Skip Navigation


Carcinogenesis Advance Access originally published online on May 13, 2004
Carcinogenesis 2004 25(10):2005-2013; doi:10.1093/carcin/bgh183
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/10/2005    most recent
bgh183v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, Z.-H.
Right arrow Articles by Surh, Y.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.-H.
Right arrow Articles by Surh, Y.-J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis vol.25 no.10 © Oxford University Press 2004; all rights reserved.

ARTICLE

Resveratrol inhibits TCDD-induced expression of CYP1A1 and CYP1B1 and catechol estrogen-mediated oxidative DNA damage in cultured human mammary epithelial cells

Zhi-Hua Chen1, Yeon-Jin Hurh1, Hye-Kyung Na1, Jung-Hwan Kim1, Young-Jin Chun2, Dong-Hyun Kim3, Kyung-Sun Kang4, Myung-Haing Cho4 and Young-Joon Surh1,5

1 College of Pharmacy, Seoul National University, Seoul 151-742, South Korea, 2 College of Pharmacy, Chung-Ang University, Seoul 156-756, South Korea, 3 Korean Institute of Science and Technology, Seoul 136-791, South Korea and 4 College of Veterinary Medicine, Seoul National University, Seoul 151-742, South Korea

5 To whom correspondence should be addressed Email: surh{at}plaza.snu.ac.kr


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Resveratrol (3,5,4'-trihydroxystilbene), a naturally occurring phytoalexin present in grapes and other foods, has been reported to possess chemopreventive effects as revealed by its striking inhibition of diverse cellular events associated with tumor initiation, promotion and progression. In our present study, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), when treated with the cultured human mammary epithelial (MCF-10A) cells, induced the expression of cytochrome P450 1A1 (CYP1A1) and 1B1 (CYP1B1) that are responsible for the oxidation of 17ß-estradiol to produce catechol estrogens. Resveratrol strongly inhibited the TCDD-induced aryl hydrocarbon receptor (AhR) DNA binding activity, the expression of CYP1A1 and CYP1B1 and their catalytic activities in MCF-10A cells. It also reduced the formation of 2-hydroxyestradiol and 4-hydroxyestradiol from 17ß-estradiol by recombinant human CYP1A1 and CYP1B1, respectively. Furthermore, resveratrol significantly attenuated the intracellular reactive oxygen species (ROS) formation and oxidative DNA damage as well as the cytotoxicity induced by the catechol estrogens. Our data suggest that CYP1A1- and CYP1B1-catalyzed catechol estrogen formation might play a key role in TCDD-induced oxidative damage, and resveratrol can act as a potential chemopreventive against dioxin-induced human mammary carcinogenesis by blocking the metabolic formation of the catechol estrogens and scavenging the ROS generated during their redox cycling.

Abbreviations: AhR, aryl hydrocarbon receptor; CYP, cytochrome P450; dGuo, 2'-deoxyguanosine; DCF-DA, dichlorofluorescein diacetate; DTT, dithiothreitol; E2, 17ß-estradiol; EROD, 7-ethoxyresorufin O-deethylation; 2-OHE2, 2-hydroxyestradiol; 4-OHE2, 4-hydroxyestradiol; 8-oxo-dGuo, 8-oxo-7,8-dihydro-2'-deoxyguanosine; ROS, reactive oxygen species; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Breast cancer has become one of the most important malignant disorders among women all over the world. It has been reported that one in 10 women in the US develops breast cancer, and over 40 000 per year are expected to die from this disease (1,2). Etiology of breast carcinogenesis depends on several parameters, such as the absence or presence of the estrogen receptor, exposure to xenobiotics and/or genetic factors. The accidental human exposure to ubiquitous environmental contaminants such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and other halogenated aromatic hydrocarbons has been well documented (35). It is widely accepted that the majority of biological effects of TCDD in higher organisms are mediated through activation of cytosolic aryl hydrocarbon receptor (AhR). Upon ligand binding, the activated AhR translocates into the nucleus where it interacts with the xenobiotic responsive element (XRE) (6,7), responsible for regulating expression of several isoforms of cytochrome P450 (CYP) enzymes, including CYP1A1, CYP1A2 and CYP1B1, and some of the phase II detoxification enzymes.

Estrogen and estradiol can stimulate cancer cell growth by triggering estrogen receptor-mediated signal transduction, resulting in increased DNA synthesis and cell proliferation (8). Estrogen metabolites formed by cytochrome P450 s may also play a role in the initiation of cancer. CYP1A1 and CYP1B1 are responsible for hydroxylation of 17ß-estradiol (E2) at the C-2 and C-4 positions, respectively, resulting in the formation of 2-hydroxyestradiol (2-OHE2) and 4-hydroxyestradiol (4-OHE2). These catechol estrogens can be oxidized to quinones, which are putative tumor initiators (913). 2,3-Estradiol quinone derived from 2-OHE2 reacts with DNA to form stable adducts, which do not seem to generate mutations. In contrast, 3,4-estradiol quinone, derived from 4-OHE2, forms depurinating adducts, which readily leads to genotoxic events (1015). Therefore, the extent of CYP1B1 expression appears to be a critical determinant of the metabolism and toxicity of estrogens in mammary cells and may hence serve as a potential biomarker for hormonal carcinogenesis (13,16).

Reseveratrol (3,5,4'-trihydroxystilbene), a naturally occurring compound present in grapes and other foods, has been reported to exert chemopreventive effects in diverse in vitro and in vivo systems (1719). Our previous studies also demonstrated some chemopreventive and chemoprotective activities of resveratrol (2023). Recently, reseveratrol has been reported to act as an AhR antagonist and inhibits TCDD-induced CYP1A1 expression (2428). It also has inhibitory effects on the catalytic activities of certain CYP isoforms (2932). In this work, we have explored the possible inhibitory effects of resveratrol on TCDD-induced expression and activities of CYP1A1 and CYP1B1 responsible for catechol estrogen formation in the human mammary epithelial MCF-10A cell line. We also investigated the protective effects of resveratrol on 2-OHE2- and 4-OHE2-induced cytotoxicity, intracellular reactive oxygen species (ROS) accumulation and oxidative DNA damage. Our data suggest that resveratrol, by inhibiting both expression and catalytic activity of CYP1A1 and CYP1B1, inhibits the formation of catechol estrogens and their subsequent oxidation, thereby attenuating oxidative DNA damage and possibly neoplastic transformation in human mammary epithelial cells.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Materials
Resveratrol (~99% purity), E2, 2-OHE2, 4-OHE2, 2'-deoxyguanosine (dGuo) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo) were purchased from Sigma Chemical (St Louis, MO). TCDD was a product of Pierce Biotechnology (Rockford, IL). Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum and horse serum were obtained from Gibco BRL (Grand Island, NY). Dichlorofluorescein diacetate (DCF-DA) was obtained from Molecular Probes (Eugene, OR). All other chemicals used were of analytical grade or the highest grade available.

Cell culture
The MCF-10A cell line, originally established at the Michigan Cancer Foundation in the US, was a generous gift from Dr Aree Moon of Duksung Women's University, Seoul, South Korea. Cells were cultured with medium containing DMEM/F12, 10 µg/ml insulin (bovine), 100 ng/ml Cholera toxin, 0.5 µg/ml hydrocortisone, 20 ng/ml recombinant human epidermal growth factor, 0.5 µg/ml fungi zone, 2 mM L-glutamine, 100 µg/ml penicillin/streptomycin mixture, and 5% horse serum at 37°C in a humidified atmosphere of 5% CO2/95% air.

Western blot analysis for CYP1A1 and CYP1B1
After treatment, cells were washed with phosphate-buffered saline (PBS) and then lysed at 4°C for 20 min in lysis buffer [150 mM NaCl, 50 mM Tris–HCl, pH 7.4, 25 mM NaF, 20 mM EGTA, 0.5% Triton X-100, 1 mM dithiothreitol (DTT) and 1 mM Na3VO4 with a protease inhibitor cocktail tablet]. Nuclei and unlysed cellular debris were removed by centrifugation. The protein concentration was determined by using the BCA protein assay kit (Pierce Biotechnology, Rockford, IL). Protein samples were solubilized with SDS–polyacrylamide gel electrophoresis sample loading buffer and electrophoresed on a 12% SDS–polyacrylamide gel. Proteins were transferred to polyvinylidene difluoride membranes at 300 mA for 3 h. The blots were blocked for 1 h at room temperature in fresh blocking buffer (0.1% Tween-20 in PBS, containing 5% non-fat dry milk). Dilutions of primary anti-CYP1A1 and anti-CYP1B1 antibodies (Genetest, MA, USA) were made in PBS with 3% non-fat dry milk. The blots were incubated with primary antibody for 3 h at room temperature. Following three washes with PBST (PBS and 0.1% Tween-20), the blots were incubated with horseradish peroxidase-conjugated secondary antibodies in PBS with 3% non-fat dry milk for 1 h at room temperature. The blots were washed again three times in PBST buffer, and transferred proteins were incubated with ECL solution (Amersham Pharmacia Biotech, Piscataway, NJ) for 1 min, and visualized with radiographic film.

Northern blot analysis for CYP1A1 and CYP1B1 mRNA expression
Total RNA was isolated from cells using TRIzol® Regent (Gibco BRL, Life Technologies). Each RNA sample (10 µg) was electrophoresed through a 1.0% agarose–formaldehyde gel in 1x MOPS buffer. The electrophoresed gel was stained for 2 min with an acridine orange (final concentration 3 µg/ml) solution diluted with autoclaved distilled water, washed twice with distilled water for 20 min, and photographed under UV light to visualize 28S and 18S rRNA as size markers. The gel was transferred by capillary action overnight onto a nylon membrane, which was then UV-crosslinked. The complementary DNA probes for CYP1A1 and CYP1B1 were generous gifts from Dr Tzuu-Huei Ueng of the National Taiwan University. The membrane was subsequently hybridized with 32P-labeled CYP1A1 and CYP1B1 cDNA probes prepared by using random primers DNA labeling. After hybridization, the blots were rinsed for 20 min with washing solutions [2x standard saline citrate (SSC) plus 0.1% SDS, 0.5x SSC plus 0.1% SDS, and 0.1x SSC plus 0.1% SDS]. Bands were developed after exposure of the X-ray film at –70°C. The loading controls were 28S and 18S rRNAs.

Reverse transcriptase–polymerase chain reaction (RT–PCR) analysis for CYP1A1 and CYP1B1 mRNA expression
After treatment and RNA isolation, 1 µg of total RNA was added into the 20 µl RT reaction mixture containing 10 µM oligo dT, 10 mM DTT and 400 U of M-MLV reverse transcriptase. The reaction was incubated at 42°C for 50 min and heated to 72°C for 15 min to inactivate the enzyme. Two-microliters of the synthesized cDNA was subjected to PCR amplification with 0.5 µM special primers in a 20-µl reaction containing 0.2 mM dNTPs and 1.25 U Taq polymerase. DNA was denatured at 95°C for 5 min and cycled immediately 35 times (for CYP1A1), 25 times (for CYP1B1) or 30 times (for GAPDH) at 94°C for 30 s with specific annealing temperatures chosen by preliminary experiments: 49°C (CYP1A1), 58°C (CYP1B1) and 63°C (GAPDH) for 30 s, and extended at 72°C for 1 min. The PCR reaction ended with a 5-min incubation at 72°C. Oligonucleotides used for PCR amplification and the putative length of the primers as described elsewhere (33) are as follows: gene sequence (5'- to 3'-) CYP1A1 (S), TCTTTCTCTTCCTGGCTATC; CYP1A1 (AS), CTGTCTCTTCCCTTCACTCT; CYP1B1 (S), AACGTCATGAGTGCCGTGTGT; CYP1B1 (AS), GGCCGGTACGTTCTCCAAATC; GAPDH (S), CCACCCATGGCAAATTCCATGGCA; GAPDH (AS), TCTAGACGGCAGGTCAGGTCCACC (abbreviations: S, sense; AS, antisense).

Nuclear protein extraction and electromobility gel shift assay
After treatment, cells were washed with PBS, centrifuged and re-suspended in ice-cold isotonic buffer A [10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT and 0.2 mM phenylmethylsulfonyl fluoride (PMSF)]. Following incubation on ice for 10 min, the mixture was centrifuged and the resulting pellets were re-suspended in ice-cold buffer C [20 mM HEPES (pH 7.9), 20% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT and 0.2 mM PMSF] and incubated on ice for 20 min. After vortex-mixing and centrifugation, the supernatant was stored at –70°C for the AhR DNA binding assay. XRE oligomers (5'-GATCCGGCTCTTCTCACGCAACTCCGAGCTCA-3' and 5'-GATCTGAGCCTGGAGTTGCGTGAGAAGAGCC-3', with underline representing the XRE core sequence) (34) were annealed and labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase and separated from unincorporated [{gamma}-32P]ATP by gel filtration using a nick spin column (Pharmacia, Uppsala, Sweden). Prior to the addition of the radiolabeled oligonucleotide (100 000 c.p.m.), 10 µg of the nuclear extract was kept on ice for 15 min in gel shift binding buffer [4% glycerol, 1 mM EDTA, 1 mM DTT, 100 mM NaCl, 10 mM Tris–HCl (pH 7.5), and 0.1 mg/ml sonicated salmon sperm DNA]. DNA–protein complexes were resolved by 6% non-denaturating polyacrylamide gel at 200 V for 2 h followed by autoradiography.

Measurement of CYP1A1 and CYP1B1 activity in MCF-10A cells
Ethoxyresorufin-O-deethylation (EROD) activity in MCF-10A cells was determined as a measure of CYP1A1 and CYP1B1 activities. Cells were plated onto 12-well plates and exposed to TCDD (2 nM) or DMSO (0.1% v/v). After 72 h, the media were replaced with 50 mM MgCl2, 5 µM 7-ethoxyresorufin and 10 µM dicumarol. The fluorescence was determined at an excitation wavelength of 530 nm with emission at 590 nm every 5 min until an optimum was reached.

HPLC analysis of catechol estrogen formation
Recombinant human CYP1A1 and CYP1B1 microsomes were purchased from GENTEST Co. (Woburn, MA). The standard incubation mixture consisted of microsomes (50 µg), 2 mM ascorbic acid, 2 mM NADPH and 10 µM of E2 in a final volume of 0.2 ml 100 mM potassium phosphate buffer (pH 7.4). Incubations were carried out at 37°C for 30 min and terminated by extraction twice with the same volume of ethyl acetate. The combined organic phase was evaporated to dryness under a gentle stream of nitrogen gas. The residue was dissolved in a mixture of methanol:water (4:1, v/v). Catechol estrogens were analyzed by HPLC coupled with an electrochemical detector (ESA, Chelmsford, MA) using a C18 reverse-phase column (4 µm, 3.9 x 150 mm). Elution was achieved with the gradient flow at a rate of 1.0 ml/min: 0–30 min, 100% mobile phase A (acetonitrile:methanol:water, 15:5:80, v/v/v) to 40% mobile phase B (acetonitrile:methanol:water, 50:20:30, v/v/v); 30–40 min, 40–100% mobile phase B; 40–50 min, 100% mobile phase B. The amounts of 2-OHE2 and 4-OHE2 were calculated from the corresponding peak areas.

Determination of cell proliferation
Cells were cultured in 6-well dish and co-treated with [methyl-3H]thymidine at a final concentration of 1 µCi/ml and varying concentrations of catechol estrogen in the presence or absence of resveratrol. After 24 h incubation, cells were trypsinized, washed with PBS and centrifuged. The supernatant was removed, and ice-cold 10% trichloroacetic acid (TCA) solution (20 µl) was added to the pellet, followed by vortex-mixing. The mixture was centrifuged, and the resulting pellet was mixed with 400 µl of 0.2 N NaOH (with 0.5% SDS) and further incubated at 37°C for 30 min. After incubation, samples were mixed with 1 N HCl (68 µl) and 1 ml cocktail solution. Radioactivity in TCA-precipitable material was measured by liquid scintillation counting.

Measurement of intracellular ROS accumulation
To monitor intracellular accumulation of ROS, the fluorescent probe DCF-DA was used. Following treatment, cells were rinsed with Kreb's ringer solution, and 10 µM DCF-DA was loaded. After a 15-min incubation at 37°C, the cells were examined under a confocal microscope equipped with an argon laser (488 nm, 200 mW).

HPLC analysis of 8-oxo-dGuo formation
DNA was isolated from the cell lysates, as described in the protocol supplied with the DNA extractor WB kit (Wako Pure Chemicals, Nagoya, Japan). Isolated DNA samples were subjected to hydrolysis in 100 µl of 20 mM sodium acetate buffer (pH 5.0), using 3 µl of 5 mg/ml nuclease P1 (Sigma) at 37°C for 30 min. After the pH of the solution was adjusted to 8.0 by addition of 10 µl of 1 M Tris–HCl buffer (pH 8.5), 2 U of calf intestine alkaline phosphatase was added, and the incubation was continued at 37°C for an additional 1 h. The reaction was terminated by the addition of 250 mM sodium acetate (pH 5.0) and 4 mM EDTA. The hydrolysates were centrifuged at 15 000 g for 30 min at 4°C and analyzed by HPLC coupled with the electrochemical detector (ESA, Chelmsford, MA) using a C18 reverse-phase column (4 µm; 3.9 x 150 mm). Products were eluted with 10% methanol in 50 mM sodium phosphate buffer (pH 5.0), at a flow rate of 0.5 ml/min. The amounts of 8-oxo-dGuo and dGuo were calculated from the corresponding peak areas, and the results were expressed as the ratio of 8-oxo-dGuo to 105 dGuo.

Statistical analysis
When necessary, data were expressed as means ± SD, and statistical analysis for single comparison was performed using the Student's t test. The criterion for statistical significance was P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Inhibitory effects of resveratrol on TCDD-induced CYP1A1 and CYP1B1 expression
TCDD-induced CYP1A1 and CYP1B1 expression in MCF-10A cells was assessed by western blot assay, northern blot assay and RT–PCR. Western blot analysis showed that treatment of MCF-10A cells with 1 or 10 nM TCDD for 6, 24 or 72 h resulted in a progressive induction of CYP1A1 and CYP1B1, which was time- and concentration-dependent (Figure 1A). Resveratrol co-treated with TCDD for 3 days significantly suppressed the TCDD-induced expression of CYP1A1 and CYP1B1 (Figure 1B) and their mRNA transcripts (Figure 1C), which was concentration-dependent. TCDD-induced expression of CYP1A1 was almost completely suppressed by resveratrol at 20 µM as assessed by western and northern blot analyses, while the CYP1B1 expression was affected to a lesser extent. We also verified the inhibitory effects of resveratrol on transcription of CYP1A1 and CYP1B1 by RT–PCR (Figure 1D), although the extent of inhibition was less prominent compared with that observed in the northern blot analysis. Furthermore, resveratrol at 50 µM alone reduced the constitutive expression of CYP1B1 and its mRNA transcripts (Figure 1B and D).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1. Inhibitory effects of resveratrol on TCDD-induced CYP1A1 and CYP1B1 expression in MCF-10A cells. (A) Western blot analysis for TCDD-induced CYP1A1 and CYP1B1 protein expression. Cells were treated with 1 or 10 nM TCDD for 6 h, 1 or 3 days. (B) Inhibitory effects of resveratrol on TCDD-induced CYP1A1 and CYP1B1 protein expression. (C) Northern blot analysis for the inhibitory effects of resveratrol on TCDD-induced CYP1A1 and CYP1B1 mRNA expression. (D) RT–PCR analysis for the inhibitory effects of resveratrol on TCDD-induced CYP1A1 and CYP1B1 mRNA expression. In (B), (C) and (D) cells were treated with 2 nM TCDD in the absence or presence of indicated concentrations of resveratrol for 3 days.

 
TCDD-induced AhR DNA binding was suppressed by pre-treatment of resveratrol
Resveratrol was found recently to act as an AhR antagonist (2428). We, therefore, assessed the possible inhibitory effects of resveratrol on TCDD-induced DNA binding activity of AhR in MCF-10A cells. In TCDD-stimulated MCF-10A cells, the AhR DNA binding activity peaked at ~1 h (Figure 2A), which was suppressed by resveratrol (Figure 2B). Resveratrol at 50 µM alone did not influence the AhR DNA binding activity.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2. Effects of resveratrol on TCDD-induced AhR DNA binding activity. (A) Time-dependent behavior of AhR DNA binding activity induced by 10 nM TCDD in MCF-10A cells. MCF-10A cells were treated with 10 nM TCDD for various times as described in the figure. (B) Effects of resveratrol on suppressing TCDD-induced AhR DNA binding activity. MCF-10A cells were pre-treated with 20 or 50 µM resveratrol for 30 min and followed by addition of 10 nM TCDD for 1 h.

 
Resveratrol inhibited the CYP enzyme activities
The catalytic activities of CYP1A1 and CYP1B1 were measured by the EROD assay. As illustrated in Figure 3, treatment of MCF-10A cells with 2 nM TCDD for 3 days significantly increased the EROD activity (~5-fold induction). Resveratrol exerted a concentration-dependent inhibition of the TCDD-induced EROD activity. Resveratrol at 50 µM abolished the enzyme activity completely (Figure 3).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Inhibitory effects of resveratrol on the TCDD-induced EROD activity. MCF-10A cells were treated with 2 nM TCDD in the absence or presence of indicated concentrations of resveratrol for 3 days. *Significantly different from the value without resveratrol co-treatment (P < 0.01). Values are means ± SD (n = 3).

 
Inhibitory effects of resveratrol on the catechol estrogen formation by recombinant human CYP1A1 and CYP1B1
Catechol estrogen formation from E2 by CYP1A1 and CYP1B1 was analyzed by HPLC equipped with an electrochemical detector. Incubation of 10 µM E2 together with 50 µg recombinant human CYP1A1 and CYP1B1 predominantly produced 2-OHE2 and 4-OHE2, respectively (Table I). Addition of resveratrol to the incubation solution significantly inhibited the formation of both 2-OHE2 (Figure 4A) and 4-OHE2 (Figure 4B). The IC50 values for inhibition of catalytic activities of CYP1A1 and CYP1B1 by resveratrol were ~2 and 25 µM, respectively.


View this table:
[in this window]
[in a new window]
 
Table I. Relative rates of catechol estrogen formation from 17ß-estradiol catalyzed by recombinant human CYP1A1 and CYP1B1

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Inhibitory effects of resveratrol on catechol estrogen formation catalyzed by recombinant human CYP1A1 (A) and CYP1B1 (B). E2 (10 µM) was incubated with recombinant human CYP1A1 or CYP1B1 microsomes at 37°C for 30 min, and the resulting catechol estrogens were isolated and identified as described in Materials and methods. *Significantly different from the value without resveratrol co-treatment (P < 0.01). Values are means ± SD (n = 3).

 
Resveratrol inhibited ROS accumulation induced by TCDD and E2
Intracellular ROS accumulation can be measured by the use of DCF-DA, which is freely permeable to the cell membrane. Once inside cells, the compound is hydrolyzed to DCF by the cellular esterase activity, which interacts with peroxides to form fluorescent 2',7'-dichlorofluorescin. Treatment of MCF-10A cells with 1 µM 17ß-estradiol alone for 6 h failed to cause an appreciable increase in ROS accumulation (Figure 5B). Stimulation with TCDD alone, exhibited slight enhancement of intracellular ROS formation (Figure 5C). However, treatment of MCF-10A cells with 10 nM TCDD for 3 days followed by exposure to 1 µM 17ß-estradiol for an additional 6 h dramatically enhanced ROS accumulation (Figure 5D), which was significantly reduced by 20 µM resveratrol (Figure 5E). Resveratrol at this concentration alone did not influence an intracellular ROS level (Figure 5F).



View larger version (106K):
[in this window]
[in a new window]
 
Fig. 5. Effects of resveratrol on TCDD plus E2-induced ROS accumulation in MCF-10A cells. Cells were treated with DMSO (A), 1 µM E2 for 6 h (B), 10 nM TCDD for 3 days (C) or 3-day stimulation with 10 nM TCDD followed by exposure to 1 µM E2 in the absence (D) or presence (E) of 20 µM resveratrol for 6 h. (F) Represents cells treated with 20 µM resveratrol alone.

 
TCDD in combination with 17ß-estradiol induced oxidative DNA damage
8-Oxo-dGuo is recognized as the hallmark of oxidative DNA damage. Treatment of MCF-10A cells with 10 nM TCDD for 3 days in combination with 1 µM 17ß-estradiol treatment for 6 h significantly increased the 8-oxo-dGuo level, which was abrogated by resveratrol (Figure 6). Either TCDD or 17ß-estradiol alone did not cause 8-oxo-dGuo formation, which was consistent with the ROS accumulation data (Figure 5).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Effects of resveratrol on oxidative DNA damage induced by TCDD and E2 in MCF-10A cells. 8-oxo-dGuo and dGuo were detected by HPLC as described in the Materials and methods. MCF-10A cells were treated with DMSO or 10 nM TCDD for 3 days, followed by treatment with 1 µM E2 in the absence or presence of 20 µM resveratrol for 6 h in fresh media. Values are means ± SD (n = 3).

 
Resveratrol protected MCF-10A cells against catechol estrogen-induced cytotoxicity
In order to further confirm the possible involvement of catechol estrogens in TCDD-induced oxidative damage, we examined the cytotoxicity induced by 2-OHE2 and 4-OHE2. 2-OHE2 was found to be more toxic than 4-OHE2 according to the results of the [methyl-3H]thymidine incorporation assay (Figure 7). Thus, 2-OHE2 (20 µM) treatment for 24 h caused ~60% cell death (Figure 7A) while the same concentration of 4-OHE2 induced only 20% decrease in the cell viability (Figure 7B). Resveratrol protected MCF-10A cells against catechol estrogen-induced cytotoxicity in a concentration-dependent manner.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7. Protective effects of resveratrol against catechol estrogen-induced cytotoxicity. MCF-10A cells were treated with indicated concentrations of 2-OHE2 (A) or 4-OHE2 (B) in the absence (•) or presence of 5 µM ({circ}) or 20 µM ({blacktriangledown}) resveratrol for 24 h. The cell proliferation was determined by the [3H]thymidine incorporation assay as described in the Materials and methods.

 
Resveratrol inhibited the catechol estrogen-induced intracellular ROS accumulation
MCF-10A cells treated with 20 µM catechol estrogen for 6 h displayed intense fluorescence after staining with DCF dye. Intracellular ROS accumulation was significantly elevated after catechol estrogen treatment (Figure 8B and D). The ROS accumulation was strongly reduced when resveratrol was present in the media (Figure 8C and E).



View larger version (108K):
[in this window]
[in a new window]
 
Fig. 8. Protective effects of resveratrol on catechol estrogen-induced intracellular ROS accumulation. Cells were treated with DMSO (A), 20 µM 2-OHE2 (B), 20 µM 2-OHE2 with 20 µM resveratrol (C), 20 µM 4-OHE2 (D), 20 µM 4-OHE2 with 20 µM resveratrol (E) or 20 µM resveratrol alone (F) for 6 h. The ROS accumulation was measured using DCF-DA as described in the Materials and methods.

 
Resveratrol had a protective effect on the catechol estrogen-induced DNA damage
Oxidative damage resulting from redox cycling between catechol estrogens and their quinoid forms is believed to be a critical event in carcinogenesis induced by estrogen. Figure 9 shows 8-oxo-dGuo formation induced by catechol estrogens and the protective effect of resveratrol. Treatment of MCF-10A cells with 2-OHE2 and 4-OHE2 at 20 µM each for 6 h increased the 8-oxo-dGuo level ~8- and 5-fold, respectively. Again, catechol estrogen-induced 8-oxo-dGuo formation was significantly attenuated by co-treatment with 20 µM resveratrol (Figure 9).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 9. Protective effects of resveratrol on catechol estrogen-induced oxidative DNA damage. MCF-10A cells were treated with 20 µM catechol estrogens with or without 20 µM resveratrol for 6 h. *Significantly different from the value without resveratrol co-treatment (P < 0.01). Values are means ± SD (n = 3).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Although many studies have shown the role of AhR-mediated CYP induction in estrogen metabolism in human breast cancer MCF-7 cells, little is known about such induction in MCF-10A cells, an immortalized cell line derived from a non-tumorigenic normal breast epithelium (3537). Some reports demonstrate that TCDD can induce oxidative stress (3841), but the underlying mechanisms still remain unclear. The primary objective of this study was to clarify whether TCDD-induced oxidative stress is mediated, at least in part, via the metabolic formation of catechol estrogens. The possible protective effects of resveratrol on the oxidative DNA damage and cell death induced by catechol estrogens as a consequence of induction of CYP1A1 and CYP1B1 were also investigated.

Resveratrol, an antioxidant present in red wine, has been reported to be a naturally occurring cancer chemopreventive substance. Jang et al. (17) have reported that resveratrol inhibits diverse cellular events associated with multi-stage carcinogenesis. Dietary administration of resveratrol (10 p.p.m.) caused striking reductions in 7,12-dimethylbenz[a]anthracene-induced rat mammary carcinogenesis and extended the latency period of tumor development (42). Single topical application of resveratrol, at a dose of 25 µmol, to SKH-1 hairless mice significantly inhibited UVB-mediated increase in bifold skin thickness and skin edema (43). Application of TPA to mouse skin induces oxidative stress, as evidenced by numerous biochemical responses, including significant generation of H2O2 and enhanced levels of myeloperoxidase and oxidized glutathione reductase activities and decreases in glutathione levels and superoxide dismutase activity (44). Pre-treatment of mouse skin with resveratrol negated some of these TPA-induced effects in a dose-dependent manner.

Several recent studies have demonstrated that resveratrol decreases CYP1A1 mRNA/protein expression or related activities in cultured cells, and that such inhibitory effects may be related to the AhR antagonizing properties of the compound (2428). Other reports describe that resveratrol can inhibit the CYP activity by competing for the substrate binding site or through some other mechanisms (2932). Our present work demonstrates that resveratrol inhibits TCDD-induced AhR DNA binding activity and the resulting expression of CYP1A1 and CYP1B1 in MCF-10A cells. The EROD assay and HPLC analysis of catechol estrogen formation reveal that reseveratrol is an effective inhibitor on the CYP enzyme activities as well. It is unlikely that the mechanisms of the inhibitory effects of resveratrol on the catalytic activities of these two enzymes are the same since there are so large differences between the two inhibitory curves as well as the IC50 values. (The IC50 value of resveratrol for inhibiting CYP1A1 activity is <2 µM while that for inhibiting CYP1B1 activity is above 20 µM.) A similar difference in the inhibitory effect is evident from the observation that resveratrol exerts a stronger inhibitory effect on the expression of CYP1A1 protein than that of CYP1B1.

Oxidative stress is considered as one of the plausible mechanisms underlying TCDD-induced carcinogenesis (38,39). We hypothesized that TCDD-induced oxidative stress could be mediated by catechol estrogens. In the MCF-10A cell line, 10 nM TCDD treatment alone for 3 days did not cause substantial oxidative stress. However, subsequent treatment with 1 µM E2 for 6 h dramatically increased both ROS accumulation and the 8-oxo-dGuo level while 1 µM E2 treatment alone did not cause any appreciable oxidative stress (Figures 5 and 6), suggesting that TCDD-induced oxidative stress may be mediated via CYP-catalyzed catechol estrogen formation. Tritscher et al. (40) reported that TCDD increased oxidative DNA damage only in intact but not ovariectomized rats. Wyde and colleagues (41) have demonstrated that TCDD-induced 8-oxo-dGuo formation was female-specific and estrogen-dependent. The findings from these studies further support our hypothesis that the catechol metabolites of estradiol may mediate TCDD-induced oxidative stress. The ROS generated through redox cycling of metabolically formed catechol estrogens or their quinoid products can damage DNA to initiate the carcinogenesis. Alternatively, mild ROS may stimulate the growth signaling cascades, thereby inducing the promotion of neoplastic transformation. Thus, it is likely that catechol metabolites can contribute to estrogen-mediated carcinogenesis by both genotoxic and epigenetic mechanisms. Resveratrol inhibition of oxidative stress mediated by TCDD in combination with E2 is considered to be partly due to its free radical scavenging ability (45) as well as suppression of de novo synthesis of CYP1A1 and CYP1B1 and their catalytic activity responsible for the catechol estrogen formation.

The implication of estradiol in breast tumorigenesis is well documented (46,47). Multiple lines of evidence support that hormonal carcinogenesis is related to not only growth stimulatory effects of estrogens, but also the formation of catechol estrogens, particularly 4-OHE2 (1013), which is generated mainly by CYP1B1 activity. On the other hand, CYP1A1 catalyzes the formation of primarily 2-OHE2, which is known to have less toxicity (1416,48,49). However, our results suggest that, at least in the MCF-10A cell line, 2-OHE2 is likely to exert more cytotoxicity than 4-OHE2 by generating a larger amount of ROS and more oxidative DNA damage. Our observation is corroborated with an earlier report of Lavigne and colleagues on the ability of TCDD to induce oxidative E2 metabolism, primarily via the 2-hydroxylation (50). Mobley et al. (51) investigated the electrochemical properties of both 2-OHE2 and 4-OHE2, and found that both catechol estrogens exhibited nearly equal oxidative potentials under physiological conditions. Based on these findings, it is likely that the different oxidation rate of these two catechol estrogens in vivo would be determined by enzymatic rather than chemical reactions.

O-Methylation catalyzed by catechol-O-methyltransferase (COMT) represents a major phase II detoxification pathway for catechol estrogens (52,53). When MCF-7 cells were pre-treated with dioxin to stimulate the oxidative estrogen metabolism to catechol estrogens, followed by exposure to E2 with and without Ro 41-0960, a COMT-specific inhibitor, the pharmacologic inhibition of O-methylation led to increased formation of both 2-OHE2 and 8-oxo-dG (50). A genetic polymorphism in the COMT gene has been associated with a different risk of developing several types of human malignancy (54,55). The possible stimulation by resveratrol of expression or catalytic activity of COMT as an alternative mechanism responsible for its inhibition of catechol estrogen-mediated oxidative damage merits further investigation.

Bioavailability and blood and tissue levels of polyphenols are important in extrapolating results from studies in cell lines to animal models and humans (56). Several groups of investigators have assessed the pharmacokinetics of trans-resveratrol after oral or systemic administration (57,58). Although resveratrol appears to be poorly absorbed, there occurs enterohepatic recirculation of the glucuronide conjugate of resveratrol as well as the aglycone in rats (59) which may contribute, significantly to its bioavailability. Although the inhibitory effects of resveratrol on oxidative estrogen metabolism and subsequent DNA damage and cytotoxicity were achievable at the supraphysiological concentrations, our present study still provides important insights into the mechanistic basis for the estrogen carcinogenesis and also for the previously reported gender differences in the susceptibility to the TCDD-induced oxidative damage (40,41).

In conclusion, this study shows that TCDD can induce oxidative stress, which is mediated, at least in part, through the catechol estrogen formation. The ROS generated from redox cycling of catechol estrogens may play a key role in the TCDD-induced oxidative DNA damage and tumorigenesis. Resveratrol inhibits not only TCDD-induced CYP1A1 and CYP1B1 expression, but also their catalytic activities in MCF-10A cells, thereby protecting these cells against oxidative damage as schematically proposed in Figure 10. Further studies will be necessary to elucidate the possible cellular signaling events that resveratrol targets in attenuating TCDD-induced CYP1A1 and CYP1B1 expression and subsequent oxidative stress.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 10. Schematic representation of resveratrol protection against oxidative DNA damage induced by TCDD and 17ß-estradiol in MCF-10A cells.

 

    Acknowledgments
 
This study was supported by a grant [03132 (ED) 401-14] from the National Center for Toxicological Research, Republic of Korea. Dr Zhi-Hua Chen was supported by the Brain Korea 21 (BK 21) program for the post-doctoral fellowship.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Lancaster,J.M. and Wiseman,R.W. (1997) Recent advances in the molecular genetics of hereditary breast and ovarian cancer. Prog. Clin. Res., 396, 31–51.
  2. Hortobagyi,G.N. (1998) The genetics of breast cancer susceptibility. Annu. Rev. Genet., 32, 95–121.[CrossRef][Web of Science][Medline]
  3. Bertazzi,P.A., Zocchetti,C., Pesatori,A.C., Guercilena,S., Sanarico,M. and Radice,L. (1989) Ten-year mortality study of the population involved in the Seveso incident in 1976. Am. J. Epidemiol., 129, 1187–1200.[Abstract/Free Full Text]
  4. Bertazzi,P.A., Pesatori,A.C., Consonni,D., Tironi,A., Landi,M.T. and Zocchetti,C. (1993) Cancer incidence in a population accidentally exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Epidemiology, 4, 398–406.[Web of Science][Medline]
  5. Landi,M.T., Bertazzi,P.A., Baccarelli,A., Consonni,D., Masten,S., Lucier,G., Mocarelli,P., Needham,L., Caporaso,N. and Grassman,J. (2003) TCDD-mediated alterations in the AhR-dependent pathway in Seveso, Italy, 20 years after the accident. Carcinogenesis, 24, 673–680.[Abstract/Free Full Text]
  6. Nebert,D.W., Puga,A. and Vasilious,V. (1993) Role of the Ah receptor and the dioxin-inducible [Ah] gene battery in toxicity, cancer and signal transduction. Ann. N. Y. Acad. Sci., 685, 624–640.[Web of Science][Medline]
  7. Okey,A.B., Riddick,D.S. and Harper,P.A. (1994) The Ah receptor: mediator of the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds. Toxicol. Lett., 70, 1–22.[CrossRef][Web of Science][Medline]
  8. Feigelson,H.S. and Henderson,B.E. (1996) Estrogens and breast cancer. Carcinogenesis, 17, 2279–2284.[Free Full Text]
  9. Yager,J.D. (2000) Endogenous estrogens as carcinogens through metabolic activation. J. Natl Cancer Inst. Monographs, 27, 67–73.
  10. Zhu,B.T. and Conney,A.H. (1998) Functional role of estrogen metabolism in target cells: review and perspectives. Carcinogenesis, 19, 1–27.[Abstract/Free Full Text]
  11. Cavalieri,E.L., Stack,D.E., Devanesan,P.D. et al. (1997) Molecular origin of cancer: catechol estrogen-3,4-quinones as endogenous tumor initiators. Proc. Natl Acad. Sci. USA, 94, 10937–10942.[Abstract/Free Full Text]
  12. Cavalieri,E.L., Devanesan,P., Bosland,M.C., Badawi,A.F. and Rogan,E.G. (2002) Catechol estrogen metabolites and conjugates in different regions of the prostate of Noble rats treated with 4-hydroxyestradiol: implications for estrogen-induced initiation of prostate cancer. Carcinogenesis, 23, 329–333.[Abstract/Free Full Text]
  13. Rogan,E.G., Badawi,A.F., Devanesan,P.D., Meza,J.L., Edney,J.A., West,W.W., Higginbotham,S.M. and Cavalieri,E.L. (2003) Relative imbalances in estrogen metabolism and conjugation in breast tissue of women with carcinoma: potential biomarkers of susceptibility to cancer. Carcinogenesis, 24, 697–702.[Abstract/Free Full Text]
  14. Hayes,C.L., Spink,D.C., Spink,B.C., Cao,J.Q., Walker,N.J. and Sutter,T.R. (1996) 17ß-estradiol hydroxylation catalyzed by human cytochrome P450 1B1. Proc. Natl Acad. Sci. USA, 93, 9776–9781.[Abstract/Free Full Text]
  15. Murray,G.I., Taylor,M.C., McFadyen,M.C., McKay,J.A., Greenlee,W.F., Burke,M.D. and Melvin,W.T. (1997) Tumor-specific expression of cytochrome P450 CYP1B1. Cancer Res., 57, 3026–3031.[Abstract/Free Full Text]
  16. Liehr,J.G. and Ricci,M.J. (1996) 4-Hydroxylation of estrogens as marker of human mammary tumors. Proc. Natl Acad. Sci. USA, 93, 3294–3296.[Abstract/Free Full Text]
  17. Jang,M., Cai,L., Udeani,G.O. et al. (1997) Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science, 275, 218–220.[Abstract/Free Full Text]
  18. Surh,Y.-J. (2003) Cancer chemoprevention with dietary phytochemicals. Nature Rev. Cancer, 3, 768–780.[CrossRef][Web of Science][Medline]
  19. Aziz,M.H., Kumar,R. and Ahmad,N. (2003) Cancer chemoprevention by resveratrol: in vitro and in vivo studies and the underlying mechanisms (review). Int. J. Oncol., 23, 17–28.[Web of Science][Medline]
  20. Surh,Y.-J., Hurh,Y.-J., Kang,J.-Y., Lee,E., Kong,G. and Lee,S.J. (1999) Resveratrol, an antioxidant present in red wine, induces apoptosis in human promyelocytic leukemia (HL-60) cells. Cancer Lett., 40, 1–10.
  21. Surh,Y.-J., Chun,K.-S., Cha,H.-H., Han,S.S., Keum,Y.-S., Park,K.-K. and Lee,S.S. (2001) Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF-kappa B activation. Mutat. Res., 480–481, 243–268.
  22. Jang,J.-H. and Surh,Y.-J. (2001) Protective effects of resveratrol on hydrogen peroxide-induced apoptosis in rat pheochromocytoma (PC12) cells. Mutat. Res., 496, 181–190.[Web of Science][Medline]
  23. Jang,J.-H. and Surh,Y.-J. (2003) Protective effect of resveratrol on beta-amyloid-induced oxidative PC12 cell death. Free Radic. Biol. Med., 34, 1100–1110.[CrossRef][Web of Science][Medline]
  24. Ciolino,H.P., Daschner,P.J. and Yeh,G.C. (1998) Resveratrol inhibits transcription of CYP1A1 in vitro by preventing activation of the aryl hydrocarbon receptor. Cancer Res., 58, 5707–5712.[Abstract/Free Full Text]
  25. Casper,R.F., Quesne,M., Rogers,I.M., Shirota,T., Jolivet,A., Milgrom,E. and Savouret,J.F. (1999) Resveratrol inhibits transcription of CYP1A1 in vitro by preventing activation of the aryl hydrocarbon receptor. Mol. Pharmacol., 56, 784–790.[Abstract/Free Full Text]
  26. Mollerup,S., Ovrebo,S. and Haugen,A. (2001) Lung carcinogenesis: resveratrol modulates the expression of genes involved in the metabolism of PAH in human bronchial epithelial cells. Int. J. Cancer, 92, 18–25.[CrossRef][Web of Science][Medline]
  27. Lee,J.E. and Safe,S. (2001) Involvement of a post-transcriptional mechanism in the inhibition of CYP1A1 expression by resveratrol in breast cancer cells. Biochem. Pharmacol., 62, 1123–1124.
  28. Singh,S.U., Casper,R.F., Fritz,P.C., Sukhu,B., Ganss,B., Girard,B.,Jr, Savouret,J.F. and Tenenbaum,H.C. (2000) Inhibition of dioxin effects on bone formation in vitro by a newly described aryl hydrocarbon receptor antagonist, resveratrol. J. Endocrinol., 167, 183–195.[Abstract]
  29. Ciolino,H.P. and Yeh,G.C. (1999) Inhibition of aryl hydrocarbon-induced cytochrome P-450 1A1 enzyme activity and CYP1A1 expression by resveratrol. Mol. Pharmacol., 56, 760–767.[Abstract/Free Full Text]
  30. Piver,B., Berthou,F., Dreano,Y. and Lucas,D. (2001) Inhibition of CYP3A, CYP1A and CYP2E1 activities by resveratrol and other non volatile red wine components. Toxicol. Lett., 125, 83–91.[CrossRef][Web of Science][Medline]
  31. Chun,Y.J., Kim,M.Y. and Guengerich,F.P. (1999) Resveratrol is a selective human cytochrome P450 1A1 inhibitor. Biochem. Biophys. Res. Commun., 262, 20–24.[CrossRef][Web of Science][Medline]
  32. Chang,T.K., Chen,J. and Lee,W.B. (2001) Differential inhibition and inactivation of human CYP1 enzymes by trans-resveratrol: evidence for mechanism-based inactivation of CYP1A2. J. Pharmacol. Exp. Ther., 299, 874–882.[Abstract/Free Full Text]
  33. Li,W., Harper,P.A., Tang,B.K. and Okey,A.B. (1998) Regulation of cytochrome P450 enzymes by aryl hydrocarbon receptor in human cells: CYP1A2 expression in the LS180 colon carcinoma cell line after treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin or 3-methylcholanthrene. Biochem. Pharmacol., 56, 599–612.[CrossRef][Web of Science][Medline]
  34. Shibazaki,M., Takeuchi,T., Ahmed,S. and Kikuchi,H. (2004) Suppression by p38 MAP kinase inhibitors (pyridinyl imidazole compounds) of Ah receptor target gene activation by 2,3,7,8-tetrachlorodibenzo-p-dioxin and the possible mechanism. J. Biol. Chem., 279, 3869–3876.[Abstract/Free Full Text]
  35. Tait,L., Soule,H.D. and Russo,J. (1990) Ultrastructural and immunocytochemical characterization of an immortalized human breast epithelial cell line, MCF-10. Cancer Res., 50, 6087–6094.[Abstract/Free Full Text]
  36. Spink,D.C., Spink,B.C., Cao,J.Q., De Pasqualle,J.A., Pentecost,B.T., Fasco,M.J., Li,Y. and Sutter,T.R. (1998) Differential expression of CYP1A1 and CYP1B1 in human breast epithelial cells and breast tumor cells. Carcinogenesis, 19, 291–298.[Abstract/Free Full Text]
  37. van Duursen,M.B., Sanderson,J.T., van der Bruggen,M., van der Linden,J. and van den Berg,M. (2003) Effects of several dioxin-like compounds on estrogen metabolism in the malignant MCF-7 and nontumorigenic MCF-10A human mammary epithelial cell lines. Toxicol. Appl. Pharmacol., 190, 241–250.[CrossRef][Web of Science][Medline]
  38. Senft,A.P., Dalton,T.P., Nebert,D.W., Genter,M.B., Puga,A., Hutchinson,R.J., Kerzee,J.K., Uno,S. and Shertzer,H.G. (2002) Mitochondrial reactive oxygen production is dependent on the aromatic hydrocarbon receptor. Free Radic. Biol. Med., 33, 1268–1278.[CrossRef][Web of Science][Medline]
  39. Hassoun,E.A., Al-Ghafri,M. and Abushaban,A. (2003) The role of antioxidant enzymes in TCDD-induced oxidative stress in various brain regions of rats after subchronic exposure. Free Radic. Biol. Med., 35, 1028–1036.[CrossRef][Web of Science][Medline]
  40. Tritscher,A.M., Seacat,A.M., Yager,J.D., Groopman,J.D., Miller,B.D., Bell,D., Sutter,T.R. and Lucier,G.W. (1996) Increased oxidative DNA damage in livers of 2,3,7,8-tetrachlorodibenzo-p-dioxin treated intact but not ovariectomized rats. Cancer Lett., 98, 219–225.[CrossRef][Web of Science][Medline]
  41. Wyde,M.E., Wong,V.A., Kim,A.H., Lucier,G.W. and Walker,N.J. (2001) Induction of hepatic 8-oxo-deoxyguanosine adducts by 2,3,7,8-tetrachlorodibenzo-p-dioxin in Sprague-Dawley rats is female-specific and estrogen-dependent. Chem. Res. Toxicol., 14, 849–855.[CrossRef][Web of Science][Medline]
  42. Banerjee,S., Bueso-Ramos,C. and Aggarwal,B.B. (2002) Suppression of 7,12-dimethylbenz(a)anthracene-induced mammary carcinogenesis in rats by resveratrol: role of nuclear factor-{kappa}B, cyclooxygenase 2 and matrix metalloprotease 9. Cancer Res., 62, 4945–4954.[Abstract/Free Full Text]
  43. Afaq,F., Adhami,V.M. and Ahmad,N. (2003) Prevention of short-term ultraviolet B radiation-mediated damages by resveratrol in SKH-1 hairless mice. Toxicol. Appl. Pharmacol., 186, 28–37.[CrossRef][Web of Science][Medline]
  44. Jang,M. and Pezzuto,J.M. (1998) Effects of resveratrol on 12-O-tetradecanoylphorbol-13-acetate-induced oxidative events and gene expression in mouse skin. Cancer Lett., 134, 81–89.[CrossRef][Web of Science][Medline]
  45. Fang,J.G., Lu,M., Chen,Z.H., Zhu,H.H., Li,Y., Yang,L., Wu,L.M. and Liu,Z.L. (2002) Antioxidant effects of resveratrol and its analogues against the free radical-induced peroxidation of linoleic acid in micelles. Chemistry, 8, 4191–4198.[CrossRef][Web of Science][Medline]
  46. Nandi,S., Guzman,R.C. and Yang,J. (1995) Hormones and mammary carcinogenesis in mice, rats and humans: a unifying hypothesis. Proc. Natl Acad. Sci. USA, 92, 3650–3657.[Abstract/Free Full Text]
  47. Weinberg,R.A. (1996) How cancer arises. Sci. Am., 275, 60–72.[Web of Science][Medline]
  48. Coumoul,X., Diry,M., Robillot,C. and Barouki,R. (2001) Differential regulation of cytochrome P450 1A1 and 1B1 by a combination of dioxin and pesticides in the breast tumor cell line MCF-7. Cancer Res., 61, 3942–3948.[Abstract/Free Full Text]
  49. Schumacher,G., Kataoka,M., Roth,J.A. and Mukhopadhyay,T. (1999) Potent antitumor activity of 2-methoxyestradiol in human pancreatic cancer cell lines. Clin. Cancer Res., 5, 493–499.[Abstract/Free Full Text]
  50. Lavigne,J.A., Goodman,J.E., Fonong,T., Odwin,S., He,P., Roberts,D.W. and Yager,J.D. (2001) The effects of catechol-O-methyltransferase inhibition on estrogen metabolite and oxidative DNA damage levels in estradiol-treated MCF-7 cells. Cancer Res., 61, 7488–7494.[Abstract/Free Full Text]
  51. Mobley,J.A., Bhat,A.S. and Brueggemeier,R.W. (1999) Measurement of oxidative DNA damage by catechol estrogens and analogues in vitro. Chem. Res. Toxicol., 12, 270–277.[CrossRef][Web of Science][Medline]
  52. Cavalieri,E.L., Devanesan,P., Bosland,M.C., Badawi,A.F. and Rogan,E.G. (2002) Catechol estrogen metabolites and conjugates in different regions of the prostate of Noble rats treated with 4-hydroxyestradiol: implications for estrogen-induced initiation of prostate cancer. Carcinogenesis, 23, 329–333.[Abstract/Free Full Text]
  53. Creveling,C.R. (2003) Reduced COMT activity as a possible environmental risk factor for breast cancer. Opin. Neurotox. Res., 5, 473–474.
  54. McGrath,M., Hankinson,S.E., Arbeitman,L., Colditz,G.A., Hunter,D.J. and De Vivo,I. (2004) Cytochrome P450 1B1 and catechol-O-methyltransferase polymorphisms and endometrial cancer susceptibility. Carcinogenesis, 25, 559–565.[Abstract/Free Full Text]
  55. Wedren,S., Rudqvist,T.R., Granath,F., Weiderpass,E., Ingelman-Sundberg,M., Persson,I. and Magnusson,C. (2003) Catechol-O-methyltransferase gene polymorphism and post-menopausal breast cancer risk. Carcinogenesis, 24, 681–687.[Abstract/Free Full Text]
  56. Yang,C.S., Landau,J.M., Huang,M.T. and Newmark,H.L. (2001) Inhibition of carcinogenesis by dietary polyphenolic compounds. Annu. Rev. Nutr., 21, 381–406.[CrossRef][Web of Science][Medline]
  57. Meng,X., Maliakal,P., Lu,H., Lee,M.J. and Yang,C.S. (2004) Urinary and plasma levels of resveratrol and quercetin in humans, mice and rats after ingestion of pure compounds and grape juice. J. Agric. Food Chem., 52, 935–942.[CrossRef][Web of Science][Medline]
  58. Asensi,M., Medina,I., Ortega,A., Carretero,J., Bano,M.C., Obrador,E. and Estrela,J.M. (2002) Inhibition of cancer growth by resveratrol is related to its low bioavailability. Free Radic. Biol. Med., 33, 387–398.[CrossRef][Web of Science][Medline]
  59. Marier,J.F., Vachon,P., Gritsas,A., Zhang,J., Moreau,J.P. and Ducharme,M.P. (2002) Metabolism and disposition of resveratrol in rats: extent of absorption, glucuronidation and enterohepatic recirculation evidenced by a linked-rat model. J. Pharmacol. Exp. Ther., 302, 369–373.[Abstract/Free Full Text]
Received February 23, 2004; revised April 12, 2004; accepted May 1, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Toxicol SciHome page
S. R. Beedanagari, I. Bebenek, P. Bui, and O. Hankinson
Resveratrol Inhibits Dioxin-Induced Expression of Human CYP1A1 and CYP1B1 by Inhibiting Recruitment of the Aryl Hydrocarbon Receptor Complex and RNA Polymerase II to the Regulatory Regions of the Corresponding Genes
Toxicol. Sci., July 1, 2009; 110(1): 61 - 67.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. H. Collins, E. C. Lessey, C. D. DuSell, D. P. McDonnell, L. Fowler, W. A. Palomino, M. J. Illera, X. Yu, B. Mo, A. M. Houwing, et al.
Characterization of Antiestrogenic Activity of the Chinese Herb, Prunella vulgaris, Using In Vitro and In Vivo (Mouse Xenograft) Models
Biol Reprod, February 1, 2009; 80(2): 375 - 383.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. C. Degner, A. J. Papoutsis, O. Selmin, and D. F. Romagnolo
Targeting of Aryl Hydrocarbon Receptor-Mediated Activation of Cyclooxygenase-2 Expression by the Indole-3-Carbinol Metabolite 3,3'-Diindolylmethane in Breast Cancer Cells
J. Nutr., January 1, 2009; 139(1): 26 - 32.
[Abstract] [Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
F. Lu, M. Zahid, C. Wang, M. Saeed, E. L. Cavalieri, and E. G. Rogan
Resveratrol Prevents Estrogen-DNA Adduct Formation and Neoplastic Transformation in MCF-10F Cells
Cancer Prevention Research, July 1, 2008; 1(2): 135 - 145.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
X. Qu, R. P. Metz, W. W. Porter, V. M. Cassone, and D. J. Earnest
Disruption of Clock Gene Expression Alters Responses of the Aryl Hydrocarbon Receptor Signaling Pathway in the Mouse Mammary Gland
Mol. Pharmacol., November 1, 2007; 72(5): 1349 - 1358.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. L. Petersen, S. Krishnan, and E. D. Hudgens
The Aryl Hydrocarbon Receptor Pathway and Sexual Differentiation of Neuroendocrine Functions
Endocrinology, June 1, 2006; 147(6): s33 - s42.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S.-H. Kim, E. C. Henry, D.-K. Kim, Y.-H. Kim, K. J. Shin, M. S. Han, T. G. Lee, J.-K. Kang, T. A. Gasiewicz, S. H. Ryu, et al.
Novel Compound 2-Methyl-2H-pyrazole-3-carboxylic Acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) Prevents 2,3,7,8-TCDD-Induced Toxicity by Antagonizing the Aryl Hydrocarbon Receptor
Mol. Pharmacol., June 1, 2006; 69(6): 1871 - 1878.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-H. Chen, Y. Yoshida, Y. Saito, A. Sekine, N. Noguchi, and E. Niki
Induction of Adaptive Response and Enhancement of PC12 Cell Tolerance by 7-Hydroxycholesterol and 15-Deoxy-{Delta}12,14-Prostaglandin J2 through Up-regulation of Cellular Glutathione via Different Mechanisms
J. Biol. Chem., May 19, 2006; 281(20): 14440 - 14445.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
L. Sparfel, J. Van Grevenynghe, M. Le Vee, C. Aninat, and O. Fardel
Potent inhibition of carcinogen-bioactivating cytochrome P450 1B1 by the p53 inhibitor pifithrin {alpha}
Carcinogenesis, March 1, 2006; 27(3): 656 - 663.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-H. Chen, Y. Saito, Y. Yoshida, A. Sekine, N. Noguchi, and E. Niki
4-Hydroxynonenal Induces Adaptive Response and Enhances PC12 Cell Tolerance Primarily through Induction of Thioredoxin Reductase 1 via Activation of Nrf2
J. Biol. Chem., December 23, 2005; 280(51): 41921 - 41927.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
Y.-J. Chun, S.-K. Lee, and M. Y. Kim
MODULATION OF HUMAN CYTOCHROME P450 1B1 EXPRESSION BY 2,4,3',5'-TETRAMETHOXYSTILBENE
Drug Metab. Dispos., December 1, 2005; 33(12): 1771 - 1776.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
Y.-J. Surh, J. K. Kundu, H.-K. Na, and J.-S. Lee
Redox-Sensitive Transcription Factors as Prime Targets for Chemoprevention with Anti-Inflammatory and Antioxidative Phytochemicals
J. Nutr., December 1, 2005; 135(12): 2993S - 3001S.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/10/2005    most recent
bgh183v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, Z.-H.
Right arrow Articles by Surh, Y.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.-H.
Right arrow Articles by Surh, Y.-J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?