Carcinogenesis Advance Access originally published online on October 10, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 25, No. 1, 11-19,
January 2004
© Oxford University Press; all rights reserved
CANCER BIOLOGY |
The role of p53 in base excision repair following genotoxic stress*
1 Department of Molecular Cell Biology, Weizmann Institute of Science, 76100 Rehovot, Israel and 2 Laboratory of Human Carcinogenesis, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA
| Abstract |
|---|
|
|
|---|
The p53 tumor suppressor protein is involved in apoptosis and cell cycle checkpoints. We have shown recently that p53 also facilitates base excision repair (BER). To further examine p53 involvement in the regulation of BER we chose to focus on 3-methyladenine DNA glycosylase (3-MeAde DNA glycosylase), the first enzyme acting in the BER pathway. 3-MeAde DNA glycosylase activity was found to be modulated by the p53 protein. This modulation was dependent on the type of genotoxic stress used.
-Irradiation damage resulted in activation of glycosylase, which was enhanced by p53. Doxorubicin and hydrogen peroxide (H2O2) treatment, although inducing p53 stabilization, did not cause the activation of glycosylase. Nitric oxide (NO) resulted in activation of 3-MeAde DNA glycosylase. Surprisingly this activation was down regulated by wild-type p53. The down regulation of 3-MeAde DNA glycosylase activity was due to trans repression of glycosylase mRNA by p53. Furthermore, we found that AP endonuclease (APE) activity was not altered by NO. Our study provides evidence for a possible antimutagenic role for p53 following exposure of cells to NO species. In the absence of p53, NO exposure results in elevation of 3-MeAde DNA glycosylase activity that results in elevation in the number of AP sites in DNA. At the same time, APE activity does not rise and removal of the AP sites is not further processed resulting in a mutator phenotype. When p53 is present, it down regulates the transcription of 3-MeAde DNA glycosylase. This provides a new model by which p53 prevents the creation of a mutator phenotype.
Abbreviations: AP, apurinic/apyrimidinic; APE, AP endonuclease; BER, base excision repair; iNOS, inducible NO synthase; 3-MeAde, 3-methyladenine; NO, nitric oxide.
| Introduction |
|---|
|
|
|---|
The p53 tumor suppressor protein is known to play a key role in the maintenance of genomic stability through its involvement in DNA repair pathways and cell cycle checkpoints (13). In vivo studies in p53 knockout mice have demonstrated a deficiency in global genomic repair leading to an increase in chromosomal abnormalities (4). Wild-type p53 was shown to participate in DNA repair and recombination pathways through transcriptional transactivation of DNA repair associated genes and through an interaction with components of the repair and recombination machinery (59). Furthermore, the core domain of wild-type p53 possesses an intrinsic 3'-to-5' exonuclease activity and the p53 C-terminus participates in sensing and detecting damaged DNA through direct binding to abnormal DNA structures (1013).
It is well established that p53 is stabilized and activated by genotoxic stress through post-translational modifications including phosphorylation of the protein both at the N' and C' termini (2,14). For example, the phosphorylation on serine 15 is believed to induce resistance to MDM-2 dependent degradation of p53 (15).
Recently, we and others have shown that wild-type p53 directly enhances base excision repair (BER) activity both in vitro and in vivo (5,1618). Furthermore, we found that following genotoxic stress, p53 modulates BER activity throughout the cell cycle (19).
The BER pathway is the main pathway responsible for the repair of oxidative DNA damage (20,21). Base modifications are the most common type of DNA lesions, occurring at an estimated rate of 20008000 sites/cell/day depending on the tissue type (22). Apurinic/apyrimidinic (AP) sites threaten cellular viability and genomic integrity as they can block DNA replication, and are cytotoxic and mutagenic. Therefore, cells have evolved elaborate mechanisms to preserve the fidelity of their genetic material and remove baseless lesions. 3-Methyladenine DNA (3-MeAde) glycosylases, the putative first step in the BER pathway, hydrolyses the N-glycosylic bond between the deoxyribose sugar moiety and the DNA base leaving an AP site. It was shown previously that some electrophilic chemotherapeutic agents activate the base excision repair by elevating the rate of generation of AP sites (20,23). Recently it was suggested that imbalance between the putative first enzyme of the BER pathway (3-MeAde glycosylase) and the putative second enzyme (AP endonuclease, APE) can lead to increased genomic instability (2426).
To better understand the role of p53 in the BER pathway, we investigated the influence of various genotoxic stress agents on the activity of 3-MeAde DNA glycosylase both in vitro and in vivo. We show the involvement of p53 in the regulation of 3-MeAde DNA glycosylase activity. Results obtained suggest that the effect of p53 on 3-MeAde DNA glycosylase activity is dependent on the type of stress introduced to cells. Furthermore, p53 is shown to down regulate 3-MeAde DNA glycosylase transcription and activity following exposure to nitric oxide (NO) species. This may prevent the development of a mutator phenotype resulting in accumulation of point mutations and in an increased genetic instability.
| Materials and methods |
|---|
|
|
|---|
Cell lines
The following cell lines were used: human colorectal carcinoma RKO cells restored with either an empty vector (RKO/NEO) or with a vector expressing the E6 gene (RKO/E6) (27); and p53 null human lung cell carcinoma cells, H1299. These were grown at 37°C in a humidified 5% CO2 atmosphere in Dulbecco's Modified Eagles Medium supplemented with 10% FCS, 4 mM glutamine, penicillin (10 U/ml) and streptomycin (10 µg/ml).
TK6 (wild-type p53) and WTK1 (mutant p53) human lymphoblast cell lines (28) were a kind gift of Dr J.B.Little. Both cell lines were derived from the same donor. These cells were grown at 37°C in suspension culture in a humidified 5% CO2 atmosphere in RPMI-1640 medium supplemented with 10% FCS, 4 mM glutamine, penicillin (10 U/ml) and streptomycin (10 µg/ml).
Exposure of cells to genotoxic stress
All cells were plated 24 h prior treatment and were 7080% confluent at the time of treatment. Cells were exposed to either spermine NONOate (0100 µM) (SPER/NO, Alexis Biochemicals, San Diego, CA), hydrogen peroxide (H2O2) (05 µM), doxorubicin (00.4 µg/ml) or irradiated (90 rad/min) by a
-beam model 150 (Nordion, Canada) fitted with a 60Co source. Cell extracts were then prepared for in vitro 3-MeAde DNA glycosylase activity assay as described below.
Preparation of protein lysates and western blot analysis
Cells were lysed in a buffer containing 50 mM TrisHCl, pH 8.0, 0.5% NP-40, 120 mM NaCl, 50 mM sodium fluoride, 0.1 mM sodium ortho vanadate, plus a recommended dose (one tablet per 10 ml buffer) of CompleteTM protease inhibitor cocktail tablets (Roche Diagnostics, Indianapolis, IN). Briefly, following protein quantification, 30 µg of cell extract were resuspended in sample buffer containing ß-mercaptoethanol and separated by SDSPAGE and electro-transferred onto nitrocellulose membrane. The following primary antibodies were used for protein analysis by standard western blot procedures: monoclonal anti-human p53 (DO-1 and PAb-421) (Oncogene Research) and monoclonal anti-tubulin (Sigma).
Analysis of cell cycle and apoptosis by FACS
Cells were treated with Triton X-100 and RNase H for 30 min at room temperature and stained with 50 µg/ml propidium iodide (PI staining) (Sigma). Cells were analyzed by FACScan flow cytometer (Beckton-Dickinson, Franklin Lakes, NJ) using the CellQuest (Beckton-Dickinson) software, as described previously (19).
Oligonucleotide-based assay for 3-MeAde DNA glycosylase activity
The oligonucleotide substrates were purchased from Midland Certified Reagents (Midland, TX). A double-stranded DNA substrate (25mer) containing a 1,N6-ethenoadenine (eA) adduct was then prepared. Briefly, an oligonucleotide sequence containing the site-specific base lesion (5'-GGATCATCGTTTTTeAGCTACATCGC-3') was 5'-end labeled with T4 polynucleotide kinase and [
-33P]ATP, then annealed to a 5-fold excess of the complementary strand (5'-GCGATGTAGCTAAAAACGATGATCC-5'). Incubations were carried out for 30 min with 10 µg protein in 3-MeAde buffer (100 mM Tris pH 7.5, 300 mM KCl, 50 mM EDTA, 50 mM EGTA, 143 mM ß-mercaptoethanol, 10 mM benzamidine, 100 µg/ml leupeptine, 100 µg/ml pepstatin A and 1 mg/ml aprotinin). Following incubation, NaOH was added to 0.1 M and the samples were heated to 70°C for 30 min, in order to convert the abasic sites created by DNA glycosylases into DNA strand breaks. Formamide containing loading buffer was added then samples were heated to 65°C for 5 min to stop the reaction. The DNA fragments were then separated on a 20% denaturing polyacrylamide gel. Gels were exposed to a phosphorimaging screen. Bands were quantified using Image Gauge Version 3.45 (Fuji Photo Film Co.). One microgram of pure DNA glycosylase (Trevigen, Gaithersburg, MD) was used as a positive control and 1 µg of BSA was used as a negative control. It should be noted that using the same oligo without the modified base did not result in glycosylase activity.
RTPCR analysis
Total RNA was extracted from 2 x 106 cells using the Tri-Reagent kit (Sigma) according to the manufacturer's instructions. For the generation of cDNA, 3 µg of RNA were incubated with 0.1 µg of random primers at 70°C for 10 min. Reverse transcription was performed using Superscript II following the manufacturer's instructions (Gibco-BRL, Cheshire, UK). The following primers were used for PCR amplification: GAPDH, 5' TCCACCACCCTGTTGCTGTA and 3' ACCACAGTCCATGCCATCAC; and 3-MeAde glycosylase, 5' AGCAGCCGTCCATCGTCAG and 3' CAGAAGTACATGCCGTAAATG.
Oligonucleotide-based assay for APE activity
The oligonucleotide substrates were purchased from Midland Certified Reagents. A double-stranded DNA substrate (18mer) containing an AP site was then prepared. Briefly, an oligonucleotide sequence containing the AP site [5'-GTCACCGTC(AP)TACGACTC-3'] was 5'-end labeled with T4 polynucleotide kinase and [
-32P]ATP, then annealed to a 5-fold excess of the complementary strand (3'-CAGTGGCAGCATGCTGAG-5'). Based on time-course and doseresponse experiments (data not shown), incubations were carried out for 2 min with 0.01 µg protein in APE buffer (50 mM HEPESKOH, pH 7.5, 50 mM KCl, 100 µg/ml bovine serum albumin, 10 mM MgCl2 and 0.05% Triton X-100) (29) followed by addition of formamide loading buffer and heating to 65°C for 5 min to stop the reaction. The DNA fragments were then separated and bands quantified as described for 3-MeAde glycosylase. One microgram of pure APE (Trevigen) was used as a positive control and 1 µg of BSA was used as a negative control.
Preparation of animal tissue extracts
Liver extracts from inducible NO synthase (iNOS) wild-type and iNOS knockout mice were analyzed. All steps during protein isolation were carried out at 4°C. Fresh-frozen tissue was homogenized for 5 s intervals in cold 3-MeAde glycosylase buffer. This buffer consisted of 100 mM Tris (pH 7.5), 300 mM KCl, 50 mM EDTA, 50 mM EGTA, 143 mM ß-mercaptoethanol, 10 mM benzamidine, 100 µg/ml leupeptine, 100 µg/ml pepstatin A and 1 mg/ml aprotinin. The homogenate was centrifuged at 60 000 r.p.m. in a Sorval RC M120 centrifuge for 10 min. Following supernatant collection and determination of protein concentration, samples were frozen at -80°C until analysis.
Statistics
Each experiment was repeated a minimum of three times. After quantification of upper and lower bands on a phosphorimager, the lower band was calculated as a percentage of the cut product. Mean differences between iNOS WT and iNOS KO mice were compared by a paired Student's t-test. The P-value chosen for significance in this study was 0.01.
| Results |
|---|
|
|
|---|
Under non-stressed conditions, 3-MeAde DNA glycosylase activity is similar, regardless of p53 status
Previously, we have shown that p53 facilitates BER (16). However, the mechanism of this activity is not well understood yet. We therefore examined whether p53 modulates the first enzyme in BER, 3-MeAde DNA glycosylase.
Previously, we found that while wild-type p53 facilitated BER activity, mutant p53 seem to interfere with it (5,16). To investigate the possible effect of p53 on 3-MeAde DNA glycosylase, we first established the status of glycosylase activity in non-stressed cells expressing wild-type or mutant p53 protein. For that, we measured 3-MeAde DNA glycosylase activity in two isogenic human lymphoblast cell lines, one expressing wild-type p53 (TK6) and the other expressing mutant p53 (WTK1, M237I mutant). As shown in Figure 1A, under non-stressed conditions, 3-MeAde DNA glycosylase activity in the mutant p53 expressing cells (WTK1) is not significantly different from that in the wild-type p53 expressing cells (TK6).
|
To further investigate the connection between the p53 protein and 3-MeAde glycosylase we measured glycosylase activity in: (i) human H1299 p53 null cells infected with either an empty retroviral vector (G40), a vector encoding the 175-p53 mutant or a vector encoding the 273-p53 mutant, (ii) RKO human colorectal carcinoma cells expressing an empty vector (RKO/NEO) or E6 (RKO/E6) (knocks out p53 function) and (iii) in mouse lymphoid cells that are p53 null (L12) and in subclones of the L12 that express either wild-type (CD) or mutant p53 (M8). As shown in Figure 1B, under non-stressed conditions, 3-MeAde glycosylase activity is similar, regardless of p53 status.
-Irradiation causes an elevation in p53-dependent 3-MeAde DNA glycosylase activity
Because p53 is known to be activated following genotoxic stress, we examined whether, under stressed conditions, p53 modulates 3-MeAde DNA glycosylase activity. Based on our previous findings in which p53 was shown to facilitate BER activity following
-irradiation (19,30), we tested whether this activity involves the direct activation of 3-MeAde DNA glycosylase. We examined RKO/NEO and RKO/E6 cells (27). Cells were irradiated with either 75 or 400 rad, incubated for 4 h and extracted for 3-MeAde DNA glycosylase activity assay in vitro. As shown in Figure 2A, 3-MeAde DNA glycosylase activity in the RKO/NEO cells was rapidly increased following exposure of cells to either dose of
-irradiation. The observed increase was not evident in cells expressing the E6 viral protein. Again, no difference in 3-MeAde DNA glycosylase activity was evident in non-stressed cells. In our previous studies we found that the p53 dependent DNA repair pathway is mutually exclusive of the p53 dependent apoptosis pathway. Indeed, we have shown previously that at low levels of DNA damage p53, dependent DNA repair is activated, while high doses block this activity and instead induce apoptosis (30). We therefore measured the apoptotic activity under conditions in which 3-MeAde DNA glycosylase activity was induced. We could not detect any significant increase in apoptosis following exposure of both cell lines to the doses mentioned (Figure 2B). Elevation in 3-MeAde DNA glycosylase activity was accompanied by p53 induction, as shown in Figure 2C. This induction did not include dephosphorylation of serine 376 on the C' terminus of p53, measured by binding to PAb-421. This further confirms our previous observation showing that activation of the BER pathway by
-irradiation is p53-dependent. Furthermore, our data show that the up regulation in BER involves the direct activation of 3-MeAde DNA glycosylase, the putative first enzyme acting in this pathway.
|
Doxorubicin did not increase 3-MeAde DNA glycosylase activity
We next examined whether 3-MeAde DNA glycosylase activity is affected by other types of genotoxic stress. RKO cells were treated with increasing doses of doxorubicin (an inducer of double strand breaks). As shown in Figure 3A, 3-MeAde DNA glycosylase activity was not altered following treatment in both RKO/NEO cells or RKO/E6 cells. The apoptotic pattern of cells under these conditions was analyzed. The cell cycle pattern of cells 24 h following doxorubicin treatment showed a marked increase in both p53 dependent and independent apoptosis in the higher dose of the drug (Figure 3B). Under these conditions, p53 protein was increased (Figure 3C) suggesting that genotoxic stress induced by doxorubicin activates p53 without the induction of 3-MeAde DNA glycosylase activity. This is consistent with the hypothesis that doxorubicin induces the mismatch and double strand breaks repair pathways (32,33) but does not trigger the BER pathway.
|
Different effects of H2O2 and NO treatment on 3-MeAde DNA glycosylase activity
The above experiments show that while
-irradiation induces 3-MeAde DNA glycosylase activity, doxorubicin treatment has no effect. We next examined the effect of NO and H2O2, key molecules involved in inflammatory stress (3436), on 3-MeAde DNA glycosylase activity. First, RKO/NEO and RKO/E6 cells were treated with increasing doses of H2O2. As shown in Figure 4, 3-MeAde DNA glycosylase activity was not significantly elevated by H2O2. p53 dependent apoptosis under the genotoxic stress used was tested. There was a slight increase in p53 independent apoptosis in RKO/E6 cells. Cells expressing wild-type p53 exhibited a marked increase in p53 dependent apoptosis (Figure 4B). This treatment also induced p53 protein accumulation (Figure 4C). Thus, indicating that H2O2 induced oxidative stress, like doxorubicin, causes p53 stabilization with little effect on 3-MeAde DNA glycosylase activity.
|
We next examined the effect of NO on 3-MeAde DNA glycosylase activity. Nitrogen and reactive oxygen species, often generated at sites of active inflammation, may result in accumulation of damaged DNA and activation of the BER pathway (37). RKO/NEO or RKO/E6 cells were treated with the NO donor SPER/NO. As shown in Figure 5A, 3-MeAde DNA glycosylase activity in RKO/NEO cells is at least three times lower than that in RKO/E6 cells in the entire range of NO doses used. The level of 3-MeAde DNA glycosylase activity in RKO/E6 was not changed following increased doses of NO. As shown in Figure 5B, activation of 3-MeAde DNA glycosylase by NO is accompanied by a rapid induction of the p53 protein. However, an elevated activity of glycosylase following exposure of cells to NO was only evident in the RKO/E6 cells. This is consistent with the hypothesis that NO-activated wild-type p53 may function as a down regulator of 3-MeAde DNA glycosylase.
|
To further establish this unexpected result, experiments were repeated with the human H1299 adenocarcinoma cells that are p53 null. Cells were treated with increasing doses of SPER/NO and 3-MeAde DNA glycosylase activity was measured. As shown in Figure 5C, NO induced 3-MeAde DNA glycosylase activity in these p53 null cells (left two bars). While using H1299 cells expressing the temperature sensitive p53 protein (Val 143) in the permissive temperature (wild-type conformation), we observed a down regulation in 3-MeAde DNA glycosylase activity following NO treatment (right two bars). These results suggest that while NO induces an increase in p53-independent 3-MeAde DNA glycosylase activity, expression of p53 appears to down regulate the NO induced 3-MeAde DNA glycosylase activity.
To explore the mechanism behind the described down regulation, we tested mRNA steady state levels of 3-MeAde DNA glycosylase in both RKO and H1299 (data not shown) cells treated with SPER/NO. As shown in Figure 5D, 3-MeAde DNA glycosylase mRNA levels are equal in both RKO/NEO and RKO/E6 cells before NO exposure. Following exposure to a high dose of NO, the level of 3-MeAde DNA glycosylase mRNA in RKO/E6 increased. In contrast, in RKO/NEO cells, 3-MeAde DNA glycosylase mRNA levels decrease rapidly. This implies that the down regulation of 3-MeAde DNA glycosylase activity by p53 is due to trans repression of 3-MeAde DNA glycosylase mRNA mediated by p53.
In all, our results suggest that depending on the type of genotoxic stress, 3-MeAde DNA glycosylase activity is differently affected by p53 expression. While
-irradiation induces p53 dependent 3-MeAde DNA glycosylase activity, doxorubicin and H2O2 do not affect this pathway. In contrast treatment of cells with NO, will induce 3-MeAde DNA glycosylase activity that is down regulated by p53.
NO treatment does not activate APE activity
Next, we asked whether exposure of cells to NO species would affect the next step in the BER pathway, APE. For that, we measured APE activity in vitro in RKO cells exposed to NO. As can be seen in Figure 6, exposure of both RKO/NEO and RKO/E6 cells to increasing doses of NO did not result in increased activity of APE.
|
We next examined the effect of NO on another human cell line expressing wild-type p53, the lymphoblastoid TK6 cells. In these cells we noticed that NO treatment at low doses hardly induce p53 stabilization. As seen in Figure 7B, p53 protein stabilization was barely evident following treatment of cells with 10 µM of SPER/NO. Interestingly, we observed an increase in 3-MeAde DNA glycosylase activity that preceded the marked increase in p53 levels. Once p53 was highly induced we observed a reduction in 3-MeAde DNA glycosylase activity. It should be mentioned that the observed induction of p53 was accompanied by phosphrylation on serine 15 and acetylation of the C'-terminus of the protein (data not shown). This is in agreement with the above findings with the RKO cells where NO induced p53 seem to down regulate 3-MeAde DNA glycosylase activity.
|
NO induced apoptosis
Analyzing the cell cycle pattern of treated RKO cells detected an elevation in apoptosis in cells that did not activate 3-MeAde DNA glycosylase. We then asked whether the decrease in 3-MeAde DNA glycosylase activity in p53 producer cells at high levels of NO is accompanied by activation of another cellular pathway. As indicated above, one such potential pathway is p53 dependent apoptosis. To test this hypothesis we treated TK6 cells with increasing doses of SPER/NO and analyzed them for cell cycle pattern by FACS. We observed that treating cells with low levels of NO did not alter the pattern of the cell cycle (Figure 8). However, high levels of NO (100 µM) resulted in an enhanced accumulation of apoptotic cells. This is consistent with the hypothesis that BER and apoptosis are most probably mutually exclusive pathways. This conclusion is supported by our previous observation in pre-B mouse cells (38), where we found that in response to low levels of
-irradiation the BER pathway was activated whereas high levels of
-irradiation induced predominantly apoptosis (30).
|
3-MeAde DNA glycosylase activity in liver protein extracts is reduced by genetic ablation of iNOS
To further support the in vitro effect of NO species on 3-MeAde DNA glycosylase, we have tested 3-MeAde DNA glycosylase activity in liver extracts of both iNOS wild-type and knock out mice. iNOS knockout mice show both exacerbated and reduced signs and symptoms of chemically or genetically-induced colitis (39,40). As shown in Figure 9, knocking out iNOS in animals reduces the activity of 3-MeAde DNA glycosylase. A time-course experiment was first performed to determine the optimal dose of protein and time of incubation used to compare liver extracts from iNOS WT and iNOS KO mice. A decision was made to use 250 µg protein incubated with oligonucleotide for 1 h (Figure 9A). Using these conditions, we observed a statistically significant reduction in 3-MeAde DNA glycosylase activity by genetic ablation of iNOS (which also resulted in a reduction in nitrate and nitrite levels by
9-fold) (Figure 9B and C). This is consistent with the hypothesis that NO plays a role in regulating 3-MeAde DNA glycosylase in vivo.
|
| Discussion |
|---|
|
|
|---|
p53 tumor suppressor, the guardian of the genome (41), functions as part of the stress-response pathway, which determines the fate of cells. p53 may induce cell survival, which involves cell cycle delay accompanied by repair of DNA damage (7,42,43), cell suicide, accomplished through apoptosis (44,45) or permanent cell-cycle arrest terminated by necrosis or cellular differentiation (46,47).
Mammalian cells have evolved a diverse defence network for the maintenance of genomic integrity to prevent the fixation of permanent genetic damage induced by endogenous and exogenous mutagens. One major genomic surveillance mechanism is through cell cycle checkpoints (48). The other involves the DNA repair machinery (2,7,8).
p53 was shown previously to affect NER mainly through regulation of downstream effector genes such as Gadd45 (49,50). Recently, we have shown that wild-type p53 protein, directly enhances BER activity measured both in vitro and in vivo (5,16). Furthermore, we found that following genotoxic stress, p53 modulates BER activity throughout the cell cycle (19). These data were further supported by a report by Zhou et al. (17) demonstrating that the stimulation of BER by p53 is correlated with its ability to interact directly both with APE (APE/Ref1) and with DNA polymerase ß, thus stabilizing the interaction between DNA Pol ß and abasic sites. Recent work has further demonstrated the active participation of p53 in BER by representing a significant diminished BER activity in cells lacking functional p53 (18).
DNA glycosylases are the first enzymes dealing with the frequently occurring base modifications. These enzymes are substrate specific each dealing with a different base lesion. Several studies with different DNA glycosylase-deficient mice have failed to demonstrate strongly increased mutation rates, increased cancer frequencies or other severely altered phenotypes. This may be due to overlap in functions between DNA glycosylases, as well as repair by alternative pathways. On the other hand, other studies reported that cells deficient in N-methylpurine-DNA glycosylase were hypersensitive to various alkylating agents, demonstrating the important role these enzymes play in repairing lethal alkylating damage (5154). Unexpectedly, over-expression of DNA glycosylase did not exert protection from these agents (55). Furthermore, there is evidence that the BER pathway is essential, since deficiencies in the common steps downstream of DNA glycosylase are embryonic lethal (56). Given the strong conservation of these enzymes, it might be that DNA glycosylases function in the long-term integrity of the genome over several generations (20).
In an attempt to better understand the role of p53 in BER, we investigated the influence of a variety of genotoxic stress agents on the activity of 3-MeAde DNA glycosylase. We have shown the involvement of p53 in the regulation of 3-MeAde DNA glycosylase activity by using several cell lines, varying in their p53 status. We found that induction of 3-MeAde DNA glycosylase activity was greatly dependent on the type of genotoxic stress that cells were exposed to. Following
-irradiation we found that cells exhibited an increase in p53 protein levels that was accompanied by an increase in 3-MeAde DNA glycosylase activity. In contrast, exposure of cells to drugs such as doxorubicin and H2O2 caused an increase in p53 protein levels with no change in 3-MeAde DNA glycosylase activity. Treatment of cells with NO caused an early increase in 3-MeAde DNA glycosylase activity that was preceded by an increase in p53 protein levels. Interestingly, once p53 accumulated following NO treatment, it in turn down regulated 3-MeAde DNA glycosylase activity (see Table I). In vivo studies in iNOS knock out mice have also demonstrated an elevation in 3-MeAde DNA glycosylase activity following exposure of cells to endogenous NO species. Furthermore, the observed down-regulation of 3-MeAde DNA glycosylase activity is due to mRNA trans repression mediated by p53.
|
Measuring APE activity following exposure of cells to NO, revealed that APE activity was neither affected by NO nor by the p53 protein. Both low and high doses of NO did not induce elevation in APE activity.
Comparative analysis of the cell cycle pattern following treatment with various genotoxic agents indicated that following treatment of cells with doxorubicin or H2O2 there was an increase in the exit from the cell cycle through apoptosis. This increase seems to be p53 dependent following H2O2 treatment and p53 independent following doxorubicin treatment. On the other hand, treatments that affected 3-MeAde DNA glycosylase activity, namely
-irradiation and NO, showed no increase in p53 dependent apoptosis. This might imply that p53 dependent activation of glycosylase and induction of p53 dependent apoptosis are mutually exclusive pathways that are determined by the type of genotoxic agents that cells are exposed to. Agents that would induce activation of the BER pathway will not draw cells towards apoptosis and vice versa.
As suggested previously, the type of cellular response might be dependent on the type of damage, the dose used, the phase of the cell cycle of the treated cell and might vary from one cell type to the other (2,57,58).
Our results suggest that the effect of p53 on 3-MeAde DNA glycosylase activity is dependent on the stress induced in cells. Furthermore, it demonstrates that p53 regulates the balance between 3-MeAde DNA glycosylase and APE by down- regulating 3-MeAde DNA glycosylase transcription and activity following exposure of cells to NO species. This may prevent the development of a mutator phenotype that might result in accumulation of point mutations, increased genetic instability and cancer susceptibility in tissues exposed to NO species like the areas of inflamed colon in ulcerative colitis (see Figure 10). Ongoing studies are aimed at assessing the influence of alkylating agents on 3-MeAde DNA glycosylase and the influence of different free radical species on the activity of other mammalian DNA glycosylases. Additional work is needed to further explore the cellular mechanisms leading to the critical cellular decisions and the proteins and pathways involved.
|
| Notes |
|---|
3 To whom correspondence should be addressed Email: varda.rotter{at}weizmann.ac.il
* This paper is dedicated to the memory of Dr Dov Schwartz, a dear friend and a great scientific inspiration. ![]()
| Acknowledgments |
|---|
This study was supported in part by a grant from the Israel-USA Binational Science Foundation (BSF). V.R. holds the Norman and Helen Asher Professorial Chair in Cancer Research at the Weizmann Institute.
| References |
|---|
|
|
|---|
- Schwartz,D. and Rotter,V. (1998) p53-dependent cell cycle control: response to genotoxic stress. Semin. Cancer Biol., 8, 325336.[CrossRef][Web of Science][Medline]
- Wahl,G.M. and Carr,A.M. (2001) The evolution of diverse biological responses to DNA damage: insights from yeast and p53. Nature Cell Biol., 3, E277286.[CrossRef][Web of Science][Medline]
- Robles,A.I. and Harris,C.C. (2001) p53-mediated apoptosis and genomic instability diseases. Acta Oncol., 40, 696701.[CrossRef][Web of Science][Medline]
- Schwartz,D., Goldfinger,N., Kam,Z. and Rotter,V. (1999) p53 controls low DNA damage-dependent premeiotic checkpoint and facilitates DNA repair during spermatogenesis. Cell Growth Differ., 10, 665675.
[Abstract/Free Full Text] - Offer,H., Milyavsky,M., Erez,N., Matas,D., Zurer,I., Harris,C.C. and Rotter,V. (2001) Structural and functional involvement of p53 in BER in vitro and in vivo. Oncogene, 20, 581589.[CrossRef][Web of Science][Medline]
- Ford,J.M. and Hanawalt,P.C. (1997) Expression of wild-type p53 is required for efficient global genomic nucleotide excision repair in UV-irradiated human fibroblasts. J. Biol. Chem., 272, 2807328080.
[Abstract/Free Full Text] - Janus,F., Albrechtsen,N., Dornreiter,I., Wiesmuller,L., Grosse,F. and Deppert,W. (1999) The dual role model for p53 in maintaining genomic integrity. Cell Mol. Life Sci., 55, 1227.[CrossRef][Web of Science][Medline]
- Wang,X.W., Yeh,H., Schaeffer,L. et al. (1995) p53 modulation of TFIIH-associated nucleotide excision repair activity. Nature Genet., 10, 188195.[Web of Science][Medline]
- Robles,A.I., Wang,X.W. and Harris,C.C. (1999) Drug-induced apoptosis is delayed and reduced in XPD lymphoblastoid cell lines: possible role of TFIIH in p53-mediated apoptotic cell death. Oncogene, 18, 46814688.[CrossRef][Web of Science][Medline]
- Jayaraman,J. and Prives,C. (1995) Activation of p53 sequence-specific DNA binding by short single strands of DNA requires the p53 C-terminus. Cell, 81, 10211029.[CrossRef][Web of Science][Medline]
- Lee,S., Elenbaas,B., Levine,A. and Griffith,J. (1995) p53 and its 14 kDa C-terminal domain recognize primary DNA damage in the form of insertion/deletion mismatches. Cell, 81, 10131020.[CrossRef][Web of Science][Medline]
- Reed,M., Woelker,B., Wang,P., Wang,Y., Anderson,M.E. and Tegtmeyer,P. (1995) The C-terminal domain of p53 recognizes DNA damaged by ionizing radiation. Proc. Natl Acad. Sci. USA, 92, 94559459.
[Abstract/Free Full Text] - Janus,F., Albrechtsen,N., Knippschild,U., Wiesm ller,L., Grosse,F. and Deppert,W. (1999) Different regulation of the p53 core domain activities 3'-to-5' exonuclease and sequence-specific DNA binding [In Process Citation]. Mol. Cell. Biol., 19, 21552168.
[Abstract/Free Full Text] - Appella,E. and Anderson,C.W. (2000) Signaling to p53: breaking the posttranslational modification code. Pathol. Biol., 48, 227245.[Medline]
- Banin,S., Moyal,L., Shieh,S. et al. (1998) Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science, 281, 16741677.
[Abstract/Free Full Text] - Offer,H., Wolkowicz,R., Matas,D., Blumenstein,S., Livneh,Z. and Rotter,V. (1999) Direct involvement of p53 in the base excision repair pathway of the DNA repair machinery. FEBS Lett., 450, 197204.[CrossRef][Web of Science][Medline]
- Zhou,J., Ahn,J., Wilson,S.H. and Prives,C. (2001) A role for p53 in base excision repair. EMBO J., 20, 914923.[CrossRef][Web of Science][Medline]
- Seo,Y.R., Fishel,M.L., Amundson,S., Kelley,M.R. and Smith,M.L. (2002) Implication of p53 in base excision DNA repair: in vivo evidence. Oncogene, 21, 731737.[CrossRef][Web of Science][Medline]
- Offer,H., Zurer,I., Banfalvi,G., Reha'k,M., Falcovitz,A., Milyavsky,M., Goldfinger,N. and Rotter,V. (2001) p53 modulates base excision repair activity in a cell cycle-specific manner after genotoxic stress. Cancer Res., 61, 8896.
[Abstract/Free Full Text] - Nilsen,H. and Krokan,H.E. (2001) Base excision repair in a network of defence and tolerance. Carcinogenesis, 22, 987998.
[Free Full Text] - Mitra,S., Boldogh,I., Izumi,T. and Hazra,T.K. (2001) Complexities of the DNA base excision repair pathway for repair of oxidative DNA damage. Environ. Mol. Mutagen., 38, 180190.[CrossRef][Web of Science][Medline]
- Nakamura,J. and Swenberg,J.A. (1999) Endogenous apurinic/apyrimidinic sites in genomic DNA of mammalian tissues. Cancer Res., 59, 25222526.
[Abstract/Free Full Text] - Evans,A.R., Limp-Foster,M. and Kelley,M.R. (2000) Going APE over ref-1. Mutat. Res., 461, 83108.[Web of Science][Medline]
- Glassner,B.J., Rasmussen,L.J., Najarian,M.T., Posnick,L.M. and Samson,L.D. (1998) Generation of a strong mutator phenotype in yeast by imbalanced base excision repair. Proc. Natl Acad. Sci. USA, 95, 999710002.
[Abstract/Free Full Text] - Glassner,B.J., Posnick,L.M. and Samson,L.D. (1998) The influence of DNA glycosylases on spontaneous mutation. Mutat. Res., 400, 3344.[Web of Science][Medline]
- Xiao,W. and Samson,L. (1993) In vivo evidence for endogenous DNA alkylation damage as a source of spontaneous mutation in eukaryotic cells. Proc. Natl Acad. Sci. USA, 90, 21172121.
[Abstract/Free Full Text] - Kastan,M.B., Onyekwere,O., Sidransky,D., Vogelstein,B. and Craig,R.W. (1991) Participation of p53 protein in the cellular response to DNA damage. Cancer Res., 51, 63046311.
[Abstract/Free Full Text] - Xia,F., Wang,X., Wang,Y.H., Tsang,N.M., Yandell,D.W., Kelsey,K.T. and Liber,H.L. (1995) Altered p53 status correlates with differences in sensitivity to radiation-induced mutation and apoptosis in two closely related human lymphoblast lines. Cancer Res., 55, 1215.
[Abstract/Free Full Text] - Chen,Y., Chen,P.-L., Arnaiz,N., Goodrich,D. and Lee,W.-H. (1991) Expression of wild-type p53 in human A673 cells suppresses tumorigenicity but not growth rate. Oncogene, 6, 17991805.[Web of Science][Medline]
- Offer,H., Erez,N., Zurer,I., Tang,X., Milyavsky,M., Goldfinger,N. and Rotter,V. (2002) The onset of p53-dependent DNA repair or apoptosis is determined by the level of accumulated damaged DNA. Carcinogenesis, 23, 10251032.
[Abstract/Free Full Text] - Smith,M.L., Chen,I.T., Zhan,Q., O'Connor,P.M. and Fornace,A.J.,Jr (1995) Involvement of the p53 tumor suppressor in repair of u.v.-type DNA damage. Oncogene, 10, 10531059.[Web of Science][Medline]
- Drummond,J.T., Anthoney,A., Brown,R. and Modrich,P. (1996) Cisplatin and adriamycin resistance are associated with MutLalpha and mismatch repair deficiency in an ovarian tumor cell line. J. Biol. Chem., 271, 1964510648.
[Abstract/Free Full Text] - Lage,H. and Dietel,M. (1999) Involvement of the DNA mismatch repair system in antineoplastic drug resistance. J. Cancer Res. Clin. Oncol., 125, 156165.[CrossRef][Web of Science][Medline]
- Jaiswal,M., LaRusso,N.F., Nishioka,N., Nakabeppu,Y. and Gores,G.J. (2001) Human Ogg1, a protein involved in the repair of 8-oxoguanine, is inhibited by nitric oxide. Cancer Res., 61, 63886633.
[Abstract/Free Full Text] - Mates,M. (2000) Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology. Toxicology, 153, 83104.[CrossRef][Medline]
- Hofseth,L.J., Saito,S., Hussain,S.P. et al. (2003) Nitric oxide-induced cellular stress and p53 activation in chronic inflammation. Proc. Natl Acad. Sci. USA, 100, 143148.
[Abstract/Free Full Text] - Nguyen,T., Brunson,D., Crespi,C.L., Penman,B.W., Wishnok,J.S. and Tannenbaum,S.R. (1992) DNA damage and mutation in human cells exposed to nitric oxide in vitro. Proc. Natl Acad. Sci. USA, 89, 30303034.
[Abstract/Free Full Text] - Aloni-Grinstein,R., Zan-Bar,I., Alboum,I., Goldfinger,N. and Rotter,V. (1993) Wild type p53 functions as a control protein in the differentiation pathway of the B-cell lineage. Oncogene, 8, 32973305.[Web of Science][Medline]
- McCafferty,D.M., Miampamba,M., Sihota,E., Sharkey,K.A. and Kubes,P. (1999) Role of inducible nitric oxide synthase in trinitrobenzene sulphonic acid induced colitis in mice. Gut, 45, 864873.
[Abstract/Free Full Text] - Zingarelli,B., Szabo,C. and Salzman,A.L. (1999) Reduced oxidative and nitrosative damage in murine experimental colitis in the absence of inducible nitric oxide synthase. Gut, 45, 199209.
[Abstract/Free Full Text] - Lane,D.P. (1992) p53, guardian of the genome. Nature, 358, 1516.[CrossRef][Medline]
- Bates,S. and Vousden,K.H. (1996) p53 in signaling checkpoint arrest or apoptosis. Curr. Opin. Genet. Dev., 6, 1219.[Medline]
- Kaufmann,W.K. and Paules,R.S. (1996) DNA damage and cell cycle checkpoints. FASEB J., 10, 238247.[Abstract]
- Gottlieb,T.M. and Oren,M. (1998) p53 and apoptosis. Semin. Cancer Biol., 8, 359368.[CrossRef][Web of Science][Medline]
- Levine,J.A. (1997) p53, the cellular gatekeeper for growth and division. Cell, 88, 323331.[CrossRef][Web of Science][Medline]
- Almog,N. and Rotter,V. (1997) Involvement of p53 in cell differentiation and development. Biochim. Biophys. Acta, 1333, F127.[Medline]
- Seluanov,A., Gorbunova,V., Falcovitz,A., Sigal,A., Milyavsky,M., Zurer,I., Shohat,G., Goldfinger,N. and Rotter,V. (2001) Change of the death pathway in senescent human fibroblasts in response to DNA damage is caused by an inability to stabilize p53. Mol. Cell. Biol., 21, 15521564.
[Abstract/Free Full Text] - Loeb,L.A. (1994) Microsatellite instability: marker of a mutator phenotype in cancer. Cancer Res., 54, 50595063.
[Free Full Text] - Smith,M.L., Ford,J.M., Hollander,M.C., Bortnick,R.A., Amundson,S.A., Seo,Y.R., Deng,C.X., Hanawalt,P.C. and Fornace,A.J.,Jr (2000) p53-mediated DNA repair responses to UV radiation: studies of mouse cells lacking p53, p21 and/or gadd45 genes. Mol. Cell. Biol., 20, 37053714.
[Abstract/Free Full Text] - Hollander,M.C., Kovalsky,O., Salvador,J.M., Kim,K.E., Patterson,A.D., Haines,D.C. and Fornace,A.J.,Jr (2001) Dimethylbenzanthracene carcinogenesis in Gadd45a-null mice is associated with decreased DNA repair and increased mutation frequency. Cancer Res., 61, 24872491.
[Abstract/Free Full Text] - Engelward,B.P., Dreslin,A., Christensen,J., Huszar,D., Kurahara,C. and Samson,L. (1996) Repair-deficient 3-methyladenine DNA glycosylase homozygous mutant mouse cells have increased sensitivity to alkylation-induced chromosome damage and cell killing. EMBO J., 15, 945952.[Web of Science][Medline]
- Allan,J.M., Engelward,B.P., Dreslin,A.J., Wyatt,M.D., Tomasz,M. and Samson,L.D. (1998) Mammalian 3-methyladenine DNA glycosylase protects against the toxicity and clastogenicity of certain chemotherapeutic DNA cross-linking agents. Cancer Res., 58, 39653973.
[Abstract/Free Full Text] - Posnick,L.M. and Samson,L.D. (1999) Imbalanced base excision repair increases spontaneous mutation and alkylation sensitivity in Escherichia coli. J. Bacteriol., 181, 67636771.
[Abstract/Free Full Text] - Sobol,R.W., Watson,D.E., Nakamura,J. et al. (2002) Mutations associated with base excision repair deficiency and methylation-induced genotoxic stress. Proc. Natl Acad. Sci. USA, 99, 68606865.
[Abstract/Free Full Text] - Ibeanu,G., Hartenstein,B., Dunn,W.C., Chang,L.Y., Hofmann,E., Coquerelle,T., Mitra,S. and Kaina,B. (1992) Overexpression of human DNA repair protein N-methylpurine-DNA glycosylase results in the increased removal of N-methylpurines in DNA without a concomitant increase in resistance to alkylating agents in Chinese hamster ovary cells. Carcinogenesis, 13, 19891995.
[Abstract/Free Full Text] - Friedberg,E.C. and Meira,L.B. (2000) Database of mouse strains carrying targeted mutations in genes affecting cellular responses to DNA damage. Version 4. Mutat. Res., 459, 243274.[Web of Science][Medline]
- Vogelstein,B., Lane,D. and Levine,A.J. (2000) Surfing the p53 network. Nature, 408, 307310.[CrossRef][Medline]
- Bates,S. and Vousden,K.H. (1999) Mechanisms of p53-mediated apoptosis. Cell. Mol. Life Sci., 55, 2837[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
D.-Q. Li, S. Divijendra Natha Reddy, S. B. Pakala, X. Wu, Y. Zhang, S. K. Rayala, and R. Kumar MTA1 Coregulator Regulates p53 Stability and Function J. Biol. Chem., December 11, 2009; 284(50): 34545 - 34552. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Kassam and A. J. Rainbow UV-inducible base excision repair of oxidative damaged DNA in human cells Mutagenesis, January 1, 2009; 24(1): 75 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Morgenroth, S. Deisenhofer, G. Glatting, F. H-G. Kunkel, C. Dinger, B. Zlatopolskiy, A. T.J. Vogg, T. Kull, and S. N. Reske Preferential Tumor Targeting and Selective Tumor Cell Cytotoxicity of 5-[131/125I]Iodo-4'-Thio-2'-Deoxyuridine Clin. Cancer Res., November 15, 2008; 14(22): 7311 - 7319. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Koll, S. S. Feis, M. H. Wright, M. M. Teniola, M. M. Richardson, A. I. Robles, J. Bradsher, J. Capala, and L. Varticovski HSP90 inhibitor, DMAG, synergizes with radiation of lung cancer cells by interfering with base excision and ATM-mediated DNA repair Mol. Cancer Ther., July 1, 2008; 7(7): 1985 - 1992. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhang, Y. Liu, J. Zhou, W. Chen, Y. Zhang, and H. L. Liber Wild-type p53 reduces radiation hypermutability in p53-mutated human lymphoblast cells Mutagenesis, September 1, 2007; 22(5): 329 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chen, Z. Yu, Z. Zhu, and C. D. Lopez The p53 Pathway Promotes Efficient Mitochondrial DNA Base Excision Repair in Colorectal Cancer Cells. Cancer Res., April 1, 2006; 66(7): 3485 - 3494. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Cook, Z. Wang, S. Alber, K. Liu, S. C. Watkins, Y. Vodovotz, T. R. Billiar, and D. Blumberg Nitric Oxide and Ionizing Radiation Synergistically Promote Apoptosis and Growth Inhibition of Cancer by Activating p53 Cancer Res., November 1, 2004; 64(21): 8015 - 8021. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














