Carcinogenesis Advance Access originally published online on June 10, 2004
Carcinogenesis 2004 25(10):1991-2003; doi:10.1093/carcin/bgh198
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.25 no.10 © Oxford University Press 2004; all rights reserved.
ARTICLE |
Insufficient p65 phosphorylation at S536 specifically contributes to the lack of NF-
B activation and transformation in resistant JB6 cells
1 Gene Regulation Section, Laboratory of Cancer Prevention, Center for Cancer Research, National Cancer Institute at Frederick, MD 21702, USA, 2 Department of Immunology Juntendo University School of Medicine 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan and 3 Department of Pathogenic Biochemistry, Institute of Natural Medicine, Toyama Medical and Pharmaceutical University, 2630 c, Toyama 930-0194, Japan
4 To whom correspondence should be addressed Email: huji{at}ncifcrf.gov
| Abstract |
|---|
|
|
|---|
NF-
B activation is required for TNF-
-induced transformation of JB6 mouse epidermal cells. Deficient activation of p65 contributes to the lack of NF-
B activation in transformation-resistant (P) cells. We hypothesized that the differential NF-
B activation involves differential p65 phosphorylation arising from enzyme activity differences. Here we show that TNF-
induces greater ERK-dependent p65 phosphorylation at S536 in transformation sensitive (P+) cells than in P cells. Our results establish that limited ERK content contributes to a low I
B kinase (IKKß) level, in turn resulting in insufficient p65 phosphorylation at S536 upon TNF-
stimulation in P cells. Phosphorylation of p65 at S536 appears to play a role in TNF-
-induced p65 DNA binding and recruitment of p300 to the p65 complex as well as in release of p65 bound to HDAC1 and 3. Blocking p65 phosphorylation at S536, but not at S276 or S529, abolishes p65 transactivational activity. Over-expression of p65 but not p65 phosphorylation mutant (S536A) in transformation-resistant P cells renders these cells sensitive to TNF-
-induced transformation. Over-expression of p65 phosphorylation mimics p65-S536D or p65-S536E in P cells and also rescues the transformation response. These findings provide direct evidence that phosphorylation of p65 at S536 is required for TNF-
-induced NF-
B activation in the JB6 transformation model. The lack of NF-
B activation seen in P cells can be attributed to an insufficient level of p65 phosphorylation on S536 that arises from insufficient IKKß that in turn arises from insufficient ERK. Thus, p65 phosphorylation at S536 offers a potential molecular target for cancer prevention.
Abbreviations: EMEM, Eagles Minimum Essential Media; FBS, fetal bovine serum; IKKß, I
B kinase; IP, immunoprecipitation; MEKK1, mitogen-activated protein kinase/ERK kinase kinase-1; NIK, NF-
B inducing kinase
| Introduction |
|---|
|
|
|---|
Clonal variants of mouse epidermal JB6 cells that are genetically susceptible (P+) or resistant (P) to tumor promoter-induced neoplastic transformation provide a useful and predictive model for understanding gene regulation events that occur during rate-limiting phases of carcinogenesis and for targeting these events for prevention (13). Nuclear factor-
B (NF-
B)-dependent transcription is important in tumor development and cancer treatment (46). Previously we found that P and P+ cells exhibit differential NF-
B response, a response that is required for TNF-
-induced JB6 cell transformation (3,7,8). The differential response involves different levels of ERK-dependent p65 transactivation (7). However, the molecular basis of this differential p65/NF-
B regulation in P and P+ cells remains undefined.
The NF-
B transcription factor is a protein dimer that binds to a common sequence motif known as the
B site. One group of NF-
B proteins consists of RelA (p65), RelB and c-Rel-proteins that are synthesized in their mature forms. Owing to its abundance in most cell types and the presence of a strong transactivational domain, RelA/p65 is responsible for most of NF-
B's transcriptional activity. In JB6 cells, p65 is the only Rel protein expressed (7). The second group consists of NF-
B1 (p105) and NF-
B2 (p100), which are processed to produce mature p50 and p52 proteins, respectively (5,9). These two groups dimerize to form hetero-dimers or homo-dimers. The most commonly detected are p65p50 and p65p52 hetero-dimers. All of the NF-
B proteins contain a Rel homology domain (RHD), which mediates their dimerization and DNA binding. However, unlike p65, Rel B and c-Rel, p50 and p52 lack transcription-modulating domains and are thought to have no transactivation function.
The best-characterized NF-
B regulation pathway applies to p65p50 and p65p52 dimers, which are held captive in the cytoplasm by specific inhibitory I
B proteins (I
B
, I
Bß, I
B
, p105 and p100). Activation of NF-
B is triggered by stimuli such as TNF-
, which activate the I
B kinase (IKK) complex. Activated IKK then phosphorylates NF-
B-bound I
B, and this targets I
B for ubiquitin-dependent degradation, allowing the liberated NF-
B dimers to translocate to the nucleus (10). Although the nuclear translocation is an important aspect of NF-
B regulation, additional post-translational modification of NF-
B itself and its surrounding chromatin environment is also critical for recruiting the transcriptional apparatus and for stimulating target gene expression. Therefore, phosphorylation (1113) and acetylation (14) of NF-
B represent another important level of regulation.
Several phosphorylation sites, among them serine 536, are required for p65 activation (1517). Phosphorylation of p65 at S536 is mediated by IKKß and/or IKK
and occurs in the cytoplasm (18). Although over-expression of mitogen-activated protein kinase/ERK kinase kinase-1 (MEKK1) or of NF-
B inducing kinase (NIK) can stimulate the kinase activity of IKKß (19), whether MEKK1 or NIK is responsible for IKKß-dependent p65 phosphorylation in the JB6 transformation model is unknown. The activated NF-
B enters the nucleus, associates with CBP/p300 and activates gene transcription (20). Signal-induced cytosolic p65 phosphorylation provides a mechanism that ensures that only activated NF-
B can induce transcription, thereby maintaining NF-
B as an inducible transcription factor.
In contrast to p65 phosphorylation, the role of acetylation in NF-
B activation is not well understood. p65 is subject to reversible acetylation at lysines 218, 221 and 310; this post-translational modification plays a pivotal role in NF-
B activation by inhibiting I
B
binding to p65 and preventing the nuclear export of the NF-
B complex (21,22). However, acetylation of p65 at lysines 122 and 123 decreases its binding to
B-containing DNA, facilitating its removal by I
B
and subsequent export to the cytoplasm, consequently suppressing NF-
B-dependent gene transcription (23). On the other hand, acetylation of p50 increases its DNA binding and further enhances NF-
B transcriptional activity (24). It appears that the activity of acetylated NF-
B in gene transcription depends on the biological context of the cell and the discrete acetylation sites of the NF-
B subunits (21).
Similar to the situation in which phosphorylation of histone protein facilitates its acetylation (25,26), the phosphorylation of p65 determines its association with CBP/p300 or HDAC1 (20), suggesting that phosphorylation of NF-
B may be needed for its acetylation. Whether phosphorylation and acetylation processes affect each other in the case of p65 is unknown.
Previously, we demonstrated that p65 transactivation rather than p65 nuclear level is limiting for NF-
B activation in P cells (7). This study addresses the molecular basis of the differential TNF-
-induced p65 transactivation and DNA binding seen in P+ and P cells. We find that phosphorylation of p65 at S536 in response to TNF-
is greater in P+ than in P cells. Phosphorylation of p65 at S536 is required for NF-
B/p65 transactivation and also influences p65 DNA binding and recruitment of p300. Lack of sufficient p65 phosphorylation at S536 in P cells results from deficient ERK content, which in turn contributes to a low level of cellular IKKß. The limited IKKß in P cells, although activated, fails to catalyze sufficient p65 phosphorylation at S536. Insufficient p65 phosphorylation at S536 in P cells in turn renders them resistant to TNF-
-induced cell transformation.
| Materials and methods |
|---|
|
|
|---|
Cell culture
Clonal variants of mouse epidermal JB6 cells were cultured as described previously (7). In brief, JB6 cells were cultured in Eagles Minimum Essential Media (EMEM) (BioWhitaker, Frederick, MD) supplemented with 4% fetal bovine serum (FBS), 2 mM L-glutamine and 25 mg/ml gentamicin (Life Technology/Gibco, Gaithersburg, MD). All other cell culture reagents were purchased from BioWhitaker or Life Technology/Gibco.
Plasmids and transient transfection
The NF-
B reporter plasmids consist of Firefly Luciferase reporter genes driven by an NF-
B responsive sequence from IL-6 promoter containing two copies of NF-
B responsive elements in a sense orientation (GACTCTAGAGGATCAAATGTGGGATTTTCCCATGTGGGATTTTCACATGATCATGGGAAAATCCCACATGAAAATCCAATTTCCGGCC) (7). The wild-type ERK 2 and dominant-negative ERK2 expression plasmids (27), HA-tagged wild-type p65 and mutants including p65-S276A, p65-S529A, p65-S536A and p65-S529A/S536A (28), as well as dominant-negative IKKß (19) were described previously. HA-p65-S536D (TCC mutated to GAC) and HA-p65-S536E (TCC mutated to GAG) were generated by site-directed mutagenesis using ExSiteTM PCR-Based Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). The HDAC1, 2 and 3 expression constructs were kind gifts of Dr Eric Verdin (University of California San Francisco). For the NF-
B luciferase reporter assay, JB6 cells were seeded at a concentration of 1 x 104 cells/well in a 24-well plate the day before transfection. Transfections were performed according to the LipofectAMINE protocol from Life Technology/Gibco. After incubation with DNA in complete medium for 24 h, the transfected cells were starved in EMEM with 0.2% FBS for 24 h. The resulting quiescent cells were then treated with TNF-
at 10 ng/ml in EMEM with 0.2% FBS as described in the figure legends. In general, the kinase inhibitors were added to the cells 1 h before stimulation with TNF-
for another 3 h. The stimulated cells were then collected and lysed. The resulting cell lysates were assayed for Luciferase activity using Dual-Luciferase Assay Kit (Promega, Madison, WI) and DYNEX Luminometer (DYNEX Technologies, Chantilly, VA). Each Firefly Luciferase activity driven by a specific promoter was normalized to its respective Renilla Luciferase activity driven by tk (thymidine kinase) promoter as a control for transfection efficiency. Mek inhibitor U0126 was purchased from Promega. For over-expression of ERK or other protein, 30 µg of the expression plasmid were transfected into JB6 cells in a 150 mm dish according to the LipofectAMINE protocol from Life Technology/Gibco. Forty-eight hours after transfection, the transfected cells were subjected to treatment and then harvested for the analysis.
Immunoprecipitation (IP) and immunoblotting (IB)
Cells were lysed in IP lysis buffer containing 20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40, 10% glycerol. Protease inhibitor cocktail tablets (Roche, Germany) were added to IP lysis buffer right before use. Cell lysates were subjected to IP in the lysis buffer, and the precipitated proteins were analyzed by IB. Protein was separated by using NuPage 10 or 12% BisTris pre-packed gel (Invitrogen, Carlsbad, CA). The proteins were then electrotransferred to nitrocellulose membrane (Schleicher & Schuell, Keene, NH); subsequently, membrane-bound proteins were probed with antibody and further detected by chemoluminescence according to the ECL protocol from Amersham (Arlington Heights, IL). Antibodies against S536-phospho-p65, acetylated lysine, phospho-ERK and IKKß were obtained from Cell Signaling Technology (Beverly, MA). Anti-ERK was from Promega. Anti-p300 was from Upstate. All other antibodies used were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Protein GSepharose 4 beads was obtained from Amersham.
Acid-soluble protein extraction
The cultured cells were washed two times with PBS after treatment. Acid-soluble protein extraction was carried out as described (29) and the extract was stored at 20°C. Briefly, the cells were lysed with IP lysis buffer. H2SO4 was then added to a final concentration of 0.2 M and the samples were incubated for 60 min on ice. After centrifugation at 14 000 r.p.m. for 10 min, the supernatant fractions were collected and precipitated with a final concentration of 20% trichloroacetic acid on ice for 45 min. These tubes were centrifuged at 14 000 r.p.m. for 10 min at 4°C and the pellets were then washed twice with acetone.
In vitro p65 phosphorylation (S536) assay
In vitro translation of p65 was carried out using TNT® Quick Coupled Transcription/Translation System (Promega, Madison, WI) according to the protocol provided. Ten micrograms of the reaction mixture containing non-purified p65 was used for each in vitro p65 phosphorylation (S536) assay. P cells were transfected with ERK-2 expression plasmid and P+ were transfected with dominant-negative ERK-2 expression vector according to the protocol described above. Twenty-four hours after transfection, the transfected cells were starved in EMEM with 0.2% FBS for 24 h and then treated with or without TNF-
for 30 min. The cells were harvested and lysed and 300 µg of the protein were used for IP with anti-IKKß antibody. In vitro phosphorylation of p65 was carried out by mixing the precipitated IKKß complex with 10 µl of the translated p65 in kinase buffer [25 mM TrisHCl (pH 7.5), 5 mM beta-glycerophosphate, 2 mM dithiothreitol, 0.1 mM Na3VO4, 10 mM MgCl2] containing 200 mM ATP (Cell Signaling, Beverly, MA). The total volume for the reaction was 50 µl and the reaction was carried out at 30°C for 30 min. The non-phosphorylated and phosphorylated p65 were then subjected to IP with p65 antibody and, subsequently, the phosphorylated p65 was separated by SDSPAGE gel and detected with anti-phosph-p65 (S536).
Electrophoretic mobility shift assay
Cells were collected after starvation and TNF-
treatment. Nuclear extracts were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce Biotechnology, Rockford, IL). A Gel Shift Assay System from Promega was used for EMSA and all the experimental procedures were carried out according to the protocol provided. One microgram of the nuclear extracts was used for each reaction. Double strand oligonucleotides containing NF-
B consensus sequence AGTTGAGGGGACTTTCCCAGG were purchased from Santa Cruz. Binding of nuclear protein to the double stranded oligonucleotides containing Sp-1 consensus sequence ATTCGATCGGGGCGGGGCGAGC (Santa Cruz) was examined to confirm the specificity of the treatment on NF-
B DNA binding. The proteinDNA complexes were resolved on a 6% Retardation gel (Invitrogen) and visualized by autoradiograph.
In vitro protein translation and acetylation
The TNF-
-stimulated JB6 P+ cell cytoplasmic extracts were used as a kinase source. The in vitro p65 phosphorylation was performed as described above. After in vitro phosphorylation, phosphorylated and non-phosphorylated p65 were purified by IP with p65 antibody. In vitro p65 acetylation was conducted by mixing the immunoprecipitated p65 complex, 2 µl of p300 or PCAF (Upstate), 3 µl of 500 mM Acetyl-CoA (Sigma, St Louis, MO) and 3 µl of 5x HAT buffer (Upstate) in a total volume of 15 µl at 30°C for 1 h. The acetylated p65 was separated by SDSPAGE gel and detected with anti-acetylated lysine.
Gal4 transactivation assay
The Gal4 expression plasmids consist of sequence from wild-type p65 and phosphorylation mutant S536A fused to the DNA binding domain of Gal4. The selected fusion construct (50 ng) was co-transfected into JB6 P+ cells with 25 ng of luciferase reporter construct driven by the Gal4-responsive promoter sequence. After 48 h of transfection, the transfected cells were treated with TNF-
(10 ng/ml) for 3 h. Luciferase activity of each sample was normalized using Renilla luciferase driven by tk promoters.
Anchorage-independent transformation assay (soft agar assay)
JB6 P cells were transfected with HA tagged p65 and p65 phosphorylation mutants as described earlier. The pooled clones over-expressing wild-type p65 or p65 phosphorylation mutants were selected with G418 (500 µg/ml) for 2 weeks. Transformation assays were performed as described previously (7). TNF-
(10 ng/ml) was added to induce cell transformation. The cells were cultured at 36°C for 14 days and the resulting colonies were counted by an automated image analysis system supported by Image Pro-Plus (v. 3.0.1) software (Media Cybernetics). The transformation responses are presented as colonies per 10 000 cells per 60 mm tissue culture dish. Cells over-expressing p65 or p65 phosphorylation mutants showed no significant reduction in total viable cell numbers during the time periods of soft agar assay.
| Results |
|---|
|
|
|---|
TNF-
differentially activates p65 phosphorylation and subsequent acetylation in JB6 P and P+ cellsPreviously, we reported that TNF-
-induced p65 nuclear accumulation is similar (
1.5-fold difference) in P+ and P cells (7). However, post-translational activation of p65 occurs only in transformation sensitive P+ cells (7). To examine the mechanistic details of differential p65 post-translational modification in NF-
B activation, we compared the p65 phosphorylation and acetylation status following TNF-
treatment in P and P+ cells. Antibody against p65 phosphorylated at serine 536 was used to evaluate p65 phosphorylation status in the JB6 cells. The serine 536 site is phosphorylated by IKKß in the cytoplasm (18) and is required for NF-
B activation (16). As shown in Figure 1, phosphorylation of p65 at S536 was slightly induced upon TNF-
stimulation in transformation-resistant P cells but greatly induced in P+ cells. Both basal and TNF-
-induced levels of p65 phosphorylation at S536 are low in P cells. Phosphorylation of p65 appeared as an early event that was first detected at 15 min after TNF-
stimulation. Acetylation of p65 was detected using anti-acetylated lysine. TNF-
-induced acetylation of p65 in P+ but not in P cells (Figure 1). Interestingly, the onset of p65 acetylation occurred after the onset of p65 phosphorylation, at 30 min after TNF-
stimulation, suggesting that the induced p65 phosphorylation (S536) may be a prerequisite for the induced acetylation of p65 (S536). However, the observation that p65 acetylation was not induced in P cells even though phosphorylation of p65 (S536) was induced, suggests that phosphorylation of p65, at least at the P level, is not sufficient for triggering acetylation.
|
ERK activity is required for NF-
B-dependent transcription and p65 phosphorylationWe showed previously that ERK activity is important for p65 transactivation and NF-
B activation in response to TNF-
(7), with the level of ERK protein and consequently of activated ERK being deficient in transformation-resistant JB6 P cells (1). In contrast, the levels of other activated protein kinases including NIK and MEKK1/JNK are not different in P and P+ cells (data not shown). We therefore asked whether differential phosphorylation of p65 at S536 and acetylation of p65 are ERK dependent. As shown in Figure 2A, TNF-
exposure activated ERK and induced p65 phosphorylation and acetylation. ERK activation and p65 phosphorylation and acetylation occurred coordinately. At 20 µM U0126, a MEK inhibitor, completely abolished ERK activation (represented by p-ERK). Interestingly, U0126 blocked not only p65 phosphorylation but also p65 acetylation. The observations that the MAP kinase inhibitor blocked acetylation and that p65 acetylation followed p65 phosphorylation suggest that p65 phosphorylation may be required for the triggering of p65 acetylation.
|
To confirm that U0126 blocks TNF-
-induced NF-
B activation, a Luciferase assay using IL-6 promoter containing two NF-
B sites was used. As shown in Figure 2B, the MEK inhibitor U0126 inhibited both basal and TNF-
-induced NF-
B activity. In addition, TNF-
did not activate NF-
B in ERK-deficient P cells, further confirming that ERK activation is required for NF-
B activation. If ERK deficiency were responsible for the low p65 phosphorylation (S536) and acetylation, then over-expression of ERK enzyme would restore p65 phosphorylation and acetylation. As demonstrated in Figure 2C, over-expression of ERK2 enhanced TNF-
-induced p65 phosphorylation, indicating the critical role of the ERK pathway in p65 phosphorylation. However, ERK over-expression did not restore p65 acetylation in P cells (data not shown) suggesting phosphorylation of p65 at S536 is not sufficient to trigger p65 acetylation, and other acetylation regulation mechanisms may be involved.
The protein acetylation status is dynamically regulated by both HAT enzymes and HDACs. We found that HDAC1 is down-regulated by TNF-
treatment in P+ but not in P cells (data not shown), implying that HDAC1 down-regulation is one contributor to P+ cell acetylation of p65. HDAC down-regulation is not restored in P/ERK cells (data not shown). This suggests that HDAC down-regulation occurs on an ERK-independent pathway, and may explain the lack of restoration of acetylation in ERK-expressing P cells.
IKKß mediates ERK activation of p65 phosphorylation on S536
As IKKß is known to phosphorylate p65 on serine 536 (18), but the kinase responsible for IKKß activation in the JB6 model is unknown, we examined whether IKKß mediates ERK activation-induced p65 phosphorylation. As shown in Figure 3A, IKKß protein level is greater in P+ than in P cells and is down-regulated by either MEK1 inhibitor U0126 (Figure 3B) or over-expressed dominant-negative ERK2 (Figure 3C) in P+ cells. It has been shown that activation of IKK
is crucial for p65 phosphorylation at S536 following the simulation of lymphotoxin beta receptor (1517). Of note, the level of IKK
is similar in P and P+ cells (Figure 3A). Therefore, whether activation of IKK
is critical for the p65 phosphorylation in JB6 cells or not, it appears that activation of IKK
is not responsible for the differential phosphorylation of p65 at S536. To confirm that IKKß is required for S536 phosphorylation of p65, and to show that ERK activation occurs upstream of IKKß activation, we expressed dominant-negative IKKß in P+ cells. Blocking IKKß prevents TNF-
-induced p65 phosphorylation but not ERK phosphorylation, indicating ERK activation is an earlier event than IKKß activation (Figure 3D). Moreover, an in vitro p65 phosphorylation assay using IKKß immunoprecipitated from P cells (as enzyme source) and in vitro translated p65 (as substrate) demonstrated that transfection of either ERK2 or IKKß rescued the ERK-deficient P cells, raising both basal and TNF-
-induced levels of IKKß activity (Figure 3E and F). These findings are consistent with the observation presented in Figure 1 that the inducibility of p65 phosphorylation at S536 is intact but the level of induced phosphorylated p65 is significantly less in P cells. The fact that IKKß can substitute for ERK in P cells to produce a gain of basal and TNF-
-induced p65 phosphorylation indicates that ERK's ability to regulate p65 phosphorylation is mediated mainly by its regulation of IKKß expression. Expression of dominant-negative ERK2 in P+ cells not only decreased the level of activated immunoprecipitated IKKß in catalyzing basal p65 phosphorylation but also abolished the TNF-
-induced increase in activated IKKß as measured by in vitro phosphorylation of p65 (Figure 3G). As we reported previously, expression of dominant-negative ERK2 almost completely abolished ERK activation (11). The fact that induced p65 phosphorylation is seen in ERK-deficient P cells (Figure 1) but not in MEK inhibitor (Figure 2A) or dominant-negative ERK (Figure 3G) treated P+ cells suggests that a threshold of activated ERK is required for induction of IKKß and activated IKKß. Therefore, it appears that ERK activation controls p65 phosphorylation at S536 mainly by affecting the IKKß protein level. These results demonstrate that deficient ERK protein in P cells results in lower levels of IKKß and activated IKKß that in turn contribute to the insufficient p65 phosphorylation at S536. It is noteworthy that over-expression of IKKß alone in P cells is sufficient to restore p65 phosphorylation without affecting ERK phosphorylation (data not shown), suggesting that low (P) levels of ERK suffice to (directly or indirectly) activate IKKß but higher levels are needed for IKKß expression.
|
Treatment with MEK inhibitor U0126 inhibits TNF-
-induced DNA binding of p65-containing complexWe showed previously that TNF-
induced greater DNA binding of the p65-containing complex in P+ than in P cells. We also found that although the basal nuclear p65 is slightly higher in P+ cells, TNF-
stimulation (up to 3 h) induces a similar degree of p65 nuclear accumulation. Therefore, the differential nuclear level of p65 (7) does not suffice to account for the stronger p65 DNA binding in P+ cells. To examine whether p65 phosphorylation at S536 also contributes to NF-
B DNA binding, we performed EMSA assays. Figure 4A shows multiple bands representing various NF-
B dimers. As established previously, the lower bands (Figure 4A, bands 1) are p50- and p52-containing complexes while the upper bands (Figure 4A, bands 2 and 3) contain p65 (7). Consistent with our previous finding, TNF-
induced much greater p65 DNA binding in P+ than in P cells. TNF-
-induced binding to the DNA of p65-containing complexes represented by the increased intensity of bands 2 and 3, and this was further confirmed by the super-shift results showing an increased level of band 4 (Figure 4A). In order to ascertain whether the increased DNA-bound p65 is phosphorylated, we performed an EMSA using samples that were unphosphorylated due to treatment with MEK inhibitor U0126. As shown in Figure 4B, U0126 (20 µM) prevented binding to DNA of p65-containing complexes. Unchanged Sp-1 DNA binding activity confirmed the specificity of U0126 treatment on NF-
B DNA binding. The observation that TNF-
-induced p65 phosphorylation is completely blocked by 20 µM U0126 treatment (
56-fold decrease, Figure 2A), suggests that the increased DNA-bound p65-containing complex is phosphorylated. Additionally, the fact that the significantly lower level of TNF-
-induced p65 phosphorylation in P cells (Figure 1) coincides with the lack of induced p65 DNA binding further supports this possibility. To test whether inhibition of p65 nuclear translocation contributes to the inhibited p65 DNA binding following U0126 treatment, we compared the nuclear p65 level in cells pre-treated with or without U0126. As is shown in Figure 4B, U0126 treatment partially inhibits TNF-
-induced p65 nuclear accumulation (
2-fold decrease). Therefore, it is likely that impaired p65 nuclear translocation contributes to the block in p65 DNA binding but does not suffice to account for the magnitude of inhibition of p65 DNA binding following MEK inhibitor exposure. p65 DNA binding thus appears to be limited both by phosphorylation at S536 and nuclear accumulation.
|
Over-expression of HDAC inhibits p65 DNA binding but does not affect p65 phosphorylation
As reported previously (20), the phosphorylation status of NF-
B determines its association with acetylation enzymes CBP/p300 or with deacetylation enzyme HDAC1, raising the question of whether p65 phosphorylation and acetylation affect each other. We over-expressed HDACs to inhibit p65 acetylation. Figure 5A shows that over-expression of HDAC1, 2 or 3 blocked TNF-
-induced NF-
B activation, suggesting that an acetylation event is required for NF-
B activation. As expected, over-expression of HDAC1 decreased p65 acetylation and histone H3 acetylation (Figure 5B). However, over-expression of HDAC1 had no effect on p65 phosphorylation (S536) indicating that p65 phosphorylation does not require acetylation (Figure 5C). We asked whether p65 phosphorylation at S536 is sufficient for the induced p65 DNA binding. If acetylation of p65 is also required, then deacetylating p65 as in Figure 5B should inhibit p65 DNA binding. As shown in Figure 5D, over-expression of HDAC1 inhibited TNF-
-induced DNA-bound p65 complex formation. Although these experiments stop short of distinguishing between p65 and other deacetylation substrates, they do establish that under conditions in which p65 becomes deacetylated but retains S536 phosphorylation, the DNA binding is diminished. Thus, one can conclude that S536 phosphorylation is not sufficient for DNA binding. In contrast to the inhibition of NF-
B DNA binding, the binding of Sp-1 to DNA was unaffected by over-expression of HDAC1, indicating the specificity of the HDAC1 for inhibition of NF-
B DNA binding.
|
Blocking phosphorylation of p65 at S536 abolishes p65 acetylation in vitro
Given that phosphorylation of p65 (S536) is an earlier event than acetylation and that blocking p65 phosphorylation by U0126 is accompanied by inhibition of p65 acetylation, we asked whether p65 phosphorylation (S536) is required for p65 acetylation in JB6 cells. The first attempt to compare the acetylation state of wild-type p65 and p65 mutant (S536A) in response to TNF-
encountered the failure of the JB6 cells to express sufficient exogenous p65 protein for the acetylation assay. Alternatively, because JB6 cells successfully expressed other constructs such as ERK and IKKß, it is also possible that the anti-HA used for IP did not pull down HA-tagged p65 efficiently. We then performed an in vitro p65 acetylation experiment using IKKß-containing cytosol from TNF-
stimulated cells and in vitro translated p65. As it has been reported that p300 catalyzes p65 acetylation both in vitro and in vivo (2123), we used p300 as the HAT enzyme to acetylate p65 in vitro. As shown in Figure 6, acetylation of p65 is inhibited when the S536 site is mutated. Although this experiment does not exclude the possibility that mutation alters folding, which alters HAT binding, such a possibility is not compatible with the experimental results shown in Figure 7A (below). Mutationally blocking p65 phosphorylation at S536 greatly reduces p65 acetylation in vitro, but it does not completely abolish it, indicating that phosphorylation of other sites on p65 might also be important for p65 acetylation. Although in vivo corroboration will be important, the in vitro observation shown in Figure 6 is consistent with the possibility that full acetylation of p65 requires prior phosphorylation at S536.
|
|
Unphosphorylated p65 but not p65 phosphorylated at S536 binds to HDAC1 and 3
Phosphorylation of p65 at serine 276 triggers the releasing of HDACs and recruitment of p300 to the p65-containing complex (20). If that is true also for p65 phosphorylation on S536, then the phosphorylated p65 (S536) will recruit more p300 and be free of binding to HDACs. To test this hypothesis, we performed co-IP to examine the binding of p300 or HDACs to p65 in JB6 cells. As shown in Figure 7A, 30-min treatment with TNF-
-induced p65 binding to p300. U0126 treatment prevented the TNF-
-induced p300 binding. The effect of U0126 on p65p300 binding might be attributable both to inhibited p65 nuclear translocation and abolished p65 phosphorylation at S536. Figures 4B and 7A show that U0126 treatment partially blocked TNF-
-induced p65 nuclear translocation (
2-fold decrease). However, the decrease in nuclear p65 level appears insufficient to account for the almost completely abolished TNF-
-induced p300 binding seen upon U0126 treatment (Figure 7A). It is noteworthy that the level of p300 bound to p65 more closely parallels the level of p-p65 than the level of nuclear p65, suggesting that S536-p-p65 is limiting for p300 recruitment.
In agreement with previous findings that nuclear NF-
BHDAC1 complexes are not a regulated pool (20), the results with co-IP demonstrate that the total amount of p65-bound HDAC3 was not affected by TNF-
(Figure 7B). HDAC2 did not bind to p65 in JB6 cells (data not shown). The explanation for the TNF-induced decrease in p65 bound to HDAC1 and 3 in Figure 7C but not in 7B is not clear. It is however clear that non-phosphorylated p65, but not phosphorylated p65 (S536) binds to HDAC1 or 3. Acetylated p65 was also found not bound to HDAC1 (data not shown) suggesting that the acetylated p65 may also be phosphorylated. Together, the results suggest that phosphorylation of p65 at S536 promotes p300 recruitment to the p65 complex, and this may contribute to the induced p65 acetylation. The results demonstrate that p65 that is S536-phosphorylated and acetylated does not bind to HDAC1 and 3. The results also indicate, as did others, that TNF-
activates NF-
B target gene transcription by inducing DNA binding of a complex containing p65 that is phosphorylated at S536 and acetylated.
Phosphorylation of p65 at S536 but not at S276 or S529 is required for TNF-
-induced NF-
B/p65 transactivation
Previously, we demonstrated that insufficient p65 activation contributes to the lack of TNF-
-induced transformation in P cells (7). Although ERK activation was shown to be required for p65 transactivation, the molecular mechanism by which ERK activation regulates p65 transactivation was unknown. In this study, we hypothesized that p65 phosphorylation at particular sites provides the missing link between ERK activation and p65 transactivation in JB6 cells. We thus asked whether p65 phosphorylation at S536 is required for p65 transactivation. The p65-specific transactivational activity was measured by the Gal4 transactivation assay, which assesses the ability of the cells to activate the transactivation domain of a transcription factor independently of its DNA binding activity. As is shown in Figure 8, transactivation of wild-type p65 was induced by TNF-
. Mutation of serine 276 or serine 529 to alanine did not affect TNF-
-induced p65 transactivation. However, blocking serine 536 phosphorylation by serine to alanine mutation completely abolished TNF-
-induced p65 transactivation, demonstrating that phosphorylation at S536 is specifically required for TNF-
-induced p65 transactivation. As is shown in Figure 8, the cellular expression of each mutant was similar to that of the wild-type p65 construct, thereby excluding the possible explanation of inefficient expression. Thus, phosphorylation at S536 but not at S276 or S529 appears to be required for p65 transactivation in the JB6 transformation model.
|
Phosphorylation of p65 at S536 but not at S276 or S529 is required for TNF-
-induced JB6 cell transformationFinally, we examined whether phosphorylation of p65 at S536 is required for JB6 cell transformation. We addressed this question by comparing the transformation responses in P cells over-expressing wild-type p65 or p65 phosphorylation mutants. Previously, we demonstrated that over-expression of p65 restores P cell transformation response to TPA and TNF-
(7). Figure 9 shows that while over-expression of wild-type p65 in P cells conferred a transformation response, over-expression of p65-S536S failed to restore this response. In contrast, p65 phosphorylation mutant p65-S276A or p65-S529A conferred a transformation response similar to wild-type p65. Lack of transformation response following introduction of p65-S536A could not be attributed to lack of expression (see Figure 9) or to lack of cell viability as total viable cell numbers were similar for all four transfectant lines. To further confirm the essential role of p65 phosphorylation in cell transformation and to exclude the possibility that S536A mutation causes a structural change that contributes to non-responsiveness in P cells, we generated P pooled clones over-expressing p65-S536 phosphorylation mimic mutants (serine to aspartic acid mutation, or serine to glutamic acid mutation) and tested their transformation responses. Results presented in Figure 9C showed that both p65-S536 phosphorylation mimics rescued TNF-
induced transformation response, indicating that phosphorylation of p65 at this specific site (S536) is essential for JB6 cell transformation. Thus, these results demonstrate that phosphorylation of p65 at S536, but not at S276 or S529 is necessary for both transactivation and transformation responses to TNF-
in the JB6 model.
|
| Discussion |
|---|
|
|
|---|
The above results establish that the lack of NF-
B activation following TNF-
exposure of transformation-resistant JB6 cells can be attributed to insufficient S536 phosphorylation of p65. Lack of phosphorylation of p65 specifically at S536 in turn contributes to the resistance of P cells to TNF-
-induced cell transformation. Insufficient p65 phosphorylation in P cells arises from insufficient expression of the MAP kinase ERK. ERK activation regulates IKKß-mediated p65 phosphorylation at S536 by controlling the cellular level of IKKß and consequently its activated form. Phosphorylation of p65 at S536 is required for TNF-
-induced p65 transactivation, and contributes to TNF-
-induced p65 DNA binding. Moreover, phosphorylation of p65 at S536 appears to be required for recruiting p300, which in turn enhances acetylation of p65 and histone.
Activation of a number of kinases can signal to NF-
B activation. Among them are Akt, protein kinase C, casein kinase II and p38 (3034). These kinases exert their effects by catalyzing phosphorylation of p65 or other factors. For example, casein kinase II controls phosphorylation of p65 at serine 529 (32) and PKA is responsible for the phosphorylation of p65 at serine 276 (13,35). IKKß is responsible for S536 phosphorylation. Although both NIK and MEKK1/JNK are activated upon TNF-
stimulation and JNK activation is required for TNF-
-induced JB6 cell transformation (36), NIK and MEKK1/JNK activation are not differential in P and P+ cells. The operative IKKß kinase that explains the P/P+ differential appears to be not NIK or MEKK1 (19) but ERK. Levels of ERK and activated ERK in P cells are limiting (1) and this contributes to the lower level of activated IKKß, p65 phosphorylation and NF-
B activation in P cells. This conclusion is supported by the observation that blocking ERK activation by the MEK inhibitor U0126 blocks the TNF-
-induced p65 phosphorylation at the S536 site, known to be catalyzed by IKKß and required for activation (17). Moreover, over-expression of ERK2 in P cells produces a gain of basal and TNF-
-induced p65 phosphorylation (S536) and over-expression of dominant-negative ERK2 in P+ cells inhibits the p65 phosphorylation (S536). Thus, the results not only demonstrate the critical role of the ERK pathway in p65 phosphorylation at S536 and NF-
B activation but also provide evidence demonstrating that IKKß is the link between ERK activation and p65 phosphorylation.
Whether ERK serves as a direct or indirect upstream kinase for IKKß activation is unknown. It appears that ERK regulates IKKß primarily at the protein expression level, and consequently limits the level of activated IKKß. The level of kinase needed to activate IKKß is apparently not limiting in ERK-deficient P cells. The IKKß-activating kinase is not known. ERK might phosphorylate IKKß directly as it has several potential ERK phosphorylation sites. Alternatively ERK may function indirectly through activating another kinase such as p90RSK (37,38). Phosphorylation of IKKß may stabilize IKKß and its inhibition may lead to IKKß degradation.
Although S276 phosphorylation (35) is known to enhance NF-
B complex binding to DNA, the role of S536 phosphorylation in DNA binding had not been investigated. It appears that S536 along with additional phosphorylation sites may be required for the induced DNA binding. Acetylation of p65 at lysine 221 increases DNA binding (21). Although the p65 acetylation sites operative in this study are unknown, and over-expression of HDAC1 may deacetylate other DNA-binding proteins, the results suggest that acetylation of p65 might also be required for DNA binding. Blocking p65/histone acetylation by HDAC over-expression blocks the binding of S536 phosphorylated p65 to DNA, suggesting that S536 phosphorylation of p65 alone is not sufficient for the induction of p65DNA binding.
The fact that the phosphorylation status of p65 may regulate its interaction with nuclear cofactors such as CBP/p300 (39,40) raises the question of whether acetylation of the NF-
B proteins might depend on p65 phosphorylation. The observation that S536 phosphorylation precedes acetylation and that acetylation is inhibited when phosphorylation is blocked is consistent with the possibility that S536 phosphorylation is required for acetylation. Furthermore, results from in vitro acetylation using wild-type p65 and p65 mutant (S536A) provide support for the notion that pre-phosphorylation of p65 (S536A) is required for p65 acetylation. This may also explain the failure to acetylate p65 in vitro (41). Phosphorylation of p65 on S536 might promote the recruiting of p300 to the p65 complex, hence inducing subsequent p65 or histone acetylation. De-phosphorylation of p65, on the other hand, may inhibit the physical interaction of p65 and HAT enzyme, hence inhibiting the releasing of HDACs from p65 and thus preventing p65 acetylation. This hypothesis is further supported by the observation that p65 that is acetylated and S536-phosphorylated does not bind to HDAC in JB6 cells. Because active complexes should be free of binding to HDACs these results also indicate that the active NF-
B complex is likely to contain phosphorylated and acetylated p65.
It has been demonstrated that NF-
B activation is required for JB6 cell transformation (7), and that either ERK or p65 can rescue the transformation response in P cells (1,7). In agreement with previous findings, we demonstrated that over-expression of p65 in P cells restores the transformation response to TNF-
. How does over-expressed exogenous p65 get activated without sufficient ERK activation? One possibility is that there is insufficient I
B
to retain the over-expressed p65. Indeed, we showed previously that over-expressed exogenous p65 accumulated in the nucleus and the nuclear level of exogenous p65 correlated with P cell's ability to respond to TNF-
-induced transformation (7). Once p65 enters the nucleus, activation of p65 may involve other signaling pathways and may not be ERK dependent. The interactions of p65 with other transcription factors may also contribute to p65 activation.
In conclusion, transformation-resistant JB6 cells owe their lack of NF-
B activation response and resistance to transformation to a deficiency of ERK-dependent IKKß-mediated S536 phosphorylation of p65. Insufficient p65 phosphorylation at S536 not only leads to lack of p65 transactivation, but also contributes to the deficient p65 DNA binding and inhibited recruitment of p300 with subsequent p65 acetylation. Together, these results indicate a critical role of p65 phosphorylation in transformation. Thus, p65 phosphorylation at S536 may be a promising molecular target for cancer prevention.
| Acknowledgments |
|---|
We wish to thank Drs Matthew R.Young and George Beck for critical and helpful discussions, and Annie Rogers for help in editing the references and the manuscript.
| References |
|---|
|
|
|---|
- Huang,C., Ma,W.Y., Young,M.R., Colburn,N. and Dong,Z. (1998) Shortage of mitogen-activated protein kinase is responsible for resistance to AP-1 transactivation and transformation in mouse JB6 cells. Proc. Natl Acad. Sci. USA, 95, 156161.
[Abstract/Free Full Text] - Young,M.R., Yang,H.S. and Colburn,N.H. (2003) Promising molecular targets for cancer prevention: AP-1, NF-kappaB and Pdcd4. Trends Mol. Med., 9, 3641.[CrossRef][Web of Science][Medline]
- Dhar,A., Young,M.R. and Colburn,N.H. (2002) The role of AP-1, NF-kappaB and ROS/NOS in skin carcinogenesis: the JB6 model is predictive. Mol. Cell. Biochem., 234/235, 185193.[CrossRef]
- Reuther-Madrid,J.Y., Kashatus,D., Chen,S., Li,X., Westwick,J., Davis,R.J., Earp,H.S., Wang,C.Y. and Baldwin,A.S.,Jr (2002) The p65/RelA subunit of NF-kappaB suppresses the sustained, antiapoptotic activity of Jun kinase induced by tumor necrosis factor. Mol. Cell. Biol., 22, 81758183.
[Abstract/Free Full Text] - Karin,M., Cao,Y., Greten,F.R. and Li,Z.W. (2002) NF-kappaB in cancer: from innocent bystander to major culprit. Nature Rev. Cancer, 2, 301310.[CrossRef][Web of Science][Medline]
- Luque,I. and Gelinas,C. (1997) Rel/NF-kappa B and I kappa B factors in oncogenesis. Semin. Cancer Biol., 8, 103111.[CrossRef][Web of Science][Medline]
- Hsu,T.-C., Nair,R., Tulsian,P., Hegamyer,G., Young,M.R. and Colburn,N.H. (2001) Transformation non-responsive cells owe their resistance to lack of NF-
B activation. Cancer Res., 61, 41604168.[Abstract/Free Full Text] - Li,J.J., Westergaard,C., Ghosh,P. and Colburn,N.H. (1997) Inhibitors of both nuclear factor-kappaB and activator protein-1 activation block the neoplastic transformation response. Cancer Res., 57, 35693576.
[Abstract/Free Full Text] - Pomerantz,J.L. and Baltimore,D. (2002) Two pathways to NF-kappaB. Mol. Cell, 10, 693695.[CrossRef][Web of Science][Medline]
- Karin,M. (1999) The beginning of the end: IkappaB kinase (IKK) and NF-kappaB activation. J. Biol. Chem., 274, 2733927342.
[Free Full Text] - Sizemore,N., Leung,S. and Stark,G.R. (1999) Activation of phosphatidylinositol 3-kinase in response to interleukin-1 leads to phosphorylation and activation of the NF-kappaB p65/RelA subunit. Mol. Cell. Biol., 19, 47984805.
[Abstract/Free Full Text] - Anrather,J., Csizmadia,V., Soares,M.P. and Winkler,H. (1999) Regulation of NF-kappaB RelA phosphorylation and transcriptional activity by p21 (ras) and protein kinase Czeta in primary endothelial cells. J. Biol. Chem., 274, 1359413603.
[Abstract/Free Full Text] - Zhong,H., SuYang,H., Erdjument-Bromage,H., Tempst,P. and Ghosh,S. (1997) The transcriptional activity of NF-kappaB is regulated by the IkappaB-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell, 89, 413424.[CrossRef][Web of Science][Medline]
- Deng,W.G., Zhu,Y. and Wu,K.K. (2003) Up-regulation of p300 binding and p50 acetylation in tumor necrosis factor-alpha-induced cyclooxygenase-2 promoter activation. J. Biol. Chem., 278, 47704777.
[Abstract/Free Full Text] - Wang,D. and Baldwin,A.S.,Jr (1998) Activation of nuclear factor-kappaB-dependent transcription by tumor necrosis factor-alpha is mediated through phosphorylation of RelA/p65 on serine 529. J. Biol. Chem., 273, 2941129416.
[Abstract/Free Full Text] - Madrid,L.V., Mayo,M.W., Reuther,J.Y. and Baldwin,A.S.,Jr (2001) Akt stimulates the transactivation potential of the RelA/p65 Subunit of NF-kappa B through utilization of the Ikappa B kinase and activation of the mitogen-activated protein kinase p38. J. Biol. Chem., 276, 1893418940.
[Abstract/Free Full Text] - Jiang,X., Takahashi,N., Matsui,N., Tetsuka,T. and Okamoto,T. (2003) The NF-kappa B activation in lymphotoxin beta receptor signaling depends on the phosphorylation of p65 at serine 536. J. Biol. Chem., 278, 919926.
[Abstract/Free Full Text] - Sakurai,H., Chiba,H., Miyoshi,H., Sugita,T. and Toriumi,W. (1999) IkappaB kinases phosphorylate NF-kappaB p65 subunit on serine 536 in the transactivation domain. J. Biol. Chem., 274, 3035330356.
[Abstract/Free Full Text] - Nakano,H., Shindo,M., Sakon,S., Nishinaka,S., Mihara,M., Yagita,H. and Okumura,K. (1998) Differential regulation of IkappaB kinase alpha and beta by two upstream kinases, NF-kappaB-inducing kinase and mitogen-activated protein kinase/ERK kinase kinase-1. Proc. Natl Acad. Sci. USA, 95, 35373542.
[Abstract/Free Full Text] - Zhong,H., May,M.J., Jimi,E. and Ghosh,S. (2002) The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol. Cell, 9, 625636.[CrossRef][Web of Science][Medline]
- Chen,L.F., Mu,Y. and Greene,W.C. (2002) Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-kappaB. EMBO J., 21, 65396548.[CrossRef][Web of Science][Medline]
- Chen,L., Fischle,W., Verdin,E. and Greene,W.C. (2001) Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science, 293, 16531657.
[Abstract/Free Full Text] - Kiernan,R., Bres,V., Ng,R.W., Coudart,M.P., El Messaoudi,S., Sardet,C., Jin,D.Y., Emiliani,S. and Benkirane,M. (2003) Post-activation turn-off of NF-kappa B-dependent transcription is regulated by acetylation of p65. J. Biol. Chem., 278, 27582766.
[Abstract/Free Full Text] - Furia,B., Deng,L., Wu,K., Baylor,S., Kehn,K., Li,H., Donnelly,R., Coleman,T. and Kashanchi,F. (2002) Enhancement of nuclear factor-kappa B acetylation by coactivator p300 and HIV-1 Tat proteins. J. Biol. Chem., 277, 49734980.
[Abstract/Free Full Text] - Cheung,P., Tanner,K.G., Cheung,W.L., Sassone-Corsi,P., Denu,J.M. and Allis,C.D. (2000) Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation. Mol. Cell, 5, 905915.[CrossRef][Web of Science][Medline]
- Lo,W.S., Trievel,R.C., Rojas,J.R., Duggan,L., Hsu,J.Y., Allis,C.D., Marmorstein,R. and Berger,S.L. (2000) Phosphorylation of serine 10 in histone H3 is functionally linked in vitro and in vivo to Gcn5-mediated acetylation at lysine 14. Mol. Cell, 5, 917926.[CrossRef][Web of Science][Medline]
- Frost,J.A., Geppert,T.D., Cobb,M.H. and Feramisco,J.R. (1994) A requirement for extracellular signal-regulated kinase (ERK) function in the activation of AP-1 by Ha-Ras, phorbol 12-myristate 13-acetate and serum. Proc. Natl Acad. Sci. USA, 91, 38443848.
[Abstract/Free Full Text] - Okazaki,T., Sakon,S., Sasazuki,T., Sakurai,H., Doi,T., Yagita,H., Okumura,K. and Nakano,H. (2003) Phosphorylation of serine 276 is essential for p65 NF-kappaB subunit-dependent cellular responses. Biochem. Biophys. Res. Commun., 300, 807812.[CrossRef][Web of Science][Medline]
- Zhong,S., Zhang,Y., Jansen,C., Goto,H., Inagaki,M. and Dong,Z. (2001) MAP kinases mediate UVB-induced phosphorylation of histone H3 at serine 28. J. Biol. Chem., 276, 1293212937.
[Abstract/Free Full Text] - Kane,L.P., Mollenauer,M.N., Xu,Z., Turck,C.W. and Weiss,A. (2002) Akt-dependent phosphorylation specifically regulates Cot induction of NF-kappa B-dependent transcription. Mol. Cell. Biol., 22, 59625974.
[Abstract/Free Full Text] - Leitges,M., Sanz,L., Martin,P. et al. (2001) Targeted disruption of the zetaPKC gene results in the impairment of the NF-kappaB pathway. Mol. Cell, 8, 771780.[CrossRef][Web of Science][Medline]
- Wang,D., Westerheide,S.D., Hanson,J.L. and Baldwin,A.S.,Jr (2000) Tumor necrosis factor alpha-induced phosphorylation of RelA/p65 on Ser529 is controlled by casein kinase II. J. Biol. Chem., 275, 3259232597.
[Abstract/Free Full Text] - Saccani,S., Pantano,S. and Natoli,G. (2001) Two waves of nuclear factor kappaB recruitment to target promoters. J. Exp. Med., 193, 13511359.
[Abstract/Free Full Text] - Saccani,S., Pantano,S. and Natoli,G. (2002) p38-Dependent marking of inflammatory genes for increased NF-kappa B recruitment. Nature Immunol., 3, 6975.[CrossRef][Web of Science][Medline]
- Zhong,H., Voll,R.E. and Ghosh,S. (1998) Phosphorylation of NF-kappa B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol. Cell, 1, 661671.[CrossRef][Web of Science][Medline]
- Huang,C., Li,J., Ma,W.Y. and Dong,Z. (1999) JNK activation is required for JB6 cell transformation induced by tumor necrosis factor-alpha but not by 12-O-tetradecanoylphorbol-13-acetate. J. Biol. Chem., 274, 2967229676.
[Abstract/Free Full Text] - Frodin,M. and Gammeltoft,S. (1999) Role and regulation of 90 kDa ribosomal S6 kinase (RSK) in signal transduction. Mol. Cell. Endocrinol., 151, 6577.[CrossRef][Web of Science][Medline]
- Smith,J.A., Poteet-Smith,C.E., Malarkey,K. and Sturgill,T.W. (1999) Identification of an extracellular signal-regulated kinase (ERK) docking site in ribosomal S6 kinase, a sequence critical for activation by ERK in vivo. J. Biol. Chem., 274, 28932898.
[Abstract/Free Full Text] - Perkins,N.D., Felzien,L.K., Betts,J.C., Leung,K., Beach,D.H. and Nabel,G.J. (1997) Regulation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science, 275, 523527.
[Abstract/Free Full Text] - Gerritsen,M.E., Williams,A.J., Neish,A.S., Moore,S., Shi,Y. and Collins,T. (1997) CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl Acad. Sci. USA, 94, 29272932.
[Abstract/Free Full Text] - Adam,E., Quivy,V., Bex,F. et al. (2003) Potentiation of tumor necrosis factor-induced NF-kappaB activation by deacetylase inhibitors is associated with a delayed cytoplasmic reappearance of IkappaBalpha. Mol. Cell. Biol., 23, 62006209.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
Y.-S. Piao, Y.-C. Du, H. Oshima, J.-C. Jin, M. Nomura, T. Yoshimoto, and M. Oshima Platelet-type 12-lipoxygenase accelerates tumor promotion of mouse epidermal cells through enhancement of cloning efficiency Carcinogenesis, February 1, 2008; 29(2): 440 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Bristow, R. Wolkowicz, M. Trucy, A. Franklin, F. Di Meo, M. T. Kozlowski, R. Winston, and R. R. Arnold NF-{kappa}B Signaling, Elastase Localization, and Phagocytosis Differ in HIV-1 Permissive and Nonpermissive U937 Clones J. Immunol., January 1, 2008; 180(1): 492 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kanda and S. Watanabe Histamine enhances the production of human -defensin-2 in human keratinocytes Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1916 - C1923. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kanda and S. Watanabe Prolactin Enhances Interferon-{gamma}-Induced Production of CXC Ligand 9 (CXCL9), CXCL10, and CXCL11 in Human Keratinocytes Endocrinology, May 1, 2007; 148(5): 2317 - 2325. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lu, W. Ouyang, and C. Huang Inflammation, a Key Event in Cancer Development Mol. Cancer Res., April 1, 2006; 4(4): 221 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Hoberg, A. E. Popko, C. S. Ramsey, and M. W. Mayo I{kappa}B Kinase {alpha}-Mediated Derepression of SMRT Potentiates Acetylation of RelA/p65 by p300 Mol. Cell. Biol., January 15, 2006; 26(2): 457 - 471. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Feng, Y. Ohmori, and P.-L. Chang Production of chemokine CXCL1/KC by okadaic acid through the nuclear factor-{kappa}B pathway Carcinogenesis, January 1, 2006; 27(1): 43 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Murakami, T. Shigemori, and H. Ohigashi Zingiberaceous and Citrus Constituents, 1'-Acetoxychavicol Acetate, Zerumbone, Auraptene, and Nobiletin, Suppress Lipopolysaccharide-Induced Cyclooxygenase-2 Expression in RAW264.7 Murine Macrophages through Different Modes of Action J. Nutr., December 1, 2005; 135(12): 2987S - 2992S. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M Lindstrom and P. R Bennett 15-Deoxy-{Delta}12,14-Prostaglandin J2 Inhibits Interleukin-1{beta}-Induced Nuclear Factor-{kappa}B in Human Amnion and Myometrial Cells: Mechanisms and Implications J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3534 - 3543. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, Y. Ma, J. Zhang, J. Cheng, and J. Du A New Cellular Signaling Mechanism for Angiotensin II Activation of NF-{kappa}B: An I{kappa}B-Independent, RSK-Mediated Phosphorylation of p65 Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1148 - 1153. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hu and N. H. Colburn Histone Deacetylase Inhibition Down-Regulates Cyclin D1 Transcription by Inhibiting Nuclear Factor-{kappa}B/p65 DNA Binding Mol. Cancer Res., February 1, 2005; 3(2): 100 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Buss, A. Dorrie, M. L. Schmitz, R. Frank, M. Livingstone, K. Resch, and M. Kracht Phosphorylation of Serine 468 by GSK-3{beta} Negatively Regulates Basal p65 NF-{kappa}B Activity J. Biol. Chem., November 26, 2004; 279(48): 49571 - 49574. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



















