at different time intervals and the labelling index was recorded. The results shown in Figure 2A clearly demonstrated that hepatocyte proliferation is induced at a higher extent in females than males. Indeed, at 24, 30 and 36 h after treatment with TCPOBOP, the labelling index was found to be 2–3-fold higher in the liver from female mice compared with males. The higher DNA synthetic activity seen in female mouse liver was confirmed by the analysis of hepatic protein levels of cyclin A, a cell cycle regulatory protein specifically expressed during S phase; indeed, as shown in Figure 2B, cyclin A was induced at a significantly higher level in females compared with males. Entry of hepatocytes into the cell cycle following treatment with ligands of nuclear receptors is not associated with changes in cytokines (tumor necrosis factor-{alpha}, interleukin-6), immediate early genes or transcription factors generally observed during liver regeneration after 2/3 partial hepatectomy (1821), while it is accompanied by a very rapid induction of a member of the G1 cyclins family, namely cyclin D1 (17,22,23). Therefore, we have determined the pattern of early changes in cyclin D1 protein in the liver of TCPOBOP-treated female and male mice. The results shown in Figure 3A indicate that levels of cyclin D1 mRNA were almost undetectable in untreated mice of both sexes; 4 h after TCPOBOP treatment a strong induction of cyclin D1 mRNA levels was seen in females, while its expression was significantly lower in male liver; accordingly, western analysis (Figure 3B) revealed that cyclin D1 protein levels were strongly induced as early as 8 h after TCPOBOP in female mouse liver, while no increase was observed up to 12 h in males. In agreement with our previous findings (22), levels of another G1 cyclin, cyclin E, were not modified, in both sexes, following treatment with TCPOBOP (Figure 3B). Together with its partners CDK4 and CDK6, cyclin D1 is thought to stimulate entry into S phase by phosphorylating pRb and causing the release of the transcriptional factor E2F (24,25). Therefore, we have examined changes in the expression of E2F and in the phosphorylation state of pRb and its family members p107 and p130 on liver nuclear extracts of TCPOBOP-treated male and female mice. Results shown in Figure 4, demonstrated that although TCPOBOP treatment caused an increase of the hepatic protein levels of E2F in both sexes, the enhancement was much higher in treated female mice; in addition, while p130 was not affected by TCPOBOP administration in both sexes, pRb and p107 phosphorylation was enhanced in both females and males, the former showing the maximal increase. To determine whether hyperphosphorylation of pRb depends entirely on enhanced cyclin-associated CDK activities or could also be due to a sex-related differential inhibition by TCPOBOP of the CDK inhibitor p27, we measured the level of this protein. As shown in Figure 4, no significant difference in p27 content could be observed between males and females, both in untreated as well as TCPOBOP-treated mice.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1. Induction by TCPOBOP of CYP2B10 mRNA in male and female CD-1 mice. Total RNAs were prepared from mouse liver 4, 24 and 30 h after treatment with TCPOBOP (3 mg/kg) and subjected to northern blot analysis as described in the Materials and methods. Three mice were used for each treatment and one representative blot probed with CYP2B10 is shown.

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. (A) Effect of TCPOBOP on labelling index of mouse hepatocytes. Male and female mice treated with a single dose of TCPOBOP (3 mg/kg, i.g.) were given a single i.p. dose of BrdU 2 h before death at 24, 30, 36 and 48 h after treatment. At least 2000 hepatocyte nuclei per liver were scored. The labelling index was expressed as number of BrdU-positive hepatocyte nuclei per 100 nuclei. Results are expressed as means ± SE of four to six mice per group. (B) Western blot analysis of cyclin A in liver of female and male mice treated as described above. Protein extracts (100 µg/lane) were prepared from the livers and western analysis was performed as described in the Materials and methods. Appropriate loading was confirmed by staining the gel with Coomassie Blue and efficiency of transfer was monitored by staining the membranes with Ponceau S red. Each lane represents pool of at least three livers.

 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3. (A) Induction by TCPOBOP of cyclin D1 mRNA in male and female mouse liver. Total RNAs were prepared from liver of mice killed 4 h after treatment with TCPOBOP (3 mg/kg) and subjected to northern blot analysis as described in the Materials and methods. Each lane represents pool of at least three livers. (B) Western blot analysis of cyclin D1 and cyclin E in liver of female and male mice killed 4, 8 and 12 h after TCPOBOP. Protein extracts (100 µg/lane) were prepared from the livers and western analysis was performed as described in the Materials and methods. Appropriate loading was confirmed by staining the gel with Coomassie Blue and efficiency of transfer was monitored by staining the membranes with Ponceau S red. Each lane represents pool of at least three livers. CO, controls.

 


View larger version (93K):
[in this window]
[in a new window]
 
Fig. 4. Western blot analysis of E2F pRb, p130, p107 and p27 in female and male mice killed 24, 30, 36 and 48 h after treatment with TCPOBOP. Nuclear extracts for E2F, p130, pRb, p107 and total extracts for p27 (100 to 200 µg/lane) were prepared from the livers and western analysis was performed as described in the Materials and methods. Appropriate loading was confirmed by staining the gel with Coomassie Blue and efficiency of transfer was monitored by staining the membranes with Ponceau S red. Each lane represents pool of three livers. CO, controls.

 
In vitro studies have shown that CAR-mediated constitutive activity on gene transcription can be inhibited by superphysiological concentrations of the testosterone metabolites androstanol and androstenol (10): although the exact mechanism by which these steroids inhibit CAR activity is not known, it was proposed that androstanes bind directly to the CAR–RXR heterodimer, causing dissociation from the SRC co-activator (10). However, other recent studies have demonstrated that basal nuclear levels of CAR mRNA are much higher in untreated females compared with male mice, suggesting that androgen at physiological concentrations could be a CAR-repressor (26). As from our present data, it appears that CAR-mediated activities in male mice are much lower than in females, we aimed at determining whether: (i) female and male mice could exhibit a difference in the hepatic mRNA levels of CAR following TCPOBOP treatment; (ii) exogenous androstanol could suppress hepatocyte proliferation induced by the ligand-activated CAR; and (iii) the difference in the proliferative response of male and female mouse hepatocytes is specific for CAR ligands or could also be observed when hepatocyte proliferation is stimulated by ligands of other nuclear receptors, such as PPAR{alpha}-ligands.

Results shown in Figure 5 demonstrated that, in agreement with previous reports (26), basal levels of CAR mRNA were higher in females than males; moreover, induction of CAR mRNA following TCPOBOP administration was more pronounced in females, suggesting that endogenous androstanes could inhibit not only CAR constitutive activity, but also the induced one.



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 5. Hepatic levels of CAR mRNA in untreated and TCPOBOP-treated female and male mice. Total RNAs were prepared from liver of mice killed 4 and 24 h after treatment with TCPOBOP (3 mg/kg) and subjected to northern blot analysis as described in the Materials and methods. Three mice were used for each treatment and one representative blot probed with CAR is shown. CO, controls.

 
To further investigate the role of testosterone metabolites on CAR-mediated effects, we next examined the proliferative response of hepatocytes from TCPOPBOP-treated male mice to androstanol. Based on previous in vitro studies (9), a concentration of 30 mg/kg of androstanol was selected for the experiment. Results showed that treatment with androstanol alone did not modify the basal proliferative activity of hepatocytes (Figure 6A and B); however, when androstanol was given prior to and after a single dose of TCPOBOP, it caused a 75% decrease in the number of BrdU-positive hepatocytes (Figure 6A and B) and a reduction of the expression of cyclin A, cyclin D1 and cyclin E in mice killed 36 h after treatment (Figure 7). Accordingly, androstanol treatment also led to a decrease of the hepatic levels of TCPOBOP-induced CYP2B10 and CAR mRNA (Figure 8), suggesting that testosterone metabolites inhibit the TCPOBOP-induced transcriptional activity of CAR.



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 6. (A) Representative microphotography, which illustrates the effect of androstanol on TCPOBOP-induced hepatocyte proliferation. Mice treated with a single dose of TCPOBOP (3 mg/kg, i.g.) were given seven injections of androstanol 48, 24 and 1 h before and 4, 8, 24 and 30 h after TCPOBOP and were killed 36 h after TCPOBOP. Two hours after TCPOBOP, all mice were given BrdU (1 mg/ml) in drinking water until the time of death (x200, sections counterstained with hematoxylin). CO, Controls; TCP, TCPOBOP; AND, androstanol. (B) Labelling index of mouse hepatocytes. Mice were treated as described above. At least 2000 hepatocyte nuclei per liver were scored. The labelling index was expressed as number of BrdU-positive hepatocyte nuclei per 100 nuclei. Results are expressed as means ± SE of four to six mice per group.

 


View larger version (80K):
[in this window]
[in a new window]
 
Fig. 7. Western blot analysis of cell cycle proteins in liver from mice killed 36 h after treatment with TCPOBOP, with or without androstanol (AND). Protein extracts (100 µg/lane) were prepared from the livers and western analysis was performed as described in the Materials and methods. Appropriate loading was confirmed by staining the gel with Coomassie Blue and efficiency of transfer was monitored by staining the membranes with Ponceau S red. Each lane represents an individual sample. CO, Control.

 


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 8. Effect of androstanol (AND) on the induction by TCPOBOP of Cyp2B10 and CAR mRNA levels in the liver of male CD-1 mice. Total RNAs were prepared from liver of mice killed 36 h after treatment with TCPOBOP (3 mg/kg), with or without androstanol. RNA was subjected to northern blot analysis as described in the Materials and methods. Each lane represents and individual sample. CO, Control.

 
Finally, to further support the hypothesis that the differences observed in TCPOBOP-treated male and female mice are specific for CAR ligands, we have examined the proliferative response of hepatocytes to the liver mitogen CIPRO, a PPAR{alpha} ligand. As our preliminary experiments showed that peroxisome proliferators do not exert a significant mitogenic activity when given at a single dose, CIPRO was fed in the diet and mice were killed at different times. As shown in Figure 9, a significant increase in labelling index was observed 3 days after beginning of CIPRO feeding being maximal at 4 days; unlike TCPOBOP treatment, no differences in the kinetics or in the extent of proliferation was observed between females and males treated with CIPRO, further suggesting that the sex-differences observed in TCPOBOP-treated mice are specific for CAR-mediated activities.



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 9. Labelling index of hepatocytes from male and female mice following treatment with CIPRO. Animals were fed a CIPRO-supplemented diet (0.025%) and killed 1, 2, 3 and 4 days later. BrdU (1 mg/ml, dissolved in drinking water) was given continuously. At least 2000 hepatocyte nuclei/liver were scored. Labelling index was expressed as number of BrdU-positive hepatocyte nuclei/100 nuclei. Results are expressed as means ± SE of four to six mice per group.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The present study demonstrates that the proliferative response of the liver to the CAR ligand TCPOBOP is sexually dimorphic in mice. Indeed, hepatocyte labelling index evaluated at several time points after treatment was higher in female than in male mice; in agreement with these findings, mRNA and protein levels of several cell cycle-related proteins were more elevated in females. The increased proliferative capacity of female mice hepatocytes appears to be specific for CAR-mediated hyperplasia and does not necessarily represent a general phenomenon in response to other mitogenic stimuli. In fact, (i) no increased regenerative capacity of the liver was reported in female mice following 2/3 surgical hepatectomy (27,28) and (ii) our present data showed that stimulation of hepatocyte proliferation by the PPAR{alpha} ligand, CIPRO, caused a similar extent of proliferation in males and females.

As to the different response between males and females in CAR-mediated activities, it was proposed that a difference in the basal levels of CAR may play a role in the sexually dimorphic induction of CYP2B in rats and mice (15,26); on the other hand, other studies have suggested that the presence in male mice of higher physiological levels of androstanol and androstenol (29), two testosterone metabolites that act as inverse agonists of CAR (10) causing dissociation of the SRC co-activator from RXR-CAR heterodimer, could be responsible for the lower responsiveness. Our present data showing higher levels of CAR mRNA in females compared with male mice following TCPOBOP treatment and demonstrating that exogenous androstanol further reduced CAR-mediated hepatocyte proliferation in males, seem to validate both the hypotheses. It could be argued that the different response of males and females to TCPOBOP might depend upon their different concentrations in the liver. However, although we have not measured the concentrations of TCPOBOP in male and female mice, there is evidence that differences in TCPOBOP metabolism and/or excretion do not justify the different proliferative response observed in the two sexes. Indeed, very detailed studies by Poland et al. (30) on four strains of mice and rats have clearly shown that the diminished potency of TCPOBOP in the rat, compared with the mouse, is not attributable to differences in the pharmacokinetics of TCPOBOP. Thus, it appears more likely that the weaker proliferative response observed in male mice, compared with females, is due to inhibition of CAR transcriptional activity by testosterone metabolites, rather than to differences in TCPOBOP concentrations in the two sexes.

A strong association between induction of microsomal detoxifying system, resulting in increased production of reactive oxygen species, mitogenic potency and liver tumor promotion in rats and mice has been suggested (3134). Both PB and TCPOBOP are non-genotoxic liver tumor promoters and/or carcinogens and both also caused hepatomegaly (11,12,33,35). At the present, we are not aware of the existence of a sex-related difference in the oncogenic potency of TCPOBOP. However, although the incidence of liver tumors is generally higher in males, it is of interest to note that PB is much more efficient in promoting rodent liver tumors in females than males (3638). Thus, it can be hypothesized that the higher capacity of CAR to induce transcription of cell cycle-related genes in female mice compared with males might represent an additional explanation for the sex-related difference in the incidence of liver tumors observed in animals treated with CAR ligands. More detailed studies are needed to determine the oncogenic potency of TCPOBOP in different sexes.

In summary, we have shown that following treatment with TCPOBOP, CAR-mediated induction of hepatocyte proliferation is sex-dependent, and that exogenous administration of the testosterone metabolite, androstanol, inhibit CAR-mediated biological effects. The possible implication of sex-related difference in the ability of TCPOBOP to induce microsomal enzymes and hepatocyte proliferation in the hepatocarcinogenic process is currently under investigation.


    Acknowledgments
 
Supported by Associazione Italiana Ricerca sul Cancro (AIRC), Ministero Universitá e Ricerca Scientifica (PRIN ex 40 and 60%), and Fondazione Banco di Sardegna, Italy.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Conney,A.H. (1982) Induction of microsomal enzymes by foreign chemicals and carcinogenesis by polycyclic aromatic hydrocarbons. Cancer Res., 42, 4875–4917.[Free Full Text]
  2. Thummel,K.E and Wilkinson,G.R. (1998) In vitro and in vivo drug interactions involving human CYP3A. Annu. Rev. Pharmacol. Toxicol., 38, 389–430.[CrossRef][Web of Science][Medline]
  3. Okey,A.B. (1990) Enzyme induction in the cytochrome P-450 system. Pharmacol. Ther., 45, 241–298.[CrossRef][Web of Science][Medline]
  4. Lubet,R.A., Dragnev,K.H., Chauhan,D.P., Nims,R.W., Diwan,B.A., Ward,J.M., Jones,V.R., Rice,J.M. and Miller,M.S. (1992) A pleiotropic response to phenobarbital-like enzyme inducers in the F344/MCr rat. Effects of chemicals of varied structure. Biochem. Pharmacol., 43, 1067–1078.[CrossRef][Web of Science][Medline]
  5. Waxman,D.J. and Azaroff,L. (1992) Phenobarbital induction of cytochrome P-450 gene expression. Biochem. J., 281, 577–582.
  6. Honkakoski,P. and Negishi,M. (1998) Regulatory DNA elements of phenobarbital-responsive cytochrome P-450 CYP2B genes. J. Biochem. Mol. Toxicol., 12, 3–9.[CrossRef][Medline]
  7. Honkakoski,P., Zelko,I., Sueyoshi,T. and Negishi,M. (1998) The nuclear orphan receptor CAR-retinoid X receptor heterodimer activates the phenobarbital responsive enhancer module of the CYP2B gene. Mol. Cell. Biol., 18, 5652–5658.[Abstract/Free Full Text]
  8. Sueyoshi,T., Kawamoto,T., Zelko,.I, Honkakoski,P. and Negishi,M. (1999) The repressed nuclear receptor CAR responds to phenobarbital in activating the human CYP2B6 gene. J. Biol. Chem., 274, 6043–6046.[Abstract/Free Full Text]
  9. Tzameli,I., Pissios,P., Schuetz,E.G. and Moore,D.D. (2000) The xenobiotic compound 1,4-bis[2-(3,5-dichloropyridiloxy)]benzene is an agonist ligand for the nuclear receptor CAR. Mol. Cell. Biol., 20, 2951–2958.[Abstract/Free Full Text]
  10. Forman,B.M., Tzameli,I., Choi,H.-S., Chen,A.J., Simha,D., Seol,W., Evans,R.M. and Moore,D.D. (1998) Androstane metabolites bind to and deactivate the nuclear receptor CARß. Nature, 395, 612–615.[CrossRef][Medline]
  11. Diwan,B.A., Lubet,R.A., Ward,J.M., Hrabie,J.A. and Rice,J.M. (1992) Tumor-promoting and hepatocarcinogenic effects of 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) in DBA/2NCr and C57BL/6NCr mice and an apparent promoting effect on nasal cavity tumors but not on hepatocellular tumors in F344/NCr initiated with N-nitrosodiethylamine. Carcinogenesis, 13, 1893–1901.[Abstract/Free Full Text]
  12. Dragani,T.A., Manenti,G., Galliani,G. and Della Porta,G. (1985) Promoting effect of 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene in mouse hepatocarcinogenesis. Carcinogenesis, 6, 225–228.[Abstract/Free Full Text]
  13. Bradford,M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein using the principle of protein-dye binding. Anal. Biochem., 72, 248–254.[CrossRef][Web of Science][Medline]
  14. Honkakoski,P., Moore,R., Washburn,K.A. and Negishi,M. (1998) Activation by diverse xenochemicals of the 51-base pair phenobarbital-responsive enhancer module in the CYP2B10 gene. Mol. Pharmacol., 53, 597–601.[Abstract/Free Full Text]
  15. Yoshinari,K., Sueyoshi,T., Moore,R. and Negishi,M. (2001) Nuclear receptor CAR as a regulatory factor for the sexually dimorphic induction of CYP2B1 gene by phenobarbital in rat livers. Mol. Pharmacol., 59, 278–284.[Abstract/Free Full Text]
  16. Manenti,G., Dragani,T.A. and Della Porta,G. (1987) Effects of phenobarbital and 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene on differentiated functions in mouse liver. Chem. Biol. Interact., 64, 83–92.[CrossRef][Web of Science][Medline]
  17. Ledda-Columbano,G.M., Curto,M., Piga,R. et al. (1998) In vivo hepatocyte proliferation is inducible through a TNF and IL-6-independent pathway. Oncogene, 17, 1039–1044.[CrossRef][Web of Science][Medline]
  18. Michalopoulos,G.K. and DeFrances,M.C. (1997) Liver regeneration. Science, 276, 60–66.[Abstract/Free Full Text]
  19. Yamada,Y., Kirillova,I., Peschon,J.J. and Fausto,N. (1997) Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type I tumor necrosis factor receptor. Proc. Natl Acad. Sci. USA, 94, 1441–1446.[Abstract/Free Full Text]
  20. Cressmann,D.E., Greenbaum,L.E., DeAngelis,R.A., Ciliberto,G., Furth,E.E., Poli,V. and Taub,R. (1996) Liver failure and defective hepatocyte regeneration in interleukin-6 deficient mice. Science, 274, 1379–1383.[Abstract/Free Full Text]
  21. Akerman,P., Cote,P., Yang,S.-Q., McClain,C., Nelson,S., Bagby,G.J. and Diehl,A.M. (1992) Antibodies to tumor necrosis factor-{alpha} inhibit liver regeneration after partial hepatectomy. Am. J. Physiol., 63, G579–G585.
  22. Ledda-Columbano,G.M., Pibiri,M., Loi,R., Perra,A., Shinozuka,H. and Columbano,A. (2000) Early increase in cyclin D1 expression and accelerated entry of mouse hepatocytes into S phase after administration of the mitogen 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene. Am. J. Pathol., 56, 91–97.
  23. Pibiri,M., Ledda-Columbano,G.M., Cossu,C., Simbula,G., Menegazzi,G., Shinozuka,H. and Columbano,A. (2001) Cyclin D1 is an early target in hepatocyte proliferation induced by thyroid hormone (T3). FASEB J., 15, 1006–1013.[Abstract/Free Full Text]
  24. Herwig,S. and Strauss,M. (1997) The retinoblastoma protein: a master regulator of cell cycle, differentiation and apoptosis. Eur. J. Biochem., 15, 581–601.
  25. Sherr,C.J. (1996) Cancer cell cycles. Science, 274, 1672–1677.[Abstract/Free Full Text]
  26. Kawamoto,T., Kakizaki,S., Yoshinari,K. and Negishi,M. (2000) Estrogen activation of the nuclear orphan receptor CAR (constitutive active receptor) in induction of the mouse Cyp2b10 gene. Mol. Endocrinol., 14, 1897–1905.[Abstract/Free Full Text]
  27. Lorup,C. (1977) An autoradiographic study of the 3H-uridine and 3H-thymidine incorporation in the regenerating mouse liver. Cell Tissue Kinet., 10, 477–485.[Web of Science][Medline]
  28. Paulsen,J.E. (1990) Variations in regenerative growth of mouse liver following partial hepatectomy. In vivo, 4, 235–238.[Medline]
  29. Bicknell,D.C. and Gower,D.B. (1976) The development and application of a radioimmunoassay for 5alpha-androst-16-en-3alpha-ol in plasma. J. Steroid Biochem., 7, 451–455.[CrossRef][Web of Science][Medline]
  30. Poland,A., Mak,I. and Glover,E. (1981) Species differences in responsiveness to 1,4-bis[2-(3,5-dichloropyridyloxy)]-benzene, a potent phenobarbital-like inducer of microsomal monooxygenase activity. Mol. Pharmacol., 20, 442–450.[Abstract/Free Full Text]
  31. McClain,RM. (1990) Mouse liver tumors and microsomal enzyme-inducing drugs: experimental and clinical perspectives with Phenobarbital. In Stevenson,D., McClain,R.M., Popp,J.A., Slaga,T.J., Ward,J.M. and Pitot,H.C. (eds) Mouse Liver Carcinogenesis: Mechanisms and Species Comparisons. Alan R. Liss, New York, pp. 345–365.
  32. Rao,M.S. and Reddy,J.K. Peroxisome proliferators and hepatocarcinogenesis. Carcinogenesis, 8, 631–636.
  33. Marsman,D.S., Cattley,R.C., Conway,G. and Popp,J.A. (1988) Relationship of hepatic peroxisome proliferation and replicative DNA synthesis to the hepatocarcinogenicity of the peroxisome proliferators di(2-ethylhexyl)phtalate and [4-chloro-6-(2,3-xilidino)-2-pyrimidynilthio]acetic acid (WY14643) in rats. Cancer Res., 48, 6739–6744.[Abstract/Free Full Text]
  34. Cunningham,M.L. (1996) Role of increased DNA replication in the carcinogenic risk of nonmutagenic chemical carcinogens. Mutat. Res., 365, 59–69.[Web of Science][Medline]
  35. Peraino,C., Fry,R.J.M. and Staffeldt,E. (1971) Reduction and enhancement by phenobarbital of hepatocarcinogenesis induced in the rat by 2-acetylaminofluorene. Cancer Res., 31, 1506–1512.[Abstract/Free Full Text]
  36. Pitot,H.C., Barsness,L., Goldsworthy,T. and Kitagawa,T. (1978) Biochemical characterization of stages of hepatocarcinogenesis after a single dose of diethylnitrosamine. Nature, 271, 456–458.[CrossRef][Medline]
  37. Weghorst,C.M. and Klaunig,J.E. (1989) Phenobarbital promotion in diethylnitrosamine-initiated infant B6C3F1 mice: influence of gender. Carcinogenesis, 10, 609–612.[Abstract/Free Full Text]
  38. Xu,Y.H., Campbell,H.A., Sattler,G.L., Hendrich,S., Maronpot,R., Sato,K. and Pitot,H.C. (1990) Quantitative stereological analysis of the effects of age and sex on multistage hepatocarcinogenesis in the rat by use of four cytochemical markers. Cancer Res., 1, 472–479.
Received February 12, 2003; revised April 3, 2003; accepted April 4, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Drug Metab. Dispos.Home page
A. Braeuning, R. Sanna, J. Huelsken, and M. Schwarz
Inducibility of Drug-Metabolizing Enzymes by Xenobiotics in Mice with Liver-Specific Knockout of Ctnnb1
Drug Metab. Dispos., May 1, 2009; 37(5): 1138 - 1145.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
A. Al Kholaifi, A. Amer, B. Jeffery, T. J. B. Gray, R. A. Roberts, and D. R. Bell
Species-Specific Kinetics and Zonation of Hepatic DNA Synthesis Induced by Ligands of PPAR{alpha}
Toxicol. Sci., July 1, 2008; 104(1): 74 - 85.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Alnouti and C. D. Klaassen
Regulation of Sulfotransferase Enzymes by Prototypical Microsomal Enzyme Inducers in Mice
J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 612 - 621.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. S. Petrick and C. D. Klaassen
Importance of Hepatic Induction of Constitutive Androstane Receptor and Other Transcription Factors That Regulate Xenobiotic Metabolism and Transport
Drug Metab. Dispos., October 1, 2007; 35(10): 1806 - 1815.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Swales and M. Negishi
CAR, Driving into the Future
Mol. Endocrinol., July 1, 2004; 18(7): 1589 - 1598.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
C. Handschin and U. A. Meyer
Induction of Drug Metabolism: The Role of Nuclear Receptors
Pharmacol. Rev., December 1, 2003; 55(4): 649 - 673.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
24/6/1059    most recent
bgg063v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ledda-Columbano, G. M.
Right arrow Articles by Columbano, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ledda-Columbano, G. M.
Right arrow Articles by Columbano, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?