Carcinogenesis Advance Access originally published online on June 3, 2004
Carcinogenesis 2004 25(10):2023-2032; doi:10.1093/carcin/bgh207
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.25 no.10 © Oxford University Press 2004; all rights reserved.
ARTICLE |
Pre-S mutant surface antigens in chronic hepatitis B virus infection induce oxidative stress and DNA damage
1 Institute of Basic Medical Sciences, 2 Department of Microbiology and Immunology, 3 Department of Biochemistry, 4 Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng-Kung University, Tainan 70101, Taiwan and 5 Division of Clinical Research, National Health Research Institute, Taipei, Taiwan
6 To whom correspondence should be addressed Email: whuang{at}mail.ncku.edu.tw
| Abstract |
|---|
|
|
|---|
Ground glass hepatocytes (GGHs) are the historic hallmarks for the hepatocytes in the late and non-replicative stages of hepatitis B virus (HBV) infection. We have identified type I and type II GGHs that contain two mutant types of large HBV surface antigens (HBsAg) with deletions over the pre-S1 and pre-S2 regions, respectively. These pre-S mutant HBVsAg accumulate in endoplasmic reticulum (ER), resulting in strong ER stress. Type II GGHs often appear in hepatic nodules in the late phases of HBV infection and proliferate in clusters, suggesting that these mutant pre-S1/S2 HBsAg may be involved in HBV-related hepatocarcinogenesis, associated with ER stress. In this study, we investigated the potential genomic instability imposed by pre-S mutant HBsAg. Based on the analysis of comet assays, we found that the pre-S1 and pre-S2 mutant HBsAg caused oxidative stress and DNA damage. The DNA repair gene ogg1 was greatly induced by over-expression of pre-S mutant HBsAg. Induction of the DNA repair gene ogg1 was also detected in the pre-S2 HBsAg transgenic mice, as well as the type II GGHs from patients with hepatocellular carcinoma, strongly suggesting that the pre-S mutant HBsAg contributes to the oxidative DNA damage to hepatocytes. In addition, the mutation rates in the X-linked hprt gene were enhanced in mouse hepatoma ML1-4a cells, which constitutively expressed the pre-S1/S2 HBsAg. These results indicate that pre-S1/S2 mutant HBsAg, which make up GGHs, induce oxidative DNA damage and mutations in hepatocytes in the late stages of HBV infection.
Abbreviations: BER, base excision repair; ER, endoplasmic reticulum; FPG, formamidopyrimidine-DNA glycosylase; GGH, ground glass hepatocyte; HCC, hepatocellular carcinoma; HBsAg, HBV surface antigen; HBV, hepatitis B virus; ROS, reactive oxygen species; TMB-8, 8-(N,N-diethylamino)octyl 3,4,5-trimethoxybenzoate
| Introduction |
|---|
|
|
|---|
Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer (1). Chronic hepatitis B virus (HBV) infection is a major global cause of HCC (2). Chronic HBV carriers have a >100-fold increase in relative risk of developing HCC (36). Expression of HBV surface proteins is strongly associated with hepatic injury. The HBV surface antigen (HBsAg) is able to up-regulate the transforming growth factor-alpha (TGF-
) gene, the most important growth factor for hepatocytes. In the chronic phase of HBV infection, the expression of HBsAg is associated with hepatic nodular formation, a prerequisite for hepatocellular carcinogenesis (7). Expression of the various types of HBsAg is dependent upon the replicative status of the HBV genome. In the acute phase of HBV infection, the major (i.e. small) HBS is the predominant form and constitutes the envelope of the virion. In the chronic phase, the HBV genome integrates into the host genome, and the large form becomes dominant. The large form of HBsAg includes an additional pre-S region that is the upstream promoter region for small HBsAg (7,8). A number of truncated surface gene mutants with a partially deleted pre-S region have already been identified. Recent research (9,10) shows that pre-S mutant HBS antigens contribute to two histological patterns designated ground glass hepatocyte (GGH) types I and II (9,10). Type I GGHs display an inclusion-like pattern of HBsAg, which is deleted in the pre-S1 promoter region. Type II GGHs display HBsAg at the margins. This type of mutant HBS gene is deleted of nucleotides 457 over the pre-S2 region and contains a point mutation at the start codon of the pre-S2 region, which leads to a dramatic decrease in the synthesis of small and middle surface antigens (Figure 1A). Both types of GGHs show accumulation of HBsAg in endoplasmic reticulum (ER) (11). Thus, type II GGH has a high correlation with the progression of cirrhosis and HCC. This mutant form of the HBS gene, designated pre-S2 mutant HBS, emerges only in the late or non-replicative phase of chronic HBV infection and eventually becomes a dominant HBV gene product in hepatocytes. Hepatocytes expressing this type of mutant consistently cluster into groups due to clonal and integrated expansion (9,10).
|
Accumulation of proteins in ER induces ER stress signaling pathway, including ER overload response, unfolded protein response (UPR) and sterol starvation. These cellular responses are associated with cell cycle exit and apoptosis (12,13). Our previous study found that the GGHs, which contain specific mutant pre-S1 or pre-S2 mutant surface antigens, exhibit significant ER stress (11). Here we characterize the molecular and genetic changes caused by these mutant HBS forms. We found that pre-S1 and pre-S2 mutant HBsAg cause oxidative stress-induced DNA damage and mutation, suggesting that the pre-S mutant HBsAg contributes to genomic instability in HBV-infected hepatocytes.
| Materials and methods |
|---|
|
|
|---|
Cell lines and reagents
The human Huh-7 and mouse ML1-4a hepatoma cell lines were used for in vitro cell culture studies. The Huh-7 cells were stably co-transfected with the pERV3 plasmid, which contains the expression cassette for ecdysone promoter function, and the pEGSH plasmid, which contains the large wild-type, pre-S1 or pre-S2 mutant HBS genes under control of the inducible ecdysone promoter (11). The mouse ML1-4a hepatoma cells, which constitutively expressed the large wild-type, pre-S1 or pre-S2 mutant HBS genes were constructed by stable transfection of one of these three types of HBS genes. These cells were maintained in regular Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 1x non-essential amino acid and 1x of antibiotic/antimycotic mixture (Gibco BRL, Grand Island, NY). The cells were grown at 37°C with 5% CO2.
Most of the reagents used for the reverse transcription and PCR amplifications were purchased from Promega (Madison, WI). Low-melting-point agarose, used for comet assays, was purchased from Gibco BRL. SYBR Green II, the staining reagent for comet DNAs, was purchased from Molecular Probes (Eugene, OR). The DNA repair enzyme formamidopyrimidine-DNA glycosylase (FPG), used for detection of 8-hydroxyguanine DNA lesions, was purchased from Trevigen (Gaithersburg, MD). The HBsAg ELISA assay kit, used for quantification of the HBS proteins in Huh-7 as well as ML1-4a cells, was purchased from General Biological (Taiwan). Antibodies used for immunological stainings were purchased from DAKO (Carpinteria, CA). Common chemicals used were purchased from Sigma Chemical (St Louis, MO).
Comet assays
Levels of oxidative DNA damage were measured by single-cell alkaline electrophoretic comet assays. Huh-7 cells in which inducible wild-type or pre-S1/S2 mutant HBS genes were transfected were used for the study. After induction of each type of HBS gene by ponasterone A for 48 h, the cells were harvested by trypsinization, centrifuged and re-suspended in PBS, then cell numbers were counted using a hemacytometer. To prepare a glass slide for comet assays, PBS (pH 7.4) with 1% agarose was first coated on the slides, and then covered with 1.5% low-melting-point agarose gel in which 4 x 104 cells were embedded. Next, another layer of 1% low-melting-point agarose gel was placed on top. After the coatings, the slides were covered with cover slips and placed on ice for 5 min. The cells on slides were then lysed with ice-cold lysis buffer (5 M NaCl, 100 mM EDTA, 100 mM TrisHCl, 1% Triton X-100, 10% dimethylsulfoxide) at 4°C for 1 h. After lysis, the slides were immersed in PBS (pH 7.4) for 10 min and then subjected to enzymatic digestion.
To detect 8-hydroxyguanine DNA lesions, the FPG DNA repair enzyme was used to specifically cleave the DNA strand at 8-hydroxyguanine sites (14). For these slides, 2 U of FPG were incubated with the slides at 37°C for 1 h. After FPG treatment, the slides were washed a few times in PBS (pH 7.4). For single-cell alkaline electrophoresis, the slides were first immersed in alkaline electrophoresis buffer (0.3 M NaOH, 1 mM EDTA) for 20 min, followed by electrophoresis at 23 V and 30 mA for 25 min. After alkaline electrophoresis, the slides were transferred to a neutralization solution of 0.4 M TrisHCl (pH 7.5) and then stained with SYBR green II for 3 min in the dark. Next, 100 cells on each slide were examined using fluorescence microscopy and scored for the fluorescent tail length from the cell nuclei. Each cell was assigned a score on an arbitrary five-point scale (0 = no DNA damage; 4 = extensive DNA damage), based on comet tail length migration. The total comet score for each slide equalled the sum of the grades for each evaluated cell (maximum possible score: 400) (15,16).
RTPCR of DNA repair genes
Human Huh-7 cells expressing inducible HBS and mouse ML1-4a cells constitutively expressing HBS genes were analyzed for expression of DNA repair genes. Huh 7-cells were treated with ponasterone A for 12, 24 or 48 h (or mock-treated) and then subjected to RNA extraction. RTPCR was performed in a mixture of 1 µg of cellular RNA, 0.5 µg of random hexamer, 2 mM of each dNTP, 0.6 µl of RNase inhibitor (Takara, Tokyo, Japan), 50 mM TrisHCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol and 200 U of Moloney murine leukemia virus reverse transcriptase (MMLV-RT). The reaction was performed at 37°C for 90 min and then stopped at 95°C for 5 min.
For each PCR reaction, 5 µl of cDNA product of the reverse transcription reaction was used as the template. The PCR primers used were as follows: ogg1, forward: 5'-cactgcactgtgtaccgagg-3', and reverse: 5'-gctgctgcagccaggctagc-3'; xrcc1, forward: 5'-atgccggagatccgcctccg-3', and reverse: 5'-catcattcccaatgtccaca-3'; and the housekeeping gene ß-actin, forward: 5'-atcatgtttgagaccttcaa-3', and reverse: 5'-catctcttgctcgaagtcca-3'. For the GGH cells isolated by LCM from the HCC patients, nested PCR was performed. The primers for nested PCR were forward: 5'-gtgtgcgactgctgcgacaa-3', and reverse: 5'-gctgctgcagccaggctagc-3'. The PCR mix contained 25 mM N-[Tris (hydroxymethyl) methyl]-3-aminopropanesulfonic acid (pH 9.3), 50 mM KCl, 2 mM MgCl2, 1 mM ß-mercaptoethanol, 200 mM of each dNTP, 0.25 µg/µl activated calf thymus DNA and 2 U of SuperTherm Fold DNA polymerase (JMR Holdings, Kent, UK). The PCR reaction was performed in the following order: ogg1 at 94°C for 10 min, then 35 cycles (xrcc1, 26 cycles) with each cycle of 94°C for 60 s, 54°C for 45 s and 72°C for 120 s. Finally, the PCR tubes were incubated at 72°C for 10 min. The PCR products were examined by agarose gel electrophoresis.
Host-cell reactivation assay
Host-cell reactivation activities on H2O2-damaged plasmids were used to detect DNA repair activity in cells. To construct the plasmid substrate, pCMVluc DNA was treated in the dark with 5% H2O2 at room temperature for 30 min. The treated plasmid DNA was purified by ethanol precipitation. To test the DNA repair activity in Huh-7 cells expressing various types of HBS genes, H2O2-damaged pCMVluc as well as wild-type, pre-S1 or pre-S2 HBS genes in the p(3A)-S plasmid vector were co-transfected into the Huh-7 cells. After transfection for 48 h, cell lysates were collected and the luciferase activities were detected using a luciferase assay kit (ABI; Applied Biosystems).
hprt gene mutation assays
ML1-4a cells constitutively expressing wild-type, pre-S1 or pre-S2 HBS genes were analyzed for gene mutation rates in the hypoxanthine phosphoribosyltransferase (hprt) gene. Cells were seeded into 96-well plates in concentrations of 2 x 103 cells/well containing 5 µg/ml 6-thioguanine (Sigma) for selection of hprt mutants. After selection for 14 days, the surviving colonies were counted for the mutation rates of the hprt gene. Those cell colonies resistant to 6-thioguanine treatments were further grown and sub-cultured in DMEM growth medium with 3 µg/ml of 6-thioguanine. After the cells became confluent in the culture wells, the cellular RNAs were isolated. The hprt cDNA was amplified by RTPCR and then sequenced to identify the mutations in the gene. The PCR primers used were: forward, atgccgacccgcagtcccagcgtcg, and reverse, ttaggctttgtatttggcttttcca.
Pre-S2 HBS transgenic mice
The plasmid p(3A)SAg-r2, which contains the large HBS surface gene with an internal deletion on the pre-S2 region (nt 457) (10), was used to construct transgenic mice by the animal facility in our medical center. The plasmid was microinjected into embryos of FVB/N mice. All microinjected embryos were then implanted into pseudo-pregnant female mice. Mice carrying the transgenes were selected by PCR detection of the pre-S mutant HBS gene. Genomic DNA was purified from whole blood using a whole blood kit (InstaGene; Bio-Rad Laboratories, Hercules, CA). Mice with the HBV transgene were tested for HBsAg expression in sera by commercial ELISA kit (General Biological, Taiwan). Transgenic mice were fed standard laboratory chow and water ad libitum in the animal facility. The animals were raised and cared for according to the guidelines set up by the National Science Council of the Republic of China.
Detection of large HBS mRNAs and proteins
The specific mRNAs of the large HBsAg were detected by RTPCR using the primers derived from the pre-S region. The forward primer was derived from the pre-S1 region, whose sequence was 5'-gctacaaactttgccagcaa-3'; the reverse primer was derived from the pre-S2 region, whose sequence was 5'-ctgcggtattgtgaggattc-3'. The full-length and pre-S1 mutant HBS genes were expected to present the 381-bp cDNA product. And the pre-S2 mutant HBS gene was expected to present the truncated 308-bp cDNA product.
The protein products of the large HBsAg were detected by western blots, using the monoclonal antibody MA18/7, which is specifically against the pre-S1 region (a generous gift from W.H.Gerlich, Institute of Medical Virology, Justus Liebig University Giessen, Giessen, Germany). The protocols for western blots basically followed those described in the study by Wang et al. (11).
HBS immunohistochemical staining
Five-micrometer sections of frozen liver tissues from pre-S2 HBS transgenic mice were fixed in ice-cold acetone, blocked with 3% H2O2 in PBS, and immunostained with monoclonal goat anti-HBS antibody. After they had been washed in PBS, slides were incubated with biotinylated anti-goat secondary antibody and then followed by peroxidase-conjugated streptavidin. The HBsAg was then stained with 3-amino-ethyl-carbazole, counterstained with Mayer's hematoxylin, and examined under a microscope.
Immunofluorescent staining of 8-oxoguanine glycosylase in HCC patients
Five-micrometer sections of frozen liver tissues from HCC patients were immunostained with mouse anti-HBS antibody and rabbit antibody against anti-8-oxoguanine glycosylase (Novus Biologicals, Littleton, CO). The slides were then incubated with anti-mouse secondary antibody conjugated with tetramethylrhodamine (TRITC) as well as anti-rabbit secondary antibody conjugated with fluorescein isothiocyanate (FITC). Finally, the cell nuclei were counterstained with Hoechst 33342. The sections were visualized by confocal microscopy at a wavelength of 547 nm for TRITC, 480 nm for FITC and 345 nm for Hoechst 33342.
| Results |
|---|
|
|
|---|
Induction of oxidative DNA damage by pre-S1/pre-S2 HBS mutant antigens
We have shown previously that the pre-S1 and pre-S2 mutant HBsAg induce reactive oxygen species (ROS) production in Huh-7 cells (11). To test for the HBsAg-induced oxidative DNA damage, in this study we performed comet assays on Huh-7 cells stably transfected with inducible constructs of wild-type, pre-S1 or pre-S2 large HBS genes. Upon induction by ponasterone A, these three types of HBS antigens were expressed in approximately equal amounts, as shown by western blot using the antibody specifically against the pre-S1 region. The full-length large HBS was in the sizes of 39 and 42 kDa (glycosylated form). In the cells expressing the pre-S1/pre-S2 mutant HBsAg, the truncated products were seen (Figure 1B). To specifically detect the amounts of the 8- hydroxyguanine, the major DNA lesion induced by oxidative stress, the DNA repair enzyme FPG was employed. FPG is a DNA glycosylase/lyase that cleaves the DNA strand at the sites of 8-hydroxyguanine (17). The comet scores, presented in Figure 1C, were the mean comet scores/slide of the five slides analyzed for each sample. Expressions of wild-type, pre-S1 or pre-S2 HBS mutant antigens all resulted in an increase of comet scores in Huh-7 cells. Treatment with FPG raised comet scores, indicating that 8-hydroxyguanine DNA lesions were present in these cells. The comet scores were increased even before the addition of FPG, suggesting that the wild-type and mutant HBsAg analyzed also created strand breaks, which, alternatively, might represent the intermediate product in DNA excision repair pathways. After treatment with FPG to create strand breaks at the 8-hydroxyguanine sites, the comet scores were further elevated. The comet score for over-expression of pre-S2 HBsAg was significantly higher than the comet scores for over-expression of wild-type or pre-S1 HBsAg, suggesting that pre-S2 mutant HBsAg triggers a higher level of oxidative DNA damage than the other two.
Induction of DNA repair by pre-S2 HBS mutant antigen
The base excision repair (BER) pathway is the major pathway for oxidative DNA damage (17). We therefore hypothesized that the DNA damage induced by pre-S HBS mutant antigens, especially pre-S2 HBS, could activate BER. We detected the expression levels of 8-oxoguanine glycosylase 1 (ogg1), the major recognition factor for oxidative DNA lesions, by RTPCR (18). After inductions of the large wild-type, pre-S1, and pre-S2 HBS genes by ponasterone A, an ecdysone analog, Huh-7 cells exhibited higher levels of ogg1 mRNAs (Figure 2A). Expression levels of ogg1 increased along with the increasing time lengths of induction by ponasterone A, whereas the alcohol, the solvent control, did not exhibit similar effects. This finding indicates that accumulation of HBsAg causes oxidative damage to the genome and consequently up-regulates the BER pathway. In mouse hepatoma ML1-4a cell lines that constitutively express wild-type large HBS, pre-S1, or pre-S2 HBS mutant genes, the BER genes ogg1 and X-ray cross-complementation 1 (xrcc1) were significantly induced (Figure 2B). The cell line carrying the pre-S2 type of HBS gene exhibited a higher induction level than the cell lines carrying the wild-type or pre-S1 HBS genes. This indicates that the pre-S1/S2 mutant HBsAg stimulates BER in human Huh-7 cells and mouse ML1-4a hepatoma cells.
|
The stimulation of BER by the pre-S1 and pre-S2 mutant HBsAg was further confirmed by host cell reactivation (HCR) assays on the luciferase reporter plasmid pCMVluc pre-treated with H2O2 (20). Huh-7 cells, transiently co-transfected with H2O2-damaged pCMVluc plasmid as well as the various types of HBS genes, were applied to the luciferase measurements. Each type of HBsAg was able to stimulate DNA repair activity for removal of oxidative DNA lesions on the reporter plasmids (Figure 2C). Pre-S2 HBsAg appears to exhibit a higher stimulatory effect than either wild-type or pre-S1 HBsAg. This stimulatory effect was specific to the surface antigens as the HBeAg was unable to induce luciferase activity. To verify that the pre-S2 HBsAg had contributed the strongest DNA repair activities, the luciferase activities obtained from cells expressing each type of HBsAg was normalized with the respective intracellular HBS antigen level, measured by ELISA assays. Pre-S2 HBsAg was indeed capable of inducing the highest activity of DNA repair (Figure 2D). These data are consistent with our other findings that pre-S2 mutant HBsAg cause the strongest oxidative stress for DNA lesions (Figure 1C).
Oxidative DNA damages in the pre-S2 HBS transgenic mice and GGHs in HCC patients
We established the FVB/N mouse model containing the pre-S2 mutant HBS transgene. A total of 25 mice at the ages of 1018.5 months were killed for the study. Data depicted in Figure 3AC are based on analysis on the representative 14.5-month-old mice, carrying the pre-S2 mutant HBS transgene or the control vector p(3A)-S. The sera in the pre-S2 HBS transgenic mice exhibited high levels of HBV surface antigens, as detected by ELISA analysis (Figure 3A). The hepatic tissues display
40% of HBS-positive hepatocytes in male transgenic mice and 10% or so in females (Figure 3B). In hepatocytes of both the male and female pre-S2 HBS transgenic mice, the BER factor ogg1 was up-regulated, as shown in Figure 3C. This finding indicates that the pre-S2 mutant HBS antigen induces oxidative DNA damages in the mouse hepatocytes as in the in vitro cell cultures.
|
Pre-S2 mutant HBsAg has been reported to display tumor-promoting phenotypes, e.g. enhanced proliferation and clonal expansion abilities (11). To test the oxidative stress induced by the pre-S2 mutant HBS antigen in the HCC patients, type II GGHs expressing pre-S2 HBsAg were isolated from hepatic tissues of six HCC patients by laser capture microdissection. ogg1 gene induction was detected in these cells using nested RTPCR (Figure 3D). Type II cells usually presented as hepatic nodules, which made them accessible for LCM sample collection; while type I GGHs scattered as individual cells, most of which were not successfully extracted by LCM. Using immunofluorescence staining in frozen hepatic tissues, the 8-oxoguanine glycosylase protein was not detectable in normal hepatocytes, and only a low level of its expression was detectable in type I GGHs (Figure 3E). In type II GGHs, however, a high level of 8-oxoguanine glycosylase protein was detected. The regions over-expressing 8-oxoguanine glycosylase were those expressing HBsAg, as seen in the merged images of the individual staining for these two proteins. The 8-oxoguanine glycosylase protein was localized in cell nuclei, as it co-localized with genomic DNA, counterstained by Hoechst 33342 fluorescent dye. Taken together with the association of pre-S2 HBsAg and 8-oxoguanine glycosylase induction, we suggest that pre-S2 mutant HBS expression causes strong oxidative stress on the hepatic genome.
Induction of oxidative stress by ER stress
To investigate whether the oxidative DNA damages contributed by the pre-S mutant HBS antigens were processed through ER stress, the Huh-7 cells were treated with ER inducers thapsigargin or tunicamycin and tested for oxidative DNA damage. The data depicted in Figure 4A indicate that the treatment of either the thapsigargin (5 µg/ml) or tunicamycin (5 µM) indeed caused significant comet formation. To confirm that the oxidative damage on DNA was indeed induced by ER stress, the ER stress inhibitors 8-(N,N-diethylamino)octyl 3,4,5-trimethoxybenzoate (TMB-8) (250 µM) and vomitoxin (150 ng/ml) were employed. The data shown in Figure 4B indicate that after treatment of either the TMB-8 or vomitoxin, the over-expression of the ogg1 gene was no longer seen. And such an effect on ogg1 was caused by ROS generated through ER stress, as the addition of the anti-oxidant melatonin (10 nM) could completely abrogate the induction of the ogg1 gene. Therefore, our data demonstrate clearly that the pre-S HBS mutant antigens induce oxidative DNA damage through ER stress.
|
Hprt gene mutations induced by the pre-S1/S2 mutant HBsAg
Oxidative stress on DNA often induces gene mutations. Accumulation of gene mutations is surely a significant factor for carcinogenesis. In the mouse ML1-4a cells constitutively expressing various types of large HBS genes, the gene mutation rates in the X-linked hprt gene was estimated as a marker for global mutation rates. The 6-thioguanine (6-TG), a nucleotide analog, was used to select for hprt mutant cells (21). The cell colonies surviving in the selective medium containing 6-TG were counted for the mutation frequencies of the hprt gene. Both pre-S1 and pre-S2 mutant HBsAg were able to enhance hprt mutation rates (Table I). Cells carrying the pre-S1 and pre-S2 mutant HBS genes exhibited 4.5- and 6.2-fold gene-mutation rates, respectively, as opposed to the 1-fold gene mutation rate in cells over-expressing the wild-type HBS gene. Thus, pre-S2 mutant HBsAg appears to be a stronger mutagen than pre-S1 HBsAg. The mutation spectra in these 6-TG-resistant cells were analyzed. The majority of mutation types were point mutations, one-base additions, or deletions (data not shown). Thus, the majority of them did not present the G to T transversion, the typical mutation type caused by oxidative stress (22). This finding suggests that the pre-S1/S2 mutant HBS antigens induce not only oxidative stress, but also overall genomic instability.
|
| Discussion |
|---|
|
|
|---|
The mechanism of hepatocellular carcinogenesis associated with the pre-S HBV mutant surface proteins was investigated in this study. We have demonstrated that these pre-S mutant HBS antigens induce oxidative DNA damage and mutagenesis. The proposed model presented in Figure 5 shows that the pre-S mutant HBsAg, mis-folded in conformation, accumulates in ER and induces ER stress. The ER stress then causes oxidative stress and oxidative DNA lesions, such as 8-hydroxyguanine. The DNA repair mechanism is activated in response to the DNA damages. Meanwhile, the DNA damages induce mutagenesis and potentially result in genomic instability. In addition to the oxidative stress-induced DNA damage, the pre-S2 deletion in type II GGH also defines a cytotoxic T lymphocyte immune escape. This type of mutation probably transforms the HBS antigen to become an immune escape mutant, which emerges in the non-replicative phase of chronic HBV infection. The produced pre-S mutant HBsAg accumulate in cytoplasm due to significant decrease in their secretion out of cells (11). Ultimately, accumulation of the oxidative adducts in cells may inactivate certain tumor suppressors or oncogenes, leading to cellular transformation and hepatocellular carcinogenesis.
|
In this study, cells carrying the pre-S1/pre-S2 mutant HBsAg exhibit oxidative stress-induced mutagenesis, as shown by the significant increase in the hprt gene mutation rates. Such induced mutations are presumably important pre-requisites for hepatic tumorigenesis. A recent study by Yeh et al. has reported that chromosomal allelic imbalance was identified in most of the cirrhotic nodules examined, indicating that the genetic aberrations occur frequently in early hepatocarcinogenesis (23). This is consistent with our finding in that induced mutagenesis of the host genome plays an important role for evolution of HBV-related HCC.
The type I and II GGHs represent cells with pre-S mutant HBS proteins accumulated in ER (911). Therefore, it is suggested that the HBS mutant proteins, partially deleted at the N-terminal pre-S1/S2 regions, are folded into improper conformations. We reported recently that the pre-S1 and pre-S2 mutant HBS proteins activate the UPR and induce production of ROS (11). Based on the data in this study, the pre-S HBsAg-induced oxidative DNA damage is contributed by ER stress, as the ER stress inhibitors TMB-8 and vomitoxin could nearly completely abrogate the HBsAg-induced ogg1 gene over-expression. The ER stress contributed by the pre-S mutant HBsAg is fairly strong. The levels of oxidative DNA damage caused by the pre-S1/pre-S2 HBsAg are higher to those caused by addition of a concentration as high as 50 µM of ER-stress inducers thapsigargin or tunicamycin in the studies of comet assays and ogg1 gene induction (data not shown). Besides the DNA damages, the ER stress response induces a series of signal transduction pathways, leading to either caspase 12-mediated apoptosis, or to a growth proliferation mediated through the NF-
B pathway, which is highly associated with tumorigenesis (2426). ER stress also induces cytoplasmic localization of p53 and blocks p53-dependent apoptosis (27). A recent study reported that the fusion protein between the HBS protein and a non-degradable fragment of cyclin A2 resides in the ER membrane and eventually leads cells to transformation (28), suggesting that the ER stress does play a role in carcinogenesis. In our preliminary study, in fact, we found that the Huh-7 cells carrying the pre-S2 mutant HBsAg exhibited higher levels of cyclin A2, as compared with those carrying the wild-type HBsAg (data not shown). Therefore, it is possible potentially that the cyclin A2 is associated with the pre-S mutant HBsAg and resides in ER, promoting hepatic carcinogenesis.
In the present study, we found that oxidative DNA lesions occur in GGHs. We also demonstrated that induction of the BER gene ogg1 was consistently detected in all the model systems applied, suggesting that the ogg1 level be a biomarker for oxidative DNA damage in hepatocytes with chronic HBV infection. Recent study by Rusyn et al. reported that expression of base excision DNA repair genes, including ogg1, is a sensitive in vivo biomarker for oxidative stress to DNA that can be used for the identification of the molecular source of radicals responsible for DNA damage in vivo (29). This is consistent with our findings. In this study, the pre-S2 mutant HBsAg causes stronger induction of a number of BER repair proteins than pre-S1 and wild-type large HBsAg do. This finding suggests that the pre-S2 mutant HBsAg causes a higher level of DNA damage than the wild-type or pre-S1 mutant HBsAg do. Such a high level of DNA lesions induced by pre-S2 HBS mutant proteins shall be an important contributing factor to hepatic carcinogenesis. Although the DNA repair activities are stimulated in the cells expressing the pre-S mutant HBsAg, they do not seem to function quickly enough to recover all of the DNA lesions to avoid mutation occurrence. Therefore, efficient DNA repair for oxidative DNA damages should play an important role in cancer prevention. Other studies have reported that a defect in the ogg1 DNA repair gene is involved in various types of human carcinogenesis (30). A number of other cancer-related viral proteins have also been documented to exhibit ER retention, suggesting that the ER stress has high association with carcinogenesis (31). These studies are consistent with our findings in GGHs.
To date, a few mechanisms of HBV-induced HCC have been proposed. Early studies proposed that insertional mutagenesis of the HBV genome into human chromosomes might cause inactivation of tumor suppressor/proto-oncogenes (3235). However, later studies have shown that integration of HBV genome is genome-wide and unlikely attacks a specific tumor suppressor or proto-oncogene (3638). Recently, the HBVX protein (pX) and surface proteins have also been proposed to play oncogenic roles. pX initiates transactivation as well as induction of signal transduction pathways such as Ras/Raf-1 (3941). The large surface protein has been shown to induce HCC in the transgenic mouse model (42,43). In our recent studies on HCC in Taiwan, we identified the pre-S1/S2 mutant HBsAg in GGHs, the pathological hallmarks for late phases of chronic HBV infection. These pre-S mutant HBsAgs exhibit viral oncoprotein features, including growth advantage and immune escape. Whether these pre-S mutant HBsAg functionally target on certain tumor suppressor/oncogene remains to be identified. Our preliminary studies have found (unpublished data) that the p53 gene is mutated in approximately half of the patient hepatocytes expressing the pre-S2 mutant HBS gene, indicating that the p53 gene is probably the direct or indirect target for pre-S2 mutant HBS protein. However, the over-expression of pre-S2 mutant HBS protein does not appear to affect the transactivation activity of p53 (data not shown), indicating that the effect of pre-S mutant surface proteins on p53 is probably through mutagenesis of p53 gene.
In conclusion, the pre-S mutant HBsAg induce oxidative DNA damage and mutagenesis, potentially resulting in genomic instability. The induced genomic instability surely enhances HCC development. This is the first study to demonstrate the association of genomic mutagenesis induced by ER response and virus-related carcinogenesis. Our study suggests that identification of the pre-S HBS genes or proteins in the chronic HBV carriers would serve as a useful diagnostic approach for detecting the risks they stand for HCC.
| Acknowledgments |
|---|
This work was supported by the National Health Research Institute, Taiwan.
| References |
|---|
|
|
|---|
- Bréchot,C., Gozuacik,D., Murakami,Y. and Paterlini-Bréchot,P. (2000) Molecular bases for the development of hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC). Semin. Cancer Biol., 10, 211231.[CrossRef][Web of Science][Medline]
- Arbuthnot,P. and Kew,M. (2001) Hepatitis B virus and hepatocellular carcinoma. Int. J. Exp. Pathol., 82, 77100.[CrossRef][Web of Science][Medline]
- Parkin,D.M., Pisani,P. and Ferlay,J. (1993) Estimates of the worldwide incidence of the 18 major cancers in 1985. Int. J. Cancer, 54, 113.[Web of Science][Medline]
- Parkin,D.M., Muir,C.S. and Whelan,S.L. (1997) Cancer Incidence in Five Continents, 7. IARC Publication, 143. IARC Publications, IARC, Lyon.
- Bosch,F.X. (1997) Global epidemiology of hepatocellular carcinoma. In Okuda,K. and Tabor,E. (eds) Liver Cancer. Churchill Livingstone, New York, pp. 1328.
- Beasley,J., Hwang,L.Y., Lin,C.C. and Chien,C.S. (1981) Hepatocellular carcinoma and HBV. A prospective study of 22,707 men in Taiwan. Lancet, 2, 11291133.[CrossRef][Web of Science][Medline]
- Feitelson,M. (1985) Molecular Components of Hepatitis B Virus. Nijhoff Publications, Boston.
- Levy,J.A. (1994) Virology. Prentice Hall, Englewood Cliffs.
- Fan,Y.-F., Lu,C.-C., Chang,Y.-C., Chang,T.-T., Lin,P.-W., Lei,H.-Y. and Su,I.-J. (2000) Identification of a pre-S2 mutant in hepatocytes expressing a novel marginal pattern of surface antigen in advanced disease of chronic hepatitis B virus infection. J. Gastroenterol. Hepatol., 15, 519528.[CrossRef][Web of Science][Medline]
- Fan,T.-F., Lu,C.-C., Chen,W.-C., Yao,W.-J., Wang,H.-C., Chang,T.-T., Lei,H.-Y., Shiau,A.-L. and Su,I.-J. (2001) Prevalence and significance of hepatitis B virus (HBV) pre-S mutants in serum and liver at different replicative stages of chronic HBS infection. Hepatology, 33, 277286.[CrossRef][Web of Science][Medline]
- Wang,H.-C., Wu,H.-C., Chen,C.-F., Lei,H.-Y. and Su,I.-J. (2003) Different types of ground glass hepatocytes in chronic hepatitis B virus infection contain specific pre-S mutants that may induce endoplasmic reticulum stress. Am. J. Path., 163, 24412449.
[Abstract/Free Full Text] - Hampton,R.Y. (2000) Getting the UPR hand on misfolded proteins. Curr. Biol., 10, 518521.
- Pahl,H.L. (1999) Signal transduction from the endoplasmic reticulum to the cell nucleus. Physiol. Rev., 79, 683701.
[Abstract/Free Full Text] - Collins,A.R., Dusinska,M., Gedik,C.M. and Stetina,R. (1996) Oxidative damage to DNA: do we have a reliable biomarker? Environ. Health Perspect., (suppl. 3), 465469.
- Rojas,E., Lopez,M.C. and Valverde,M. (1999) Single cell gel electrophoresis. Methodology and applications. J. Chromatogr., B 1-2, 225254.
- Tice,R.R., Agurell,E., Anderson,D., Burlinson,B., Hartmann,A., Kobayashi,H., Miyamae,Y., Rojas,E., Ryu,J.C. and Sasaki,Y.F. (2000) Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environ. Mol. Mutagen., 35, 206221.[CrossRef][Web of Science][Medline]
- Friedberg,E.C., Walker,G.C. and Siede,W. (1995) DNA Repair and Mutagenesis. ASM Press, Washington, DC.
- Kemp,P.A.V.D., Thomas,D., Barbey,R., Oliveira,R.D. and Boiteux,S. (1996) Cloning and expression in Escherichia coli of the OGG1 gene of Saccharomyces cerevisiae, which codes for a DNA glycosylase that excises 7,8-dihydro-8-oxoguanine and 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine. Proc. Natl Acad. Sci. USA, 93, 51975202.
[Abstract/Free Full Text] - Prasad,R., Lavrik,O.I., Kim,S.J., Kedar,P., Yang,X.P., Vande Berg,B.J. and Wilson,S.H. (2001) DNA polymerase beta-mediated long patch base excision repair. Poly (ADP-ribose)polymerase-1 stimulates strand displacement DNA synthesis. J. Biol. Chem., 276, 3241132414.
[Abstract/Free Full Text] - Philpott,S.M. and Buehring,G.C. (1999) Defective DNA repair in cells with human T-cell leukemia/bovine leukemia viruses: role of tax gene. J. Natl Cancer Inst., 91, 933942.
[Abstract/Free Full Text] - Yoshida,M.C. and Kodama,Y. (1977) Karyological characterization of a human lymphoblastoid cell line resistant to 6-thioguanine. Hum. Genet., 35, 201208.[CrossRef][Web of Science][Medline]
- Michaels,M.L. and Miller,J.H. (1992) The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine). J. Bacteriol., 174, 63216325.
[Free Full Text] - Yeh,S.-H., Chen,P.-J., Shau,W.-Y., Chen,Y.-W., Lee,P.-H., Chen,J.-T. and Chen,D.-S. (2001) Chromosomal allelic imbalance evolving from liver cirrhosis to hepatocellular carcinoma. Gastroenterology, 121, 699709.[CrossRef][Web of Science][Medline]
- Liu,H., Bowes,R.C., van de Water,B., Sillence,C., Nagelkerke,J.F. and Stevens,J.L. (1997) Endoplasmic reticulum chaperones GRP78 and calreticulin prevent oxidative stress, Ca2+ disturbances and cell death in renal epithelial cells. J. Biol. Chem., 272, 2175121759.
[Abstract/Free Full Text] - Serbinova,E.A., Kadiiska,M.B., Bakalova,R.A., Koynova,G.M., Stoyanovsky,D.A., Karakashev,P.C., Stoytchev,T.S., Wolinsky,I. and Kagan,V.E. (1989) Lipid peroxidation activation and cytochrome P-450 decrease in rat liver endoplasmic reticulum under oxidative stress. Toxicol. Lett., 47, 119123.[CrossRef][Web of Science][Medline]
- Wang,X.Z., Lawson,B., Brewer,J.W., Zinszner,H., Sanjay,A., Mi,L.J., Boorstein,R., Kreibich,G., Hendershot,L.M. and Ron,D. (1996) Signals from the stressed endoplasmic reticulum induce C/EBP-homologous protein (CHOP/GADD153). Mol. Cell. Biol., 16, 42734280.[Abstract]
- Q,L., Huang,S., Baltzis,D., Rivas-Estilla,A.M., Pluquet,O., Hatzoglou,M., Koumenis,C., Taya,Y., Yoshimura,A. and Koromilas,A.E. (2004) Endoplasmic reticulum stress induces p53 cytoplasmic localization and prevents p53-dependent apoptosis by a pathway involving glycogen synthase kinase-3ß. Genes Dev., 18, 261277.
[Abstract/Free Full Text] - Faivre,J., Frank-Vaillant,M., Poulhe,R., Mouly,H., Jessus,C., Brechot,C. and Sobczak-Thepot,J. (2002). Centrosome overduplication, increased ploidy and transformation in cells expressing endoplasmic reticulum-associated cyclin A2. Oncogene, 28, 14931500.
- Rusyn,I., Asakura,S., Pachkowski,B. et al. (2004) Expression of base excision DNA repair genes is a sensitive biomarker for in vivo detection of chemical-induced chronic oxidative stress: identification of the molecular source of radicals responsible for DNA damage by peroxisome proliferators. Cancer Res., 64, 10501057.
[Abstract/Free Full Text] - Shinmura,K. and Yokota,J. (2001) The OGG1 gene encodes a repair enzyme for oxidatively damaged DNA and is involved in human carcinogenesis. Antioxid. Redox Signal., 3, 597609.[CrossRef][Web of Science][Medline]
- Pahl,H.L., Sester,M., Burgert,H.G. and Baeuerle,P.A. (1996) Activation of transcription factor NF-kappaB by the adenovirus E3/19K protein requires its ER retention. J. Cell Biol., 132, 511522.
[Abstract/Free Full Text] - Bréchot,C., Hadchouel,M., Scotto,J., Fonck,M., Potet,F., Vyas,G.N. and Tiollais,P. (1981) State of hepatitis B virus DNA in hepatocytes of patients with hepatitis B surface antigen-positive and negative liver disease. Proc. Natl Acad. Sci. USA, 78, 39063910.
[Abstract/Free Full Text] - Shafritz,D.A. and Kew,M.C. (1981) Integration of hepatitis B virus DNA into the genome of liver cells in chronic liver disease and hepatocellular carcinoma. N. Engl. J. Med., 305, 10671073.[Abstract]
- Takada,S., Gotoh,Y., Hayashi,S., Yoshida,M. and Koike,K. (1990) Structural rearrangement of integrated hepatitis B virus DNA as well as cellular flanking DNA is present in chronically infected hepatic tissues. J. Virol., 64, 822828.
[Abstract/Free Full Text] - Hsu,T., Moroy,T., Etiemble,J., Louise,A., Trepo,C., Tiollais,P. and Buendia,M.A. (1988) Activation of c-myc by woodchuck hepatitis virus insertion in hepatocellular carcinoma. Cell, 55, 627635.[CrossRef][Web of Science][Medline]
- Buetow,K.H., Sheffield,V.C., Zhu,M., Zhou,T., Shen,F.M., Hino,O. and Smith,M. (1992) Low frequency of p53 mutations observed in a diverse collection of primary hepatocellular carcinomas. Proc. Natl. Acad. Sci. USA, 89, 96229626.
[Abstract/Free Full Text] - Urano,Y., Watanabe,K., Lin,C., Hino,O. and Tamaoki,T. (1991) Interstitial chromosomal deletion within 4q11-q13 in a human hepatoma cell line. Cancer Res., 51, 14601464.
[Abstract/Free Full Text] - Wang,H.P. and Rogler,C.E. (1988) Deletions in human chromosome arms 11p and 13q in primary hepatocellular carcinomas. Cytogenet. Cell Genet., 48, 7278.[Web of Science][Medline]
- Natoli,G., Avantaggiati,M.L., Chirllo,P., Costanzo,A., Artini,M., Balsano,C. and Levrero,M. (1994) Induction of the DNA-binding activity of c-jun/c-fos heterodimers by the hepatitis B virus transactivator pX. Mol. Cell. Biol., 14, 989998.
[Abstract/Free Full Text] - Natoli,G., Avantaggiati,M.L., Chirillo,P., Puri,P.L., Ianni,A., Balsano,C. and Levrero,M. (1994) Ras- and Raf-dependent activation of c-jun transcriptional activity by the hepatitis B virus transactivator pX. Oncogene, 9, 28372843.[Web of Science][Medline]
- Benn,J., Su,F., Doria,M. and Schneider,R.J. (1996) Hepatitis B virus HBx protein induces transcription factor AP-1 by activation of extracellular signal-realted and c-Jun N-terminal mitogen-activated protein kinases. J. Virol., 70, 49784985.
[Abstract/Free Full Text] - Huang,S.N. and Chisari,F.V. (1995) Strong, sustained hepatocellular proliferation precedes hepatocarcinogenesis in hepatitis B surface antigen transgenic mice. Hepatology, 21, 620626.[CrossRef][Web of Science][Medline]
- Chisari,F.V., Filippi,P., McLachlan,A., Milich,D.R., Riggs,M., Lee,S., Palmiter,R.D., Pinkert,C.A. and Brinster,R.L. (1986) Expression of hepatitis B virus large envelope polypeptide inhibits hepatitis B surface antigen secretion in transgenic mice. J. Virol., 60, 880887.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
Z.-L. Fang, C. A. Sabin, B.-Q. Dong, S.-C. Wei, Q.-Y. Chen, K.-X. Fang, J.-Y. Yang, J. Huang, X.-Y. Wang, and T. J. Harrison Hepatitis B virus pre-S deletion mutations are a risk factor for hepatocellular carcinoma: a matched nested case-control study J. Gen. Virol., November 1, 2008; 89(11): 2882 - 2890. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Y. Sung, S. K. W. Tsui, C.-H. Tse, E. Y. T. Ng, K.-S. Leung, K.-H. Lee, T. S. K. Mok, A. Bartholomeusz, T. C. C. Au, K. K. F. Tsoi, et al. Genotype-Specific Genomic Markers Associated with Primary Hepatomas, Based on Complete Genomic Sequencing of Hepatitis B Virus J. Virol., April 1, 2008; 82(7): 3604 - 3611. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-F. Wu, S.-L. Fu, C.-H. Kao, C.-W. Yang, C.-H. Lin, M.-T. Hsu, and T.-F. Tsai Chemopreventive Effect of Silymarin on Liver Pathology in HBV X Protein Transgenic Mice Cancer Res., March 15, 2008; 68(6): 2033 - 2042. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Hsieh, I.-J. Su, H.-C. Wang, J.-H. Tsai, Y.-J. Huang, W.-W. Chang, M.-D. Lai, H.-Y. Lei, and W. Huang Hepatitis B Virus Pre-S2 Mutant Surface Antigen Induces Degradation of Cyclin-Dependent Kinase Inhibitor p27Kip1 through c-Jun Activation Domain-Binding Protein 1 Mol. Cancer Res., October 1, 2007; 5(10): 1063 - 1072. [Abstract] [Full Text] [PDF] |
||||
![]() |
I-C. Huang, C.-Y. Chien, C.-R. Huang, and S. J. Lo Induction of hepatitis D virus large antigen translocation to the cytoplasm by hepatitis B virus surface antigens correlates with endoplasmic reticulum stress and NF-{kappa}B activation J. Gen. Virol., June 1, 2006; 87(6): 1715 - 1723. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Meuleman, L. Libbrecht, S. Wieland, R. De Vos, N. Habib, A. Kramvis, T. Roskams, and G. Leroux-Roels Immune Suppression Uncovers Endogenous Cytopathic Effects of the Hepatitis B Virus J. Virol., March 15, 2006; 80(6): 2797 - 2807. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Hung, I.-J. Su, H.-Y. Lei, H.-C. Wang, W.-C. Lin, W.-T. Chang, W. Huang, W.-C. Chang, Y.-S. Chang, C.-C. Chen, et al. Endoplasmic Reticulum Stress Stimulates the Expression of Cyclooxygenase-2 through Activation of NF-{kappa}B and pp38 Mitogen-activated Protein Kinase J. Biol. Chem., November 5, 2004; 279(45): 46384 - 46392. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 and 








