Skip Navigation


Carcinogenesis Advance Access originally published online on September 11, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/1/69    most recent
bgg150v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Crott, J. W.
Right arrow Articles by Mason, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crott, J. W.
Right arrow Articles by Mason, J. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 25, No. 1, 69-76, January 2004
© Oxford University Press; all rights reserved


MOLECULAR EPIDEMIOLOGY AND CANCER PREVENTION

Effects of dietary folate and aging on gene expression in the colonic mucosa of rats: implications for carcinogenesis

Jimmy W. Crott1,4, Sang-Woon Choi1, Jose M. Ordovas2, Jeremy S. Ditelberg3 and Joel B. Mason1

1 Vitamins and Carcinogenesis Laboratory and 2 Nutrition and Genomics Laboratory, Jean Mayer USDA Human Nutrition Research Center on Aging at Tufts University, 711 Washington Street, Boston, MA 02111, USA and 3 Department of Pathology, Tufts–New England Medical Center, Boston, MA, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Folate depletion and aging are risk factors for colorectal cancer. We investigated the effects of folate status and aging on gene expression in the rat colon. Young (weanling) and older (12 month) rats were fed folic acid depleted (0 mg/kg) and supplemented (8 mg/kg) diets for 20 weeks. Gene expression was measured in colonic mucosal scrapings (n = 3 per group) using oligonucleotide arrays (Affymetrix U34A). Folate depletion induced the up-regulation of immune-related genes, urokinase and inducible nitric oxide synthase and the down-regulation of adhesion molecules (protocadherin-4, nidogen and integrin {alpha}V) and vascular endothelial growth factor in young rats. The abbreviated response to depletion in old rats (62 changes versus 136 in the young) included up-regulation of caspase-2 and deleted in colon cancer. Gene expression changes due to aging were more abundant in folate depleted than supplemented rats (38 versus 119 genes, respectively). In folate-deficient rats, aging induced the down-regulation of immune-related genes, urokinase, p53, insulin-like growth factor binding protein-3 and vav-1 oncogene. In folate supplemented rats, aging induced the down-regulation of vascular endothelial growth factor and caspase-2. Lower expression of adhesion molecules and higher expression of urokinase with folate depletion in young rats may indicate that cell detachment and migration, cancer-related processes, may be modulated by folate status. An age-related decline in p53 and IGF-BP3 expression was only observed in folate depleted animals, indicating that folate supplementation may reduce the risk for age-associated cancers by suppressing deleterious changes in the expression of certain genes.

Abbreviations: 0-FA, 0 mg/kg folic acid; 8-FA, 8 mg/kg folic acid; DCC, deleted in colon cancer; ECM, extracellular matrix; H&E, hematoxylin and eosin; IELs, intra-epithelial lymphocytes; IGF-BP3, insulin-like growth factor binding protein 3; iNOS, inducible nitric oxide synthase; MHC major histocompatibility complexes; MMP-16, matrix metalloproteinase 16; TCR, T cell receptor; TIMP-2, tissue inhibitor of metalloproteinase 2; VEGF, vascular endothelial growth factor


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Folate is essential for the synthesis, repair and methylation of DNA, processes that are central to maintaining the integrity of the genome. Folate depletion is reported to cause various genetic and epigenetic aberrations in mammalian cells, such as uracil misincorporation (1,2), genomic (3) and p53-specific (4) DNA breaks and genomic (5) and p53-specific (4) hypomethylation. These deleterious genetic and epigenetic changes are thought to underlie the inverse relationship between blood folate status and the risk for colorectal cancer. Indeed, it is estimated that people with the highest intakes of folate have a 30–40% lower risk for colorectal cancer than those with the lowest intakes (6). It is appropriate to study aging in conjunction with folate status in regard to colon carcinogenesis because the elderly often have impaired assimilation of dietary folate (7), colons of elder animals are particularly sensitive to folate depletion (8) and aging is perhaps the strongest risk factor for colorectal cancer, with the risk increasing from 0.07 to 0.87 to 4.0% in people aged 0–39, 40–59 and 60–79, respectively (9).

Deleterious genetic and epigenetic changes due to inadequate folate may promote or accelerate carcinogenesis by changing the expression of genes involved in the regulation of the cell cycle, cell death and other critical processes, such as DNA repair. Folate deficiency may affect gene expression by disturbing DNA methylation, inducing DNA breaks within the gene, inducing gene deletions and by inducing gene amplification. DNA methylation is an important method of gene silencing (10) and folate depletion is reported to cause genomic hypomethylation in humans (5) and in cell culture (11) and p53 hypomethylation in rats (4). In addition, folate depletion may induce gene amplification in vitro (12), probably via breakage–fusion–bridge cycles, a random process initiated by double-stranded DNA breakage (1,13). Although several mechanisms by which folate depletion disrupts DNA integrity are well characterized, the down-stream effects of these molecular changes are less clear. Particularly, we know very little of the gene pathways through which folate depletion may enhance colorectal carcinogenesis.

Cell culture studies utilizing northern blotting and RT–PCR to study the abundance of specific mRNA transcripts show that folate depletion causes an up-regulation of folate receptor {alpha} (12), folate-binding protein (14) and metallothionein (15). Furthermore, Kim et al. (16) reported that p53 expression in the rat colon is reduced by severe folate depletion and increased above basal levels with supplementation and plasma and mucosal folate concentrations are positively correlated with adenomatous polyposis coli mRNA levels.

Gene array technology has been used extensively to profile the gene expression patterns of various cancers, however, the use of gene arrays to study the effect of nutritional intervention, and more specifically folate depletion, is very much in its infancy. To date, only one published study has investigated the effect of folate status on mass gene expression (17). Human nasopharangeal epidermoid carcinoma cells were grown in medium containing either 2 mM (replete) or 2–10 nM (deplete) folic acid and gene expression was analyzed using cDNA arrays. Of the approximately 2000 genes studied, five genes were up-regulated and three genes down-regulated in response to folic acid depletion. Among these was H-cadherin, a cell adhesion molecule commonly down-regulated in cancers, which showed a 2.5-fold reduction in gene expression. This down-regulation was associated with hypermethylation of a CpG island in the first exon and intron of the H-cadherin gene.

We therefore aimed to study the effects of dietary folate depletion in combination with aging on gene expression in the rat colon using oligonucleotide probe arrays which probe for almost 9000 transcripts. These studies further our understanding of how folate depletion and aging disturb the cellular milieu and predispose to colorectal neoplasia.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Details of the animal protocol are reported elsewhere (8). Briefly, weanling (n = 16) and middle aged (12 month old, n = 16) male Sprague–Dawley rats were fed amino acid-defined diets containing 0 (0-FA) or 8 mg/kg folic acid (8-FA). Water was supplied ad libitum and diet consumption was matched to the group consuming the lowest amount within each age group. In the absence of any added sulfonamides in the diet, this regimen has been established to produce a moderate, not severe, degree of folate depletion (8). After 20 weeks on the diet, rats were anesthetized in a carbon dioxide breathing chamber and the abdomen was opened. Plasma and colonic samples were obtained before the animals were killed by cutting the aorta. The colorectum was removed, opened longitudinally on an ice-cold glass plate and washed with ice-cold saline. A small section of the transverse colon was immediately fixed in formalin and embedded in paraffin within 24 h. The tissue was then sectioned, mounted on a glass microscope slide and stained with hematoxylin and eosin (H&E). The remaining colon was gently scraped with a glass microscope slide to remove the mucosa as previously described (18). Mucosal scrapings were divided into several aliquots before being frozen in liquid nitrogen and stored at -70°C.

Colonic sections were examined for variations in epithelial and submucosal lymphocyte populations in a blind fashion. An experienced pathologist quantified the presence of intra-epithelial lymphocytes (IELs) per high power (400x) field of view. An average of 10 randomly selected fields across the section was taken. Furthermore, the presence of lymphocytes in the lamina propria was semi-quantitatively assessed using a rating of 1–3 after visual inspection of the entire section. No obvious lesions or abnormalities in cell distribution or morphology were detected in any of the sections.

Total RNA was isolated from an aliquot of colonic mucosa using TRIzol reagent (Invitrogen, San Diego, CA). RNA samples were randomly selected from 3 animals per group (total = 12) and 5 µg total RNA was prepared for gene expression analysis by oligonucleotide array (U34; Affymetrix, Santa Clara, CA) according to the manufacturer's instructions. Hybridized, stained and washed probe arrays were scanned using a laser scanner (Affymetrix). The fluidics station and scanner were controlled by MicroArray Suite 5.0 software (Affymetrix).

Abundances of urokinase and GAPDH transcripts were analyzed using RT–PCR. Primer sequences and product lengths were as follows: GAPDH forward, acccatcaccatcttccagga; GAPDH reverse, agccttctccatggtggtgaa (109 bp); urokinase forward, caatgctcacagatccgatgc; urokinase reverse, gccaatttgcacatagcacca (103 bp). One nanogram of total RNA was reverse transcribed and then 2.5 or 5 µl of the RT product was amplified by PCR (both using a SYBR Green RT–PCR kit; Applied Biosystems, Foster City, CA) using an ABI7700 sequence detector system controlled by SDS version 1.7a (Applied Biosystems). Dissociation curves were generated for each assay using Dissociation Curve software version 1.0 (Applied Biosystems) to ensure that non-specific amplification did not occur. All PCR products were analyzed by gel electrophoresis to ensure that the amplicon was of the anticipated length. Primers were designed using Primer Express version 2.0 software (Applied Biosystems) and synthesized by the Tufts University core facility. BLAST searches were performed on primer sequences using NCBI to ensure primer specificity.

Fluorescence intensity data from gene array experiments were exported to MS Excel and then into SAS version 8.02 (SAS Institute, Cary, NC) for analysis. Differences between groups were tested using two-way ANOVA followed by Tukey's post-test and significance was accepted at P < 0.05. Genes with a 1.5-fold or greater change in expression are reported. Fold changes are discussed with the 8-FA (supplemented) and young groups being the reference or control groups for the up- or down-regulation in the 0-FA (depleted) or old groups (see Table III). Data regarding the presence of IELs and RT–PCR were also analyzed by two-way ANOVA using SAS software.


View this table:
[in this window]
[in a new window]
 
Table III. Effect of dietary folic acid on colonic gene expression in young and old rats

 

    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Microscopy
The number of IELs present is shown in Table I. There was no significant difference in the number of IELs per high power field (P = 0.41). Semi-quantitative analysis of the lamina propria also failed to detect any differences in the presence of lymphocytes (data not shown). No overt pathologies or lesions were present and all sections appeared normal and healthy.


View this table:
[in this window]
[in a new window]
 
Table I. Intra-epithelial lymphocytes in H&E stained colonic sections

 
Probe array analysis
The number of genes meeting the criteria for a significant change is shown in Table II. FA depletion induced more than twice the number of changes in expression in young animals than old animals (comparison I versus II). Similarly, the observed difference in gene expression between age groups was >2-fold greater under conditions of FA depletion than supplementation (comparison III versus IV). Thus age appears to have a large impact on the colon's response to folate depletion and folate depletion magnifies the extent of expression differences between age groups.


View this table:
[in this window]
[in a new window]
 
Table II. Number of genes changing for each comparison

 
The names and data for the majority of changed genes are reported in Tables III and IV. Only annotated genes are reported. Genes considered to be of low relevance are omitted for the sake of brevity, but the entire list of genes whose expression was altered is available as Supplementary Tables 1–4 (see Supplementary material).


View this table:
[in this window]
[in a new window]
 
Table IV. Effect of aging on colonic gene expression in folate depleted and supplemented rats

 
Folate effect in the young
In the comparison of FA intakes in the young, 84 genes were down-regulated and 52 genes up-regulated in response to depletion. Of particular interest was the up-regulation of several immune cell-specific transcripts, including T cell receptor (TCR) {alpha}, {delta} and {zeta} chains (3.7- to 13.5-fold) and subunits of major histocompatibility complexes (MHC) I and II (2.1- to 3.6-fold), urokinase (2.1-fold) and inducible nitric oxide synthase (iNOS) (4.4-fold) with FA supplementation.

Several genes that are associated with cell–extracellular matrix (ECM) interactions and tissue remodeling were down-regulated with depletion. These included the adhesion molecules protocadherin-4 (3.5-fold), nidogen (1.9-fold) and integrin {alpha}V (1.7-fold), the ECM-digesting proteases matrix metalloproteinase 16 (MMP-16) (8.3-fold) and metalloendopeptidase (1.6-fold) and the angiogenesis promoter vascular endothelial growth factor (VEGF) (3.1-fold). In addition, tissue inhibitor of metalloproteinase 2 (TIMP-2) (2.1-fold), three heat shock proteins (HSP 27 kDa protein 2 and 70 kDa proteins 4 and 8) (1.5- to 1.9-fold) and c-Myc (2.1-fold) were down-regulated (Table III).

Folate effect in the old
In old rats, FA depletion altered the expression of fewer genes than in the young, with only 21 genes down-regulated and 41 up-regulated. Among the up-regulated genes were caspase-2 (2.0-fold) and deleted in colon cancer (DCC) (7.6-fold). Except for nidogen, which was down-regulated in the young and up-regulated in the old animals, there was no overlap in which genes underwent expression changes in young and old rats as a result of FA depletion (Table III).

Aging effect during folate depletion
Older age caused the up-regulation of 48 genes and down-regulation of 71 genes in 0-FA rats. Among the down-regulated genes were several immune cell-specific transcripts including CD antigens (5, 8, 36, 38, 43, 45, 74 and 94) (1.6- to 5.0-fold), TCR {alpha}, ß, {delta} and {zeta} chains (3.5- to 14.1-fold) and subunits of MHC I and II (2.6- to 5.2-fold). Several ECM-interacting genes were also down-regulated, including caveolin 3 (5.7-fold), mast cell protease (2.0-fold), chymase 1 (2.0-fold), urokinase (1.8-fold), integrin ß7 (2.4-fold) and glycosylation-dependent cell adhesion molecule (4.6-fold). In addition, p53 (1.7-fold), insulin-like growth factor binding protein 3 (3.2-fold) and vav 1 oncogene (1.9-fold) were down-regulated.

Up-regulated genes included DCC (5.9-fold) and nidogen (1.8-fold) (Table IV).

Aging effect during folate supplementation
The aging effect, in terms of numbers of genes changing, was lower in the 8-FA group, with only 13 genes up-regulated and 25 genes down-regulated. Among these changes was the down-regulation of caspase-2 (2.0-fold) and VEGF (3.3-fold). {alpha}-Actin was up-regulated in both the 8-FA (1.8-fold) and 0-FA (3.2-fold) groups, whereas nidogen was up-regulated in the 8-FA (1.8-fold) and down-regulated in the 0-FA (1.6-fold) groups with advancing age (Table IV).

RT–PCR analysis
Urokinase expression was analyzed by RT–PCR and normalized for GAPDH expression. Gene array analysis showed that urokinase expression was approximately 2-fold lower in young 0-FA than young 8-FA and old 0-FA colons (P < 0.05). This effect was confirmed by RT–PCR, however, it did not reach statistical significance (Figure 1). It should be noted that small changes in expression are difficult to detect by RT–PCR because a 2-fold difference in expression translates to only a one cycle difference in Ct ({Delta}Ct) because the PCR product theoretically doubles every cycle during the exponential phase of the PCR. Perhaps more relevant to the concordance of the RT–PCR and gene array data was the fact that both end points were significantly and negatively correlated (r2 = 0.54, P = 0.007, n = 12).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Effect of FA depletion and aging on urokinase (X63434) expression. Analysis by gene array and RT–PCR. Data are means ± SEM. n = 3 and n = 6 per group for gene array and RT–PCR, respectively. RT–PCR data corrected for GAPDH expression. RT–PCR ANOVA P = 0.11. *P < 0.05 versus young 0-FA.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Using oligonucleotide probe arrays we have identified several groups of genes that are sensitive to dietary FA depletion and aging in the colonic mucosa of rats. Both age and folate status had marked effects on gene expression in this organ. Age has previously been shown to have a significant impact on both molecular end points in the colon (19) as well as on its cell biology (20), and our observations delineate the broad array of changes that may underlie many of the alterations in the biology of the older colon. We find it particularly remarkable that alterations in folate status modified the expression of a set of genes in the older colon that was very distinct from the set of genes altered in the young colon, underscoring the profound changes in the colon due solely to the effect of age. In fact, only one gene (nidogen) changed in both young and old rats in response to dietary folate depletion.

Apart from the lack of overlap in genes changing due to folate depletion in young and old rats, young rats exhibited a more vigorous response to FA depletion (136 and 62 changed genes, respectively). This result seems somewhat counter-intuitive, since old rats have higher colonic proliferation rates (21) and require more dietary folate to maintain similar tissue folate levels (8) than the young. Nonetheless, the broader response to FA depletion in the young rats may be related to a higher resistance to cancer in young than old colons.

An earlier study of FA depletion in cell culture using cDNA arrays reported that H-cadherin was down-regulated 2.5-fold in FA depleted cells (17). We observed a similar response with protocadherin-4, another cadherin involved in cell–cell adhesion, which was down-regulated 3.5-fold in 0-FA compared with 8-FA rats in the young but not old. Furthermore, in young rats we observed that integrin ({alpha}V subunit), nidogen and involucrin, molecules involved in cell adhesion to the ECM or basement membrane, were all between 1.7- and 5-fold down-regulated in the 0-FA compared with 8-FA colons. In concert with the down-regulation of adhesion-related transcripts, young 0-FA rats had a 2-fold up-regulation of urokinase compared with young 8-FA rats. Urokinase expression in the old rats does not appear to be sensitive to FA depletion. Therefore, the apparently higher urokinase expression in young 0-FA than old 0-FA rats (26.7- and 1.2-fold, respectively) may simply be a function of the presence of a folate effect in the young and the absence of a similar effect in the old. Urokinase (urinary plasminogen activator) is consistently over-expressed in cancers and is involved in ECM degradation, both directly and indirectly, and in stimulating angiogenesis, cell proliferation and migration (22). Together these changes may indicate that colonic cells from young 0-FA rats have an enhanced capacity to detach from their environment and invade, characteristics necessary for tumorigenesis. Nevertheless, the observed changes are not entirely consistent with traditional concepts of carcinogenesis. For example, VEGF and MMP-16, which are associated with angiogenesis and ECM digestion, respectively, were down-regulated with depletion in young colons. Macroscopic tumor expansion, angiogenesis and invasion, features of cancers associated with VEGF (23) and MMPs (24), are phenomena related to later stages of carcinogenesis and therefore the counter-intuitive changes in expression observed here may be non-relevant.

We also detected up-regulation of iNOS due to FA depletion in young colons. Elevated iNOS expression has been detected in cancerous versus normal human colonic mucosa (25,26) and also in rat intestinal cells treated in vitro with 1,2-diacyl-sn-glycerol, a tumor-promoting agent (27). During colorectal tumorigenesis iNOS enzyme activity is reported to be highest in adenomas and declines with advancing tumor stage to a level similar to that of normal tissue during metastasis (28). It is possible that the increase in iNOS expression may be partially explained by elevated homocysteine concentrations in the young 0-FA group compared with the young 8-FA group [25.9 ± 9.5 and 3.4 ± 0.6 µM in plasma (8)]. Support for this hypothesis is provided by Woo et al. (29), who reported that treatment of macrophages with 0.05–0.1 mM homocysteine caused a significant increase in NO production and iNOS mRNA and protein.

It is tempting to hypothesize that the up-regulated iNOS expression we detected, and hence increase in NO production, may be linked to changes in the MMP and TIMP enzymes as described above. Although there are no reports on an effect of NO on MMP-16 and TIMP-2 specifically, NO is known to regulate the expression of various other members of the MMP and TIMP families (30). In addition, NO may explain the observed urokinase up-regulation in young 0-FA colons, since treatment of coronary venular endothelial cells with the NO donor sodium nitroprusside is reported to increase urokinase activity in a dose-dependent fashion (31).

Zhu and Melera (15) have previously shown that metallothionein, a metal-binding protein, is up-regulated in FA depleted Chinese hamster lung fibroblasts in vitro, affording cells a growth advantage. In our system, however, we observed a 2-fold down-regulation of metallothionein due to FA depletion in young but not old rats. This discrepancy may be due to differences between the in vitro and in vivo situation, particularly in the severity of folate depletion, or due to tissue- or species-specific differences.

Several immune-related transcripts were also up-regulated due to FA depletion in young colons and, in fact, constitute the largest functional group of changed genes. This change in expression cannot be explained by quantitative changes in colonic lymphocyte populations since no significant differences were detected in the presence of intraepithelial (Table II) or lamina propria lymphocytes (data not shown). The cell-mediated immune system may play an important role in monitoring the appearance of neoplastic cells and destroying them (32) and it is tempting to speculate that the changes in immune transcripts are the result of an increased appearance of abnormal preneoplastic cells.

It is particularly interesting that in both young and old rats, FA depletion did not affect the expression of any folate-related (including folate-binding, folate-dependent and folate-metabolizing proteins) genes (data not shown). It is possible that in this model the abundance of folate-related proteins is regulated by post-translational mechanisms or because the moderate depletion induced in our system was insufficient to induce detectable changes in the abundance of folate-related transcripts. In support of this, Zhu et al. (12) report that despite stable mRNA levels, folate receptor protein expression is inversely related to medium folate concentrations in fibroblasts in vitro.

Our data show that p53 expression is reduced due to aging, but only in the 0-FA group. This result indicates that FA supplementation can suppress the age-related decline in p53 expression and fits well with the hypothesis that FA supplementation may reduce the risk of age-associated cancers, by reducing or preventing deleterious changes in gene expression. Studies from this laboratory have previously shown that severe FA deficiency decreases p53 expression in the colonic mucosa of rats (16). In the current study no differences in p53 abundance were observed between the 0-FA and 8-FA groups, however, the previous study utilized a more severe model of folate deficiency induced by succinylsulfathiazone addition to the diet. An age-related decline in p53 transcript has been reported for the rat colon (33), however, some studies were unable to detect these changes (34,35), possibly due to differences in the FA content of rat chow since we only observed an age-related decline in p53 in 0-FA rats.

Similarly, insulin-like growth factor binding protein 3 (IGF-BP3) mRNA was more abundant in young 0-FA than old 0-FA rats, an effect suppressed by FA supplementation. IGF-BP3 mRNA has previously been shown to decline with age in the rat colon (34 –36). It is possible that this decline may be mediated by p53, because p53 is reported to stimulate IGF-BP3 production (37). IGF-BP3 sequesters IGF-1 and thereby inhibits DNA synthesis and proliferation (37). A decline in IGF-BP3 and subsequent increase in IGF-1 bioavailability with age support the hypothesized increased cancer risk in old 0-FA than young 0-FA rats because lowered IGF-BP3 and elevated IGF-1 are associated with carcinogenesis (38,39).

Several changes detected in this study are in agreement with the literature [e.g. p53 and IGF-BP3 (33–36)] and add weight to the validity of using gene arrays to measure gene expression in this system. Furthermore, we verified urokinase expression changes by RT–PCR and the results support those obtained by gene array analysis (Figure 1). Although many changes in our data seem to fit well with the hypothesis that aging and FA depletion, at least in synergy, increase the risk for carcinogenesis, various changes seem counter-intuitive and expose our lack of knowledge of cellular processes and their perturbation.

One limitation of this study is the use of colonic mucosal scrapings rather than a homogeneous population of colonocytes. Mucosal scrapings yield a heterogeneous population of cells primarily containing colonocytes but with some lymphocytes, macrophages, endothelial cells and smooth muscle cells as well. However, alternative approaches have their own distinct limitations, since protocols for the isolation of homogeneous populations of colonocytes require enzymatic digestion and or agitation and centrifugation for between 30 and 90 min (40,41), conditions that would no doubt stress the colonocytes sufficiently to artificially perturb gene expression patterns. Similarly, cell cultures of colonocytes have an architecture that is vastly different from the reality of the in vivo milieu, producing its own artifacts. Our data set has been validated both in silico, whereby the expression changes of several transcripts parallel previous reports in the literature (29,33–36), and also using real-time RT–PCR for the urokinase transcript.

We have identified changes in gene expression related to ECM remodeling and cell attachment as novel end points of FA depletion that are related to cancer and possibly other degenerative diseases. Previously the cell adhesion molecule H-cadherin has been identified as being responsive to FA concentrations (17), however, this is the first report of the effects of FA depletion in combination with aging on mass gene expression in an in vivo model. Of particular importance is the finding of increased urokinase expression with FA depletion in the young. As discussed, urokinase is frequently over-expressed in cancers and plays an important role in migration and invasion (22). Our data support those of other groups who show age-related declines in p53 and IGF-BP3 expression, however, this is the first report of a suppression of these changes due to FA supplementation.


    Supplementary material
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 
Supplementary material can be found at http://www.carcin.oupjournals.org


    Notes
 
4 To whom correspondence should be addressed Email: jimmy.crott{at}tufts.edu Back


    Acknowledgments
 
Many thanks are due to Drs Jerry Dallal (Human Nutrition Research Center) and Larry Sonna (US Army Institute for Environmental Medicine and Brigham and Womens Hospital) for consultations on statistical analyses. This material is based upon work supported by the US Department of Agriculture, under agreement no. 581950-9-001. Any opinions, findings, conclusions or recommendations expressed in this publication are those of the authors and do not necessarily reflect the view of the US Department of Agriculture. This project has been supported in part by a Jean Mayer USDA Human Nutrition Research Center pilot grant (S.-W.C.), NCI grant RO3 CA96004-01 (S.-W.C.) and NIH grant RO1 CA59005-05S1 (J.B.M.).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary material
 References
 

  1. Crott,J.W., Mashiyama,S.T., Ames,B.N. et al. (2001) The effect of folic acid deficiency and MTHFR C677T polymorphism on chromosome damage in human lymphocytes in vitro. Cancer Epidemiol. Biomarkers Prev., 10, 1089–1096.
  2. Blount,B.C., Mack,M.M., Wehr,C.M. et al. (1997) Folate deficiency causes uracil misincorporation into human DNA and chromosome breakage: implications for cancer and neuronal damage. Proc. Natl Acad. Sci. USA, 94, 3290–3295.[Abstract/Free Full Text]
  3. Duthie,S.J. and Hawdon,A. (1998) DNA instability (strand breakage, uracil misincorporation, and defective repair) is increased by folic acid depletion in human lymphocytes in vitro. FASEB J., 12, 1491–1497.[Abstract/Free Full Text]
  4. Kim,Y.I., Pogribny,I.P., Basnakian,A.G. et al. (1997) Folate deficiency in rats induces DNA strand breaks and hypomethylation within the p53 tumor suppressor gene. Am. J. Clin. Nutr., 65, 46–52.[Abstract/Free Full Text]
  5. Jacob,R.A., Gretz,D.M., Taylor,P.C. et al. (1998) Moderate folate depletion increases plasma homocysteine and decreases lymphocyte DNA methylation in postmenopausal women. J. Nutr., 128, 1204–1212.[Abstract/Free Full Text]
  6. Giovannucci,E., Rimm,E.B., Ascherio,A. et al. (1995) Alcohol, low-methionine–low-folate diets, and risk of colon cancer in men (see comments). J. Natl Cancer Inst., 87, 265–273.[Abstract/Free Full Text]
  7. Russell,R.M., Krasinski,S.D., Samloff,I.M. et al. (1986) Folic acid malabsorption in atrophic gastritis—possible compensation by bacterial folate synthesis. Gastroenterology, 91, 1476–1482.[Web of Science][Medline]
  8. Choi,S.W., Friso,S., Dolnikowski,G.G. et al. (2003) Biochemical and molecular aberrations in the rat colon due to folate depletion are age-specific. J. Nutr., 133, 1206–1212.[Abstract/Free Full Text]
  9. Jemal,A., Thomas,A., Murray,T. et al. (2002) Cancer statistics, 2002. CA Cancer J. Clin., 52, 23–47.[Abstract/Free Full Text]
  10. Laird,P.W. and Jaenisch,R. (1994) DNA methylation and cancer. Hum. Mol. Genet., 3, 1487–1495.[Abstract]
  11. Duthie,S.J., Narayanan,S., Blum,S. et al. (2000) Folate deficiency in vitro induces uracil misincorporation and DNA hypomethylation and inhibits DNA excision repair in immortalized normal human colon epithelial cells. Nutr. Cancer, 37, 245–251.[CrossRef][Web of Science][Medline]
  12. Zhu,W.Y., Alliegro,M.A. and Melera,P.W. (2001) The rate of folate receptor alpha (FR alpha) synthesis in folate depleted CHL cells is regulated by a translational mechanism sensitive to media folate levels, while stable overexpression of its mRNA is mediated by gene amplification and an increase in transcript half-life. J. Cell Biochem., 81, 205–219.[CrossRef][Web of Science][Medline]
  13. Fenech,M. and Crott,J.W. (2002) Micronuclei, nucleoplasmic bridges and nuclear buds induced in folic acid deficient human lymphocytes—evidence for breakage–fusion–bridge cycles in the cytokinesis-block micronucleus assay. Mutat. Res., 504, 131–136.[Web of Science][Medline]
  14. Jansen,G., Kathmann,I., Rademaker,B.C. et al. (1989) Expression of a folate binding protein in L1210 cells grown in low folate medium. Cancer Res., 49, 1959–1963.[Abstract/Free Full Text]
  15. Zhu,W.Y. and Melera,P.W. (1999) Metallothionein is overexpressed by hamster fibroblasts selected for growth in 15 pM folinic acid and provides a growth advantage in low folate. Cancer Res., 59, 4194–4199.[Abstract/Free Full Text]
  16. Kim,Y.I., Shirwadkar,S., Choi,S.W. et al. (2000) Effects of dietary folate on DNA strand breaks within mutation-prone exons of the p53 gene in rat colon. Gastroenterology, 119, 151–161.[CrossRef][Web of Science][Medline]
  17. Jhaveri,M.S., Wagner,C. and Trepel,J.B. (2001) Impact of extracellular folate levels on global gene expression. Mol. Pharmacol., 60, 1288–1295.[Abstract/Free Full Text]
  18. Perret,V., Lev,R. and Pigman,W. (1977) Simple method for the preparation of single cell suspensions from normal and tumorous rat colonic mucosa. Gut, 18, 382–385.[Abstract/Free Full Text]
  19. Ahuja,N., Li,Q., Mohan,A.L. et al. (1998) Aging and DNA methylation in colorectal mucosa and cancer. Cancer Res., 58, 5489–5494.[Abstract/Free Full Text]
  20. Holt,P.R. and Yeh,K.Y. (1988) Colonic proliferation is increased in senescent rats. Gastroenterology, 95, 1556–1563.[Web of Science][Medline]
  21. Xiao,Z.Q., Moragoda,L., Jaszewski,R. et al. (2001) Aging is associated with increased proliferation and decreased apoptosis in the colonic mucosa. Mech. Ageing Dev., 122, 1849–1864.[CrossRef][Web of Science][Medline]
  22. Duffy,M.J. (2002) Urokinase-type plasminogen activator: a potent marker of metastatic potential in human cancers. Biochem. Soc. Trans., 30, 207–210.[CrossRef][Web of Science][Medline]
  23. Ferrara,N. and Davis-Smyth,T. (1997) The biology of vascular endothelial growth factor. Endocr. Rev., 18, 4–25.[Abstract/Free Full Text]
  24. Egeblad,M. and Werb,Z. (2002) New functions for the matrix metalloproteinases in cancer progression. Nature Rev. Cancer, 2, 161–174.[Web of Science][Medline]
  25. Kojima,M., Morisaki,T., Tsukahara,Y. et al. (1999) Nitric oxide synthase expression and nitric oxide production in human colon carcinoma tissue. J. Surg. Oncol., 70, 222–229.[CrossRef][Web of Science][Medline]
  26. Yagihashi,N., Kasajima,H., Sugai,S. et al. (2000) Increased in situ expression of nitric oxide synthase in human colorectal cancer. Virchows Arch., 436, 109–114.[CrossRef][Web of Science][Medline]
  27. Hirose,Y., Rao,C.V. and Reddy,B.S. (2001) Modulation of inducible nitric oxide synthase expression in rat intestinal cells by colon tumor promoters. Int. J. Oncol., 18, 141–146.[Web of Science][Medline]
  28. Ambs,S., Bennett,W.P., Merriam,W.G. et al. (1999) Relationship between p53 mutations and inducible nitric oxide synthase expression in human colorectal cancer. J. Natl Cancer Inst., 91, 86–88.[Free Full Text]
  29. Woo,C.W., Cheung,F., Chan,V.W. et al. (2003) Homocysteine stimulates inducible nitric oxide synthase expression in macrophages: antagonizing effect of ginkgolides and bilobalide. Mol. Cell. Biochem., 243, 37–47.[CrossRef][Web of Science][Medline]
  30. Pfeilschifter,J., Eberhardt,W. and Huwiler,A. (2001) Nitric oxide and mechanisms of redox signalling: matrix and matrix-metabolizing enzymes as prime nitric oxide targets. Eur. J. Pharmacol., 429, 279–286.[CrossRef][Web of Science][Medline]
  31. Ziche,M., Parenti,A., Ledda,F. et al. (1997) Nitric oxide promotes proliferation and plasminogen activator production by coronary venular endothelium through endogenous bFGF. Circ. Res., 80, 845–852.[Abstract/Free Full Text]
  32. Dalerba,P., Maccalli,C., Casati,C. et al. (2003) Immunology and immunotherapy of colorectal cancer. Crit. Rev. Oncol. Hematol., 46, 33–57.[Web of Science][Medline]
  33. Xiao,Z.Q., Jaszewski,R. and Majumdar,A.P. (2000) Aging enhances G(1) phase in the colonic mucosa of rats. Mech. Ageing Dev., 116, 1–14.[CrossRef][Web of Science][Medline]
  34. Lee,H.M., Greeley,G.H.,Jr and Englander,E.W. (2001) Age-associated changes in gene expression patterns in the duodenum and colon of rats. Mech. Ageing Dev., 122, 355–371.[CrossRef][Web of Science][Medline]
  35. Lee,H.M., Greeley,G.H.,Jr and Englander,E.W. (2000) Effects of aging on expression of genes involved in regulation of proliferation and apoptosis in the colonic epithelium. Mech. Ageing Dev., 115, 139–155.[CrossRef][Web of Science][Medline]
  36. Hallberg,L.M., Ikeno,Y., Englander,E. et al. (2000) Effects of aging and caloric restriction on IGF-I, IGF-I receptor, IGFBP-3 and IGFBP-4 gene expression in the rat stomach and colon. Regul. Pept., 89, 37–44.[CrossRef][Web of Science][Medline]
  37. Buckbinder,L., Talbott,R., Velasco-Miguel,S. et al. (1995) Induction of the growth inhibitor IGF-binding protein 3 by p53. Nature, 377, 646–649.[CrossRef][Medline]
  38. Chan,J.M., Stampfer,M.J., Ma,J. et al. (2002) Insulin-like growth factor-I (IGF-I) and IGF binding protein-3 as predictors of advanced-stage prostate cancer. J. Natl Cancer Inst., 94, 1099–1106.[Abstract/Free Full Text]
  39. Sandhu,M.S., Dunger,D.B. and Giovannucci E.L. (2002) Insulin, insulin-like growth factor-I (IGF-I), IGF binding proteins, their biologic interactions, and colorectal cancer. J. Natl Cancer Inst., 94, 972–980.[Abstract/Free Full Text]
  40. Roediger,W.E. and Truelove,S.C. (1979) Method of preparing isolated colonic epithelial cells (colonocytes) for metabolic studies. Gut, 20, 484–488.[Abstract/Free Full Text]
  41. Benya,R.V., Schmidt,L.N., Sahi,J. et al. (1991) Isolation, characterization, and attachment of rabbit distal colon epithelial cells. Gastroenterology, 101, 692–702.[Web of Science][Medline]
Received June 10, 2003; revised August 1, 2003; accepted August 11, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
J. Marsillach, N. Ferre, J. Camps, F. Riu, A. Rull, and J. Joven
Moderately High Folic Acid Supplementation Exacerbates Experimentally Induced Liver Fibrosis in Rats
Experimental Biology and Medicine, January 1, 2008; 233(1): 38 - 47.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
Y. S. Kim and J. A. Milner
Dietary Modulation of Colon Cancer Risk
J. Nutr., November 1, 2007; 137(11): 2576S - 2579S.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Novakovic, J. M. Stempak, K.-J. Sohn, and Y.-I. Kim
Effects of folate deficiency on gene expression in the apoptosis and cancer pathways in colon cancer cells
Carcinogenesis, May 1, 2006; 27(5): 916 - 924.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. Jang, J. B. Mason, and S.-W. Choi
Genetic and Epigenetic Interactions between Folate and Aging in Carcinogenesis
J. Nutr., December 1, 2005; 135(12): 2967S - 2971S.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. Chanson, T. Sayd, E. Rock, C. Chambon, V. Sante-Lhoutellier, G. Potier de Courcy, and P. Brachet
Proteomic Analysis Reveals Changes in the Liver Protein Pattern of Rats Exposed to Dietary Folate Deficiency
J. Nutr., November 1, 2005; 135(11): 2524 - 2529.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. D. Davis and N. G. Hord
Nutritional "Omics" Technologies for Elucidating the Role(s) of Bioactive Food Components in Colon Cancer Prevention
J. Nutr., November 1, 2005; 135(11): 2694 - 2697.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. W.L. Ma, R. H. Finnell, L. A. Davidson, E. S. Callaway, O. Spiegelstein, J. A. Piedrahita, J. M. Salbaum, C. Kappen, B. R. Weeks, J. James, et al.
Folate Transport Gene Inactivation in Mice Increases Sensitivity to Colon Carcinogenesis
Cancer Res., February 1, 2005; 65(3): 887 - 897.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. C. Cabelof, J. J. Raffoul, J. Nakamura, D. Kapoor, H. Abdalla, and A. R. Heydari
Imbalanced Base Excision Repair in Response to Folate Deficiency Is Accelerated by Polymerase {beta} Haploinsufficiency
J. Biol. Chem., August 27, 2004; 279(35): 36504 - 36513.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/1/69    most recent
bgg150v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Crott, J. W.
Right arrow Articles by Mason, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crott, J. W.
Right arrow Articles by Mason, J. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?