Skip Navigation


Carcinogenesis Advance Access originally published online on October 10, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/1/123    most recent
bgg187v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kang, C.-M.
Right arrow Articles by Lee, Y.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, C.-M.
Right arrow Articles by Lee, Y.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 25, No. 1, 123-132, January 2004
© Oxford University Press; all rights reserved


CARCINOGENESIS

Alteration of gene expression during radiation-induced resistance and tumorigenesis in NIH3T3 cells revealed by cDNA microarrays: involvement of MDM2 and CDC25B

Chang-Mo Kang*, Hye-Nyun Cho*, Joo-Mee Ahn, Seung-Sook Lee1, Doo-Il Jeoung2, Chul-Koo Cho, Sangwoo Bae, Su-Jae Lee and Yun-Sil Lee3

Laboratory of Radiation Effect and 1 Laboratory of Experimental Pathology, Korea Institute of Radiological and Medical Sciences, 215-4 Gongneung-Dong, Nowon-Ku, Seoul 139-706, South Korea and 2 Division of Life Sciences, Kangwon National University College of Natural Sciences, 192-1 Hyoja 2-dong, Chuncheon-Si, Kangwon-do 200-701, South Korea


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
To identify a set of genes involved in the development of radiation-induced tumorigenesis, we used DNA microarrays consisting of 1176 mouse genes and compared expression profiles of radioresistant cells, designated NIH3T3-R1 and NIH3T3-R4. These cells were tumorigenic in a nude mouse grafting system, as compared with the parental NIH3T3 cells. Expression of MDM2, CDK6 and CDC25B was found to increase more than 3-fold. Entactin protein levels were down-regulated in NIH3T3-R1 and NIH3T3-R4 cells. Changes in gene expression were confirmed by reverse transcription–PCR or western blotting. When these genes were transfected into NIH3T3 cells, CDC25B and MDM2 overexpressing NIH3T3 cells showed radioresistance, while CDK6 overexpressing cells did not. In the case of entactin, overexpressing NIH3T3-R1 and NIH3T3-R4 cells were still radioresistant. Furthermore, CDC25B and MDM2 overexpressing cells grafted into nude mice were tumorigenic. NIH3T3-R1 and NIH3T3-R4 cells showed increased radiation-induced apoptosis accompanied by a faster growth rate, rather than an earlier radiation-induced G2/M phase arrest, suggesting that the radioresistance of NIH3T3-R1 and NIH3T3-R4 cells was due to a faster growth rate rather than induction of apoptosis. In the case of MDM2 and CDC25B overexpressing cells, similar phenomena, such as increased apoptosis and a faster growth rate, were shown. The above results, therefore, demonstrate involvement of CDC25B and MDM2 overexpression in radiation-induced tumorigenesis and provide novel targets for detection of radiation-induced carcinogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Ionizing radiation is a well-established environmental mutagen and carcinogen. Several in vitro studies have shown that ionizing radiation produces a variety of genetic lesions, including deletions, rearrangements and point mutations (1). There exists a clear dose–response interrelationship among radiation-induced cell inactivation, chromosomal rearrangements and mutagenesis. A question arises whether such interrelationships are valuable in understanding mechanisms of radiation carcinogenesis. There is an extensive research effort directed towards developing in vitro cellular systems that can describe events associated with radiation-induced oncogenic transformation. In some established cell lines, neoplastic transformation can be induced by various agents, including some chemicals and radiation, and such transformed cells can induce tumors when grafted into the animal from which they were originally derived or when transplanted into immunologically compatible hosts. Transformed cells in vitro usually display characteristics such as loss of anchorage dependence and contact inhibition and changes at the DNA level (2). However, the exact mechanisms and the genes involved are not well characterized.

These mechanisms have been under intensive study for the last two decades. At the molecular level, activation of oncogenes (3,4) and inactivation of tumor suppressor genes (4,5) have been known to be involved in radiation-induced carcinogenesis, together with abrogation of the DNA mismatch repair systems (6). Nevertheless, the exact mechanism of how these genetic alterations bring about the development and progression of radiation-induced carcinogenesis remains largely unclear. To further complicate the picture, accumulation of mutant genes in neoplasia tends to be accompanied by other genetic and epigenetic changes, including loss of heterozygosity, inactivation of important genes by methylation or loss of imprinting and gene amplification, all of which can alter gene expression profiles. Therefore, genome-wide monitoring of gene expression is of great importance if we are to delineate the numerous and diverse events associated with carcinogenesis. In the present study, using microarray analysis, we identified genes from radioresistant cell lines that showed tumorigenesis in a nude mouse grafting system.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation of resistant cells
NIH3T3 cells (5 x 106) were plated in 10 cm dishes and irradiated with 4 Gy on the following day. Three days later, irradiated or control cells were trypsinized and viable cells (5 x 106) were again irradiated with 4 Gy. These procedures were repeated 24 times (for 6 months). After the last irradiation, resistant colonies were selected.

Transfection
Control NIH3T3 cells or resistant clones (NIH3T3-R1 and NIH3T3-R4) were cultured in Dulbecco's minimal essential medium (Gibco, Gaithersburg, MD) supplemented with heat-inactivated 10% fetal bovine serum (Gibco) and antibiotics at 37°C in a humidified incubator with a mixture of 95% air and 5% CO2. Transformant clones were obtained from stable transfection with MDM-2 or CDC25B, which were obtained from Drs D.Y.Shin (Dankook University, Cheon-an, Korea) (7) and J.W.Soh (Columbia University, New York, NY) (8), respectively.

Irradiation
Cells were plated in 10 cm dishes and incubated at 37°C under humidified 5% CO2, 95% air in culture medium until 70–80% confluent. Cells were then exposed to {gamma}-rays from a 137Cs {gamma}-ray source (Atomic Energy of Canada Ltd, Canada and located in Institute, Seoul, Korea) at a dose rate of 3.81 Gy/min.

Colony-forming assay
Clonogenicity was examined by a colony-forming assay, as described previously (9,10). Cells were seeded into 6 cm Petri dishes at densities to produce ~500 colonies/dish in the controls and were incubated for 7–14 days. Colonies were fixed with a mixture of 75% methanol and 25% acetic acid and stained with 0.4% trypan blue. The number of colonies consisting of 50 or more cells was scored.

Cell viability assay
Cell viability was determined by the MTT assay (11). Cells in the exponential phase were collected and were transferred into each well after irradiation (~104–105 cells in 180 µl/well). The cells were incubated for the indicated times in the presence of 50 µl of 2 mg/ml MTT solution (0.1 mg/well). After incubating for an additional 4 h, the plates were centrifuged at 800 g for 5 min and the supernatants were aspirated. The formazan crystals in each well were dissolved in 150 µl of DMSO and A540 was read on a scanning multiwell spectrophotometer (Molecular Device Co., Sunnyvale, CA). All experiments were performed in triplicate. Cell viability was also measured by trypan blue exclusion.

Detection of apoptosis
DNA fragmentation
Cells were grown in a 10 cm dish and treated with radiation when they were 70–80% confluent. Both detached and attached cells were harvested by scraping and centrifuging. The cells were then lysed with lysis buffer (5 mM Tris–HCl, pH 8.0, 20 mM EDTA, 0.5% Triton X-100) on ice for 45 min. Fragmented DNA in the supernatant following centrifugation at 14 000 r.p.m. (45 min at 4°C) was extracted twice with phenol/chloroform/isopropanol (25:24:1 v/v) and once with chloroform and then precipitated with ethanol and 5 M NaCl. The DNA pellet was washed once with 70% ethanol and resuspended in Tris–EDTA buffer (pH 8.0) containing 100 µg/ml RNase and incubated at 37°C for 2 h. The DNA fragments were separated by 1.8% agarose gel electrophoresis.

Flow cytometry
Cells were cultured, harvested at the indicated times and fixed in 1 ml of 70% ethanol (1 x 106 cells/sample) for 30 min at 4°C. Cells were then washed twice with phosphate-buffered saline (PBS) and incubated in the dark for 30 min at 37°C in 1 ml of PBS containing 100 µg propidium iodide (PI) and 100 µg RNase A. Flow cytometric analysis was performed with a FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ). The effect on apoptosis was evaluated as the increase in the proportion of sub-G1 hypodiploid cells (12).

Annexin V staining
Cells were cultured, harvested at the indicated times and stained with FITC-conjugated Annexin V (Pharmingen) and PI according to the manufacturer's protocol. Cells were then analyzed with a FACScan flow cytometer.

Cell cycle analysis
For cell cycle analysis, cells were fixed in 80% ethanol for at least 18 h at 4°C. The fixed cells were then washed once with PBS containing EDTA and resuspended in 1 ml of PBS. After the addition of 10 µl each of PI (5 mg/ml) and RNase (10 mg/ml), the samples were incubated for 30 min at 37°C and analyzed with a FACScan flow cytometer.

Nude mouse grafting
Cells (1 x 106 cells) were transferred to a grafting chamber and surgically implanted on the back of Balb/c nude mice (13). The chamber was removed 1 week after grafting and tumor development was examined.

Histological staining
Six weeks after grafting, tumors were removed and cut into 5 µm thick sections. Tissue blocks were fixed in 10% neutral buffered formalin adjusted to pH 7.4 and embedded in paraffin. Serial sections were prepared and each of three adjacent sections was stained with hematoxylin and eosin.

cDNA array sample preparation and cDNA expression array
Total RNA was isolated from the parent NIH3T3 cells and NIH3T3-R1 and NIH3T3-R4 cells with TRITM reagent (MRC, Cincinnati, OH) according to the manufacturer's instruction and 33P-labeled cDNAs were synthesized by reverse transcription. For array hybridization, a mouse cDNA microarray filter (Atlas Mouse Arrays membraneTM, 1176 genes; Clontech) was used. Array analysis was performed using a kit purchased from Clontech, according to the manufacturer's method.

RT–PCR
cDNA was generated using 1 µg of total RNA isolated from control NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells as templates for 2.5 mM oligo(dT) primers, in a 20 µl reaction mixture, and reverse transcription was carried out at 37°C for 1 h, followed by 95°C for 10 min using the GeneAmp RNA PCR Core kit (Perkin-Elmer, Branchburg, NJ). Aliquots of 2 µl of cDNA were amplified in a 20 µl PCR reaction mixture containing 1x PCR buffer, 2 mM MgCl2, 0.5 µM primers, 0.25 mM each deoxynucleotide triphosphate and 1 U ExTaq DNA polymerase, as follows: 95°C for 5 min, followed by 30 cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C and 1 min extension at 72°C. Finally, PCR products were fully extended by incubation at 72°C for 5 min. The PCR reagents were purchased from Perkin-Elmer. The primer sequences were sense CGTGGTCAGGTTGTTTGATG and antisense TGCGAAACATTTCTGCAAAG for CDK6, sense TGGCGTAAGTGAGCATTCTG and antisense GAAGCCAGTTCTCACGAAGG for MDM2, sense GACAGCTGGAGGAAAACTGA and antisense ATCACTCTCCAGGATGTCCA for CDC25B, and sense CCAGCTTAGGCAAGGTCATA and antisense GAGCTCCAGATGACTCTCCA for entactin.

Polyacrylamide gel electrophoresis and western blot
Cells were solubilized with lysis buffer (120 mM NaCl, 40 mM Tris, pH 8.0, 0.1% NP40), the samples were boiled for 5 min and equal amounts of protein (40 µg/well) were analyzed on 7.5–10% SDS–PAGE. After electrophoresis, proteins were transferred to a nitrocellulose membrane and processed for immunoblotting. For the detection of CDK6, CDC25B and MDM2, blots were incubated with 1:1000 dilution rabbit polyclonal or monoclonal antibodies (Santa Cruz) and further incubated with horseradish peroxidase- conjugated secondary antibody diluted at 1:5000 and specific bands were visualized by chemiluminescence (Amersham International). Autoradiographs were recorded onto X-Omat AR films (Eastman Kodak Co.).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Selection of radiation-resistant clones from NIH3T3 cells
NIH3T3 cells were irradiated twice per week for 6 months with 4 Gy and seven resistant clones were selected. When an in vitro clonogenic survival assay was performed, NIH3T3-R1 and NIH3T3-R4 cells showed the most radioresistance, whereas the rest of the clones showed only slightly higher radioresistance than parental NIH3T3 cells (Figure 1A). When cellular growth after radiation was examined by the trypan blue dye exclusion method, NIH3T3-R1 and NIH3T3-R4 cells showed increased growth rate on irradiation, when compared with the control NIH3T3 cells (Figure 1B).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Selection of radiation-resistant clones from NIH3T3 cells. (A) The surviving fraction of NIH3T3 and seven radioresistant cells were obtained by colony-forming assay after irradiation. The error bar indicates mean ± SD from three independent experiments. NIH3T3-R1 and NIH3T3-R4 cells showed the highest radioresistancy, compared with the parent NIH3T3 cells. (B) Cells (~104–105) in exponential phase were collected and after irradiation were incubated for the indicated times. At each time point, viable cells were counted by the trypan blue dye exclusion method. *, NIH3T3-R1 and NIH3T3-R4 were significantly different from NIH3T3 control cells at P < 0.05.

 
Tumorigenesis of radiation-resistant clones when grafted into nude mice
To elucidate the relationship between cells surviving after repeated radiation treatments and tumorigenesis, control NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells were grafted onto nude mice. Examination of tumorigenesis revealed that the parental NIH3T3 cells did not show any tumors, while the resistant clones, NIH3T3-R1 and NIH3T3-R4, induced tumors. Figure 2A shows the tumor burden in NIH3T3-R1 and NIH3T3-R4 after 6 weeks of grafting. Histological examination also suggested that tumor sections from NIH3T3-R1 and NIH3T3-R4 grafted mice showed characteristic tumor morphology; clear cells (B), an increased apoptotic body (C), giant cells (polynuclear cells) (D) and necrosis (E) (Figure 2B).



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2. Tumorigenesis of radiation-resistant clones, when grafted onto nude mice. (A) Cells (1 x 106) were transferred to a grafting chamber and surgically implanted on the back of Balb/c nude mice. The chamber was removed 1 week after grafting and tumor development was examined. (B) Six weeks after grafting, tumors were removed and cut into 5 µm thick sections. Tissue blocks were fixed in 10% neutral buffered formalin adjusted to pH 7.4 and embedded in paraffin. Serial sections were prepared and each of three adjacent sections was stained with hematoxylin and eosin. (A) Normal skin of NIH3T3 cell grafted mouse. (B–E) Tumors from NIH3T3-R1 or NIH3T3-R4 grafted mouse (B), an increased apoptotic body (C), giant cells (polynuclear cells) (D) and necrosis (E).

 
Altered gene expression, revealed by microarray, in radiation-resistant clones
We used cDNA expression array hybridization to identify genes that were differentially expressed in radioresistant NIH3T3 clones. For a comparison of the autoradiographic intensities, two radioresistant clones, NIH3T3-R1 and NIH3T3-R4, were selected for cDNA array analysis. The genes CDK6, MDM2, CDC25B and entactin showed alterations in expression in both radioresistant clones (3.5-, 4.3- and 3.7-fold increases and a 1.6-fold decrease, respectively), NIH3T3-R1 and NIH3T3-R4. After cDNA expression array hybridization we performed RT–PCR analysis, to further validate the cDNA array approach. As seen in Figure 3A, four genes, including CDK6, CDC25B, MDM2 and nidogen-1 (entactin), were selected. Western blot analyses for MDM2, CDC25B and CDK6 were consistent with the results of the cDNA hybridization array and RT–PCR (Figure 3B). Furthermore, in situ immunocytochemical analyses revealed increased expression of CDK6, MDM2 and CDC25B proteins; CDK6 and CDC25B proteins were slightly expressed in the cytosol of normal NIH3T3 cells, but increased amounts of protein were detected in the resistant clones. In the case of MDM2, nuclear expression was found in normal NIH3T3 cells and increased nuclear protein expression was observed in the resistant clones (data not shown).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. Altered gene expression in radiation-resistant clones, revealed by microarray. (A) cDNA was generated using 1 µg of total RNA from control NIH3T3 cells, NIH3T3-R1 and NIH3T3-R4 cells as template for oligo(dT) primers and reverse transcription was carried out. (B) Protein extracts (60 µg) of the parent NIH3T3 cells, NIH3T3-R1 and NIH3T3-R4 cells were prepared, separated by SDS–PAGE and analyzed by western blotting for MDM2, CDK6 and CDC25B levels.

 
MDM2 or CDC25B, but not CDK6 or entactin, overexpression induces radioresistance in NIH3T3 cells
To elucidate which genes were possibly involved in radioresistance, the MDM2, CDC25B and CDK6 genes were overexpressed in parental NIH3T3 cells, while entactin was overexpressed in NIH3T3-R1 and NIH3T3-R4. Three clones overexpressing each gene, showing similar expression levels, were selected and examined for their radiosensitivity, using clonogenic survival. As shown in Figure 4, overexpression of each gene was observed in selected clones, detected by RT–PCR and western blot analysis. When entactin was overexpressed in NIH3T3-R1 and NIH3T3-R4 cells, radioresistance was still observed (Figure 4A). Similarly, when CDK6 was overexpressed in NIH3T3 cells, the radiosensitivity of the parental NIH3T3 cells did not change (Figure 4B). On the other hand, when MDM2 or CDC25B was overexpressed in NIH3T3 cells, the radiosensitivity of NIH3T3 cells changed: these cells became radioresistant, similar to NIH3T3-R1 and NIH3T3-R4 (Figure 4C and D). These data suggest that MDM2 and CDC25B were responsible for the radioresistance of NIH3T3-R1 and NIH3T3-R4.




View larger version (89K):
[in this window]
[in a new window]
 
Fig. 4. Generation of cells overexpressing MDM2, CDC25B, CDK6 or entactin and detection of radioresistance. (A) (Upper) cDNA was generated using 1 µg of total RNA from control NIH3T3, NIH3T3-R1 or NIH3T3-R4 cells or three clones of NIH3T3-R1 or NIH3T3-R4 cells overexpressing entactin. (Lower) The surviving fraction was obtained by colony-forming assay after irradiation. (B) (Upper) cDNA was generated using 1 µg of total RNA from control NIH3T3, NIH3T3-R1 or NIH3T3-R4 cells or three clones of NIH3T3 cells overexpressing CDK6. (Lower) The surviving fraction was obtained by colony-forming assay after irradiation. (C) (Upper) cDNA was generated using 1 µg of total RNA from control NIH3T3, NIH3T3-R1 or NIH3T3-R4 cells or three clones of NIH3T3 cells overexpressing MDM2. (Lower) The surviving fraction was obtained by colony-forming assay after irradiation. (D) (Upper) cDNA was generated using 1 µg of total RNA from control NIH3T3, NIH3T3-R1 or NIH3T3-R4 cells or three clones of NIH3T3 cells overexpressing CDC25B. (Lower) The surviving fraction was obtained by colony-forming assay after irradiation. Error bar indicates mean ± SD from three independent experiments. *, Significantly different from NIH3T3 control cells at P < 0.05.

 
MDM2 or CDC25B overexpression in parental NIH3T3 cells induces tumorigenesis when grafted into nude mice
To determine whether radioresistance of cells overexpressing MDM2 or CDC25B was involved in tumorigenesis, these cells were grafted onto nude mice. After 6 weeks, NIN3T3-R1 and NIH3T3-R4 cells showed tumorigenesis, while the parental NIH3T3 cells did not. In addition, three clones each overexpressing MDM2 or CDC25B also showed tumorigenesis (Figure 5), thus suggesting that MDM2 or CDC25B overexpression in NIH3T3-R1 and NIH3T3-R4 was involved in NIH3T3-R1- and NIH3T3-R4-mediated tumorigenesis. When grafted, tumorigenesis was not observed in CDK6 overexpressing NIH3T3 cells (data not shown).



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 5. Tumorigenesis of MDM2 or CDC25B overexpression in parental NIH3T3 cells. Cells (1 x 106) were transferred to a grafting chamber and surgically implanted on the back of Balb/c nude mice. The chamber was removed 1 week after grafting and tumor development was examined. (A) MDM2 overexpressing cells. (B) CDC25B overexpressing cells.

 
NIH3T3-R1 and NIH3T3-R4 showed increased radiation-induced apoptosis
Since NIH3T3-R1 and NIH3T3-R4 cells were radioresistant, we examined whether this phenomenon was related to apoptosis. Interestingly, all the data, including DNA laddering, Annexin V staining and sub-G1 analysis indicated that NIH3T3-R1 and NIH3T3-R4 had increased radiation-induced apoptosis (Figure 6).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 6. Radiation-induction of apoptosis in NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells. (A) NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells were irradiated with 10 Gy at the indicated times, after which protein was lysed in lysis buffer, followed by incubation with RNase and finally with proteinase K. This method extracted only fragmented DNA. The DNA was separated by electrophoresis in 1.5% agarose gels and stained with ethidium bromide. (B) Cells were cultured, harvested at the indicated times and stained with FITC-conjugated Annexin V and PI and then analyzed by FACScan flow cytometry. (C) Cells were cultured, harvested at the indicated times and fixed in 70% ethanol. After washing, the cells were incubated in PBS containing 100 µg PI and 100 µg RNase A for 30 min at 37°C. Flow cytometric analysis was performed with a FACScan flow cytometer.

 
NIH3T3-R1 and NIH3T3-R4 showed increased growth rate and earlier radiation-induced G2/M arrest
Because of the inconsistency between radioresistance and increased radiation-induced apoptosis in NIH3T3-R1 and NIH3T3-R4, cell growth was studied using the cell counting trypan blue dye exclusion method. As seen in Figure 7A, the cell cycle times of NIH3T3-R1 and NIH3T3-R4 were faster than the control NIH3T3 cells and NIH3T3-R1 was faster than NIH3T3-R4. When doubling time was examined, it was 2.7-fold faster in NIH3T3-R1 and 1.9-fold faster in NIH3T3-R4 compared with parental cells. When surviving colonies of the parental NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells were examined 2 weeks after seeding, increased proliferation was found for NIH3T3-R1 and NIH3T3-R4, compared with the parental cells, with NIH3T3-R1 growing faster than NIH3T3-R4 (Figure 7B). Irradiation (5 Gy) induced G2/M cell cycle arrest from 6 h and peaked at 12 h in the NIH3T3 parental cells, however, earlier G2/M arrest was obvious in the case of NIH3T3-R1 and NIH3T3-R4: it peaked at 6 h after irradiation (Figure 7C). Changes in levels of cell cycle proteins, such as cyclin A and cyclin B, which regulate the G2/M transition, were also detected at an earlier time point in NIH3T3-R1 and NIH3T3-R4 than in the parental NIH3T3 cells (Figure 7D), thus demonstrating faster cell growth and radiation-induced G2/M arrest of tumorigenic clones NIH3T3-R1 and NIH3T3-R4.




View larger version (77K):
[in this window]
[in a new window]
 
Fig. 7. Growth rate of NIH3T3-R1 and NIH3T3-R4 cells and radiation-induced G2/M arrest. (A) Growth curves for NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells. Cell were incubated for the indicated times. At each time, viable cells were counted by the trypan blue dye exclusion method. (B) Five hundred NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells were plated in 6 cm dishes and, colonies were stained with trypan blue dye 10 or 12 days later. (C) Clonogenic survival of NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells after irradiation at the indicated doses with or without 200 µM mimosine treatment. (D) NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells were harvested following incubation for the periods indicated after 5 Gy radiation and cell cycle distribution was analyzed with a flow cytometer after staining with PI. (E) At the indicated time intervals after 5 Gy irradiation, protein extracts (60 µg) of NIH3T3-R1 and NIH3T3-R4 cells were prepared, separated by SDS–PAGE, and analyzed by western blotting for cyclin A, cyclin B and p21. Cell lysates (200 µg) were immunoprecipitated (IP) with anti-cyclin A or anti-cyclin B1 antibodies and kinase activity was assayed using histone H1 as substrate.

 
MDM2 and CDC25B overexpressing cells exhibited similar patterns of induction of apoptosis to the tumorigenic clones (NIH3T3-R1 and NIH3T3-R4)
Because NIH3T3-R1 and NIH3T3-R4 revealed increased apoptosis compared with the parental NIH3T3 cells, we examined the induction of apoptosis in MDM2 and CDC25B overexpressing NIH3T3 cells. As shown in Figure 8, the number of sub-G1 cells was higher in MDM2 and CDC25B overexpressing clones, whose patterns were similar to those of NIH3T3-R1 and NIH3T3-R4.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 8. Apoptosis pattern of MDM2 or CDC25B overexpressing NIH3T3 cells. Cells were cultured, harvested at the indicated times and fixed in 70% ethanol. After washing, the cells were incubated in PBS containing 100 µg PI and 100 µg RNase A for 30 min at 37°C. Flow cytometric analysis was performed with a FACScan flow cytometer.

 
MDM2 and CDC25B overexpression increases growth rate and earlier radiation-induced G2/M arrest
We also checked growth rate and radiation-induced cell cycle distribution. When MDM2 or CDC25B was overexpressed in NIH3T3 cells, growth rate was increased compared with the parental NIH3T3 cells, and the patterns were similar to those of NIH3T3-R1 and NIH3T3-R4 cells; MDM2 overexpressing cells showed a pattern more similar to NIH3T3-R1 and NIH3T3-R4 and growth rate was also faster in MDM2 overexpressing clones than in CDC25B overexpressing clones (Figure 9A). A faster G2/M arrest was also found in CDC25B and MDM2 overexpressing clones, with similar patterns to those found in NIH3T3-R1 and NIH3T3-R4. MDM2 overexpressing clones were more similar to NIH3T3-R1 and NIH3T3-R4 (Figure 9B) than to the parental NIH3T3 cells.




View larger version (35K):
[in this window]
[in a new window]
 
Fig. 9. Growth rate and radiation-induced G2/M phase arrest of MDM2 and CDC25B overexpressing NIH3T3 cells. (A) Growth curves for NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells. Cells were incubated for the indicated times. At each time point, viable cells were counted by the trypan blue dye exclusion method. (B) NIH3T3, NIH3T3-R1 and NIH3T3-R4 cells were harvested following incubation for the periods indicated after 5 Gy radiation and cell cycle distribution was analyzed with a flow cytometer after staining with PI.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In the present study we have identified four genes, CDK6, CDC25B, MDM2 and entactin, whose expression was altered in radiation-resistant NIH3T3 cells. Since these cells induced tumorigenesis, it is highly likely that alterations in expression of these genes are involved in tumor generation.

There are very few published studies on radiation-induced transformation and tumorigenesis. Hei et al. (14) reported that human bronchial epithelial cells immortalized by viral antigen were transformed to the malignant state by a single exposure to radon-stimulated {alpha}-particles. Similarly, it has been demonstrated that human keratinocytes, immortalized by a combination of DNA tumor viral antigens, were transformed by two or more exposures to {gamma}-radiation (15) or by a single exposure to fission neutrons (16). Riches et al. (17) reported that malignant transformation of SV40 virus-immortalized human thyroid cells after a single exposure to {gamma}-irradiation and Wazer et al. (18) successfully transformed a finite lifespan human mammary cell line to malignant by repeated exposures to ionizing radiation. In our system, we selected two radioresistant NIH3T3 clones (NIH3T3-R1 and NIH3T3-R4) after repeated irradiation (Figure 1). Parental NIH3T3 cells did not show any tumorigenicity when grafted onto nude mice, while two radioresistant clones did, indicating that repeated radiation-induced gene alterations resulted in radiation-induced tumorigenesis (Figure 2).

Gene expression profiling can significantly increase our understanding of the mechanisms and pathways that regulate the transition from the normal to the tumor state. The advantage of cDNA microarray technology is that it is possible to analyze thousands of genes simultaneously. Seven genes were 5-fold overexpressed in both NIH3T3-R1 and NIH3T3-R4 cells, and these were MDM2, CDK6, CDC25B, secreted phosphoprotein, procollagen type III, CD-2 and associated protein. On the other hand, entactin was 2-fold underexpressed in both of the resistant cells, compared with parental NIH3T3 cells (Figure 3). When MDM2, CDK6 or CDC25B was overexpressed in NIH3T3 parental cells and entactin in tumorigenic clones of NIH3T3-R1 and NIH3T3-R4, radioresistance was found only in cells overexpressing MDM2 and CDC25B. In the case of CDK6 and entactin, there was no difference found in a clonogenic cell survival assay (Figure 4). Next, experiments were performed to answer the question of whether MDM2 and CDC25B overexpression was responsible for tumorigenesis. Thus, cells overexpressing MDM2 or CDC25B were grafted onto nude mice and tumorigenesis was examined. After 6 weeks of 1 x 106 cells/mouse, cells overexpressing MDM2 and CDC25B showed tumorigenesis at the same level as tumorigenic radioresistant cells (NIH3T3-R1 and NIH3T3-R4) (Figure 5).

MDM2 is an oncoprotein that is deregulated in tumors and has transfoming properties. Between 5 and 10% of human tumors overexpress MDM2, due to gene amplification or increased transcription and translation (19), and MDM2 overexpression confers tumorigenic properties upon fibroblasts (20), immortalizes primary rat embryo fibroblasts and transforms them in the presence of Ras (21). The major function of MDM2 is to inhibit the activity of p53 tumor suppressor. However, p53 gene mutation and MDM2 gene amplification do not occur in the same tumors (22). In NIH3T3-R1 and NIH3T3-R4 mutation of the p53 gene was not detected (data not shown), suggesting that they are independently regulated.

CDC25B is a cell cycle-related gene and its product is a phosphatase that catalyzes the removal of inhibitory phosphate from the CDK family of proteins (23). CDC25B protein can dephosphorylate threonine 14, tyrosine 14 or both on CDKs, thereby activating cyclin/CDK complexes to stimulate cell proliferation (24). In vitro transfoming experiments have demonstrated that CDC25B is also a potential oncogene (25) and overexpression of CDC25B has been found in cancers arising from breast, stomach, lung and head and neck.

Our data described in the present study uncovered a discrepancy. The tumorigenic and radioresistant clones NIH3T3-R1 and NIH3T3-R4 showed both MDM2 and CDC25B overexpression, however, their overexpression was shown to induce apoptosis, suggesting that the radioresistance of NIH3T3-R1 and NIH3T3-R4 was not due to a reduction in apoptosis (Figure 6). Since a clonogenic survival assay revealed cell death and growth delay, we examined the growth rate of radioresistant NIH3T3-R1 and NIH3T3-R4 cells by the trypan blue dye exclusion method and found a 2- or 3-fold increased growth rate and increased colony numbers in NIH3T3-R1 and NIH3T3-R4 cells, when compared with NIH3T3 parent cells. Synchronization with mimosine treatment, which induces G1 cell cycle arrest, eliminated the radioresistance of NIH3T3-R1 and NIH3T3-R4 cells, suggesting that the faster growth of NIH3T3-R1 and NIH3T3-R4 cells contributed to their radioresistance (Figure 7). In fact, greater radiation-induced earlier G2/M phase arrest and G2/M phase cell cycle-related protein expression were observed in NIH3T3-R1 and NIH3T3-R4 cells than in the parental NIH3T3 cells. Of course, NIH3T3-R1 and NIH3T3-R4 cells induced more apoptosis than the parental NIH3T3 cells, nevertheless, our hypothesis states that a faster growth rate exceeded apoptosis, resulting in an increased number of cells. When we overexpressed MDM2 and CDC25B in the parental NIH3T3 line, they induced tumorigenesis, and these cells also showed increased apoptosis (Figure 8) and a faster cell growth rate (Figure 9). These patterns were similar to those of NIH3T3-R1 and NIH3T3-R4 cells.

There are inconsistencies between radiosensitivity and MDM2 expression, which showed potent oncogenic potential (7,26). Some data revealed radiosensitivity (7), while others did not (26). On the other hand, CDC25B also showed radiosensitivity (27), however, its oncogenic potential is still contradictory (28).

In conclusion, even though we do not know exactly how expression of these genes is altered by radiation, we herein attempted to characterize the genes which are responsible for radiation resistance and radiation-induced tumorigenesis. Further studies are needed to elucidate the cellular nature of these resistant cell lines as well as to clarify the potential relationship between these four genes, radiation resistance and tumorigenesis using an overexpression system. However, our data strongly implicate novel targets for detection of radiation-induced carcinogenesis.


    Notes
 
3 To whom correspondence should be addressed Email: yslee{at}kcch.re.kr Back

* These two authors contributed equally to this paper Back


    Acknowledgments
 
This work was supported by the Nuclear R&D Program of the Ministry of Science and Technology of Korea.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Breimer,L.H. (1988) Ionizing radiation-induced mutagenesis. Br. J. Cancer, 57, 6–18.[ISI][Medline]
  2. Hall,E.J., Marchese,M., Hei,T.K. and Zaider,M. (1988) Radiation response characteristics of human cells in vitro. Radiat. Res., 114, 415–424.[CrossRef][ISI][Medline]
  3. Krolewski,B. and Little,J.B. (1995) Alterations of mdm2 gene in X-ray transformed mouse 10T1/2 cells clones. Int. J. Oncol., 6, 1123–1127.
  4. Vahakangas,K.H., Samet,J.M., Metcalf,R.A., Welsh,J.A., Bennett,W.P., Lane,D.P. and Harris,C.C. (1992) Mutation of p53 and ras genes in radon-associated lung cancer from uranium miners. Lancet, 339, 576–580.[CrossRef][ISI][Medline]
  5. Dutrillaux,B. (1997) Ionizing radiation induced malignancies in man. Radioprotection, 32, C431–C440.
  6. Degtyareva,N.P., Greenwell,P., Hofmann,E.R., Hengartner,M.O., Zhang,L., Culotti,J.G. and Petes,T.D. (2002) Caenorhabditis elegans DNA mismatch repair gene msh-2 is required for microsatellite stability and maintenance of genome integrity. Proc. Natl Acad. Sci. USA, 99, 2158–2163.[Abstract/Free Full Text]
  7. Dilla,T., Romero,J., Sanstisteban,P. and Velasco,J.A. (2002) The mdm2 proto-oncogene sensitizes human medullary thyroid carcinoma cells to ionizing radiation. Oncogene, 21, 2376–2386.[CrossRef][ISI][Medline]
  8. Galaktionov,K. and Beach,D. (1991) Specific activation of cdc25 tyrosine phosphatase by B-type cyclins: evidence for multiple roles of mitotic cyclins. Cell, 67, 1181–1194.[CrossRef][ISI][Medline]
  9. Park,S.H., Cho,H.N., Lee,S.J. et al. (2000) HSP25-induced radioresistance is associated with reduction of apoptotic death: involvement of Bcl-2 or cell cycle. Radiat. Res., 154, 421–428.[ISI][Medline]
  10. Park,S.H., Lee,S.J., Chung,H.Y., Cho,C.K., Yoo,S.Y. and Lee,Y.S. (2000) Inducible heat shock protein 70 (HSP70) is involved in radioadaptive response. Radiat. Res., 153, 318–326.[CrossRef][ISI][Medline]
  11. Camichael,J., Digraff,W.G. and Gazdar,A.F. (1987) Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemisensitivity testing. Cancer Res., 47, 936–941.[Abstract/Free Full Text]
  12. Nicoletti,I., Migliorati,G., Pagliacci,M.C., Grignani,F. and Riccardi,C. (1991) A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods, 139, 271–279.[CrossRef][ISI][Medline]
  13. Dlugosz,A.A., Glick,A.B., Tennenbaum,W.C., Weinberg,W.C. and Yuspa,S.H. (1995) Isolation and utilization of epidermal keratinocytes for oncogene research. Methods Enzymol., 254, 3–20.[ISI][Medline]
  14. Hei,T.K., Piao, C.Q., Willey,J.C., Thomas,S. and Hall,E.J. (1994) Malignant transformation of human bronchial epithelial cells by radon-stimulated alpha-particle. Carcinogenesis, 15, 431–437.[Abstract/Free Full Text]
  15. Thraves,P., Salehi,Z., Dritschilo,A. and Rhim,J.S. (1990) Neoplastic transformation of immortalized human epidermal keratinocytes by ionizing radiation. Proc. Natl Acad. Sci. USA, 87, 1174–1177.[Abstract/Free Full Text]
  16. Thraves,P., Varghes,S., Jung,M., Grdina,D.J., Rhim,J.S. and Dritschilo,A. (1994) Transformation of human epidermal keratinocytes with fission neutrons, Carcinogenesis, 15, 2867–2873.[Abstract/Free Full Text]
  17. Riches,A.C., Herceg,Z., Bryant,P.E. and Wynford-Thomas,D. (1994) Radiation-induced transformation of SV40-immortalized human thyroid epithelial cells by single and fractionated exposure to gamma-irradiation in vitro. Int. J. Radiat. Biol., 66, 757–765.[ISI][Medline]
  18. Wazer,D.R., Chu,Q., Liu,X.L., Gao,Q., Safaii,H. and Band,V. (1994) Loss of p53 protein during radiation transformation of primary human mammary epithelial cells. Mol. Cell. Biol., 14, 2468–2478.[Abstract/Free Full Text]
  19. Momand,J., Jung,D., Wilczynski,S. and Niland,J. (1998) The MDM2 gene amplification database. Nucleic Acids Res., 26, 3453–3459.[Abstract/Free Full Text]
  20. Cahilly-Snyder,L., Yang-Feng,T., Francke,U. and George,D.L. (1987) Molecular analysis and chromosomal mapping of amplified genes isolated from a transformed mouse 3T3 cell line. Somat. Cell Mol. Genet., 13, 235–244.[CrossRef][ISI][Medline]
  21. Finlay,C.A. (1993) The mdm-2 oncogene can overcome wild type p53 suppression of transformed cell growth. Mol. Cell. Biol., 13, 301–306.[Abstract/Free Full Text]
  22. Momand,J., Wu,H.H. and Dasgupta,G. (2000) MDM2—master regulator of the p53 tumor suppressor protein. Gene, 242, 15–29.[CrossRef][ISI][Medline]
  23. Gautier,J., Solomon,M.J., Booher,R.N., Bazan,J.F. and Kirschner,M.W.L. (1991) cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell, 67, 197–211.[CrossRef][ISI][Medline]
  24. Galacktionov,K., Chen,X. and Beach,D. (1996) Cdc25 cell-cycle phosphatase as a target of c-myc. Nature, 382, 511–517.[CrossRef][Medline]
  25. Galaktionov,K., Lee,A.K., Eckstein,J., Draetta,G., Meckler,J., Loda,M. and Beach,D. (1995) CDC25 phosphatase as potential human oncogenes. Science, 269, 1575–1577.[Abstract/Free Full Text]
  26. Mendrysa,S.M., McElwee,M.K., Michalowski,J., O'Leary,K.A., Young,K.M. and Perry,M.E. (2003) mdm2 is critical for inhibition of p53 during lymphopoiesis and the response to ionizing irradiation. Mol. Cell. Biol., 23, 462–472.[Abstract/Free Full Text]
  27. Miyata,H., Doki,Y., Yamamoto,H. et al. (2001) Overexpression of CDC25B overrides radiation-induced G2-M arrest and results in increased apoptosis in esophageal cancer cells. Cancer Res., 61, 3188–3193.[Abstract/Free Full Text]
  28. Chen,M.S., Hurov,J., White,L.S., Woodford-Thomas,T. and Piwnica-Worms,H. (2001) Absence of apparent phenotype in mice lacking Cdc25C protein phosphatase. Mol. Cell. Biol., 21, 2853–3861.
Received April 16, 2003; revised September 16, 2003; accepted September 24, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
S. K. Srivastava, P. Bansal, T. Oguri, J. S. Lazo, and S. V. Singh
Cell Division Cycle 25B Phosphatase Is Essential for Benzo(a)Pyrene-7,8-Diol-9,10-Epoxide Induced Neoplastic Transformation
Cancer Res., October 1, 2007; 67(19): 9150 - 9157.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Bansal and J. S. Lazo
Induction of Cdc25B Regulates Cell Cycle Resumption after Genotoxic Stress
Cancer Res., April 1, 2007; 67(7): 3356 - 3363.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Li, Z. Zhang, D. L. Hill, X. Chen, H. Wang, and R. Zhang
Genistein, a Dietary Isoflavone, Down-Regulates the MDM2 Oncogene at Both Transcriptional and Posttranslational Levels
Cancer Res., September 15, 2005; 65(18): 8200 - 8208.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/1/123    most recent
bgg187v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kang, C.-M.
Right arrow Articles by Lee, Y.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, C.-M.
Right arrow Articles by Lee, Y.-S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?