Carcinogenesis Advance Access originally published online on July 29, 2004
Carcinogenesis 2004 25(11):2247-2255; doi:10.1093/carcin/bgh246
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.25 no.11 © Oxford University Press 2004; all rights reserved.
ARTICLE |
IL-6-induced survival of colorectal carcinoma cells is inhibited by butyrate through down-regulation of the IL-6 receptor
1 Department of Medical Oncology, Dana-Farber Cancer Institute and 2 Departments of Medicine, Harvard Medical School and Brigham and Women's Hospital, Boston, MA 02115, USA
3 To whom correspondence should be addressed Email: david_frank{at}dfci.harvard.edu
| Abstract |
|---|
|
|
|---|
Colorectal carcinoma cells are characterized by over-expression of IL-6 and the IL-6 receptor, an autocrine loop that promotes the development of many tumors. To determine the importance of this pathway, we examined the role that IL-6 plays in the biology of 228 and RKO colorectal tumor cells. IL-6 induced prominent tyrosine phosphorylation of the transcription factor STAT1 in both cell types. Furthermore, IL-6 exerts functional effects in these cells in that it inhibited apoptosis induced by Fas ligation, and up-regulated Bcl-xl, a STAT target gene, which can promote cell survival. Butyrate, a compound formed in the intestines of people who consume a high-fiber diet, may confer protection against the development of colorectal cancer. Given the potential importance of IL-6 in the pathogenesis of colorectal tumors, we tested the hypothesis that butyrate acts by inhibiting IL-6-induced signaling events in colorectal carcinoma cells. Following treatment with butyrate, the activation of STAT1 in response to IL-6, but not interferon-
, was completely lost. Butyrate induced a prominent decrease of mRNA and cell surface expression of the IL-6 receptor
(IL-6R
) chain. Introduction of a soluble form of the IL-6R
chain restored IL-6-induced STAT1 activation and resistance to apoptosis of butyrate treated cells. These experiments indicate that IL-6 may play an important role in the pathogenesis of colorectal cancers, and that butyrate may exert its protective effect by specifically blocking IL-6-induced signaling events.
Abbreviations: IL-6R, IL-6 receptor; IFN-
, interferon-
; PBS, phosphate-buffered saline; sIL-6R
, soluble IL-6R
chain
| Introduction |
|---|
|
|
|---|
Cytokines are key factors in regulating the growth and survival of hematopoietic and epithelial cells, and can also promote the proliferation of malignant cells. IL-6 is of particular interest, as it is part of a family of cytokines, which have broad actions on epithelial, hematopoietic and neuronal cells (1). Although both IL-6 and the IL-6 receptor (IL-6R) are expressed to a small extent on normal colonic epithelium, both of these proteins are expressed to a much greater degree in colonic carcinomas (2). This suggests that an IL-6 autocrine loop may be important to the genesis and/or maintenance of colorectal carcinomas. IL-6 exerts its effects by interacting with a cell surface receptor, which is comprised of an 80-kDa subunit necessary for ligand binding (gp80), and a signal transducing subunit termed gp130 (3). gp130, which is involved in the transduction of signals from other cytokines such as ciliary neurotrophic factor, leukemia inhibitory factor and oncostatin M, associates with members of the Jak family of tyrosine kinases. When IL-6 binds to its receptor, it induces activation of the Jaks and the subsequent tyrosine phosphorylation of latent transcription factors termed STATs. Once phosphorylated, STATs dimerize, translocate to the nucleus and bind to specific DNA elements where they can modulate transcription of target genes (4,5). STATs are activated inappropriately in a variety of human tumors (6,7). The over-expression of IL-6 and the IL-6R in colorectal carcinoma suggested that ectopic STAT activation might play a role in the pathogenesis of colorectal cancer.
The observation that the incidence of colorectal carcinoma was much greater in industrial societies compared with agricultural societies suggested that dietary factors might modulate the generation and progression of such tumors (8). Although it is controversial (9), it has been suggested that individuals who have a greater intake of dietary fiber have a decreased incidence of colorectal neoplasms (1014). While there may be several mechanisms by which fiber might exert a protective effect, diets high in fiber lead to notable changes in the microbial flora of the bowel. Butyrate is a non-toxic short-chain fatty acid that is produced naturally during the microbial fermentation of dietary fiber in the colon (15). Butyrate has been reported to cause a G1 block, inhibition of cellular proliferation, and inhibition of onset of DNA synthesis in a large number of cultured cell types (16), and butyrate may exert an antiproliferative effect upon the cells of the mucosal epithelium (17). Therefore, it has been proposed that butyrate may mediate a protective effect of dietary fiber against colorectal cancer (17,18), and might also have therapeutic benefit in this malignancy. However, the precise mechanism by which butyrate mediates its effects on colonic mucosa is unknown.
Given this background, we examined the signaling events and biological effects induced by IL-6 in colorectal carcinoma cells in vitro, and determined how butyrate modulated this pathway.
| Materials and methods |
|---|
|
|
|---|
Materials
Sodium butyrate and soluble IL-6R
chain (sIL-6R
) were obtained from Sigma (St Louis, MO). IL-6 and interferon (IFN)-
were obtained from Genzyme Biological Company (Cambridge, MA). Antibodies to Bcl-x were obtained from Transduction Laboratories (Lexington, KY), antibodies to tubulin, STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and antibodies to CD95 (19) and tyrosine phosphorylated STAT1 (20) and STAT3 (21) were generated as described.
Cell culture
Human colon cancer cell lines RKO and 228 were kindly provided by Drs Bruce Spiegelman and Elisabetta Mueller (Dana-Farber Cancer Institute). Cells were cultured in Dulbecco's Modified Eagle's Medium (Mediatech, Herndon, VA) containing 10% heat-inactivated fetal calf serum supplemented with penicillin (100 U/ml) and streptomycin (100 µg/ml) at 37°C in a humidified atmosphere of 5% CO2 and 95% air (22). IL-6 was used at a concentration of 30 ng/ml, unless indicated otherwise, and IFN-
was used at 500 U/ml. sIL-6R
was used at a concentration of 10 ng/ml, and was added to the medium 4 h prior to stimulation with IL-6 unless noted otherwise. To induce differentiation, RKO cells were treated with 0.5 mM butyrate and 228 cells were treated with 0.25 mM butyrate. Apoptosis was induced with anti-CD95 (7C11 ascites) (19), diluted 1:1000 for RKO cells and 1:10 000 for 228 cells or Fas ligand (5 ng/ml; Oncogene, Boston, MA).
Western blotting
After appropriate stimulation, cells were placed on ice, washed once with ice-cold phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4), and extracted in buffer containing 50 mM Tris, pH 7.5, 0.5% NP-40, 250 mM NaCl, 1 mM sodium orthovanadate, 1 mM phenylmethylysulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml pepstatin and 1 µg/ml aprotinin. Insoluble material was removed by centrifugation at 12 000 g for 1 min. Protein concentration was estimated by the Bradford assay using bovine serum albumin as standard. Samples were mixed with 2 vol of 3x Laemmli sample buffer and heated to 95°C for 5 min prior to SDSPAGE and transfer to nitrocellulose membranes. The membranes were blocked with 5% non-fat dry milk in TBST (100 mM Tris, pH 8.0, 150 mM NaCl and 0.05% Tween 20) for 30 min, then incubated with primary antibody in TBST containing 3% BSA for 1 h at room temperature. Antibodies to STAT1 and tyrosine-phosphorylated STAT1 were diluted 1:10 000, and antibody to Bcl-xl was diluted 1:500. After washing, the blot was incubated with horseradish peroxidase-conjugated secondary antibody (Calbiochem, La Jolla, CA) diluted 1:20 000 in TBST containing 1% BSA for 1 h at room temperature. After additional washing, bound antibody was detected by chemiluminescence.
Colonic differentiation assay
Alkaline phosphatase activity was determined by a modification of the method of Chung and co-workers (23,24). 100 µg of cell extract was incubated with 10 mM p-nitrophenyl phosphate in 0.1 M Tris buffer, pH 10.0, at 37°C for 1 h. The reaction was terminated by the addition of 900 µl of 1 M sodium carbonate and the amount of p-nitrophenol formed was determined spectrophotometrically at 410 nm. Relative phosphatase activity was determined after normalization to an internal control.
Cell cycle analysis
Cells (1 x 106) were washed, re-suspended in 100 µl of ice-cold PBS, to which 1 ml of ice cold 80% ethanol was added while vortexing. After incubating for 30 min on ice, cells were washed once and re-suspended in 1 ml PBS. Five microliters of propidium iodide (1 mg/ml; Sigma, St Louis, MO) and 1 µl of RNase (10 mg/ml) were added to the cell suspension, which was then incubated for 1 h at room temperature in the dark. Fluorescence was determined using an EPICS Elite ESP flow cytometer (Coulter, Miami, FL).
RTPCR
Total RNA was extracted using Trizol Reagent (Gibco/BRL, Paisley, UK) according to the manufacturer's guidelines. RTPCR was performed as described (47), using the following primers: IL-6R
chain (gp80), CATTGCCCATGTTCTGAGGTTC and AGTAGTCTGTATTGCGGATGTC (a gift from Dr Jian Zhang, University of Michigan Cancer Center); ß-glucuronidase (GUSB), GACGGTGATGTCATCGATGT and ACTATCGCCATCAACAACACACTCACC; gp130, GTT CGT GCG CTG TGG AGA and CCA AGT CTG CAA CTG CAA CA; TATA binding protein (TBP), CCGTGAATCTTGGCTGTAAACTTG and CAACGCAGTTGTCCGTGGCTCTCT; and, IL-6, CAG GAG CCC AGC TAT GAA CT and GGA ATC TTC TCC TGG GGG TA. The intensity of the PCR products was quantified using an imaging densitometer (Model GS-670, Biorad, Herts, UK) and Molecular Analist/PC Software (Biorad Image Analysis System).
Flow cytometry for gp80 cell surface expression
Cells were washed in cold PBS, then re-suspended in 50 µl of cold PBS plus 15 µl of antibody to IL-6R
(C-20, Santa Cruz Biotechnology) and incubated for 15 min on ice. One milliliter of cold PBS was added and cells were centrifuged and washed once with cold PBS. Cells were re-suspended in 50 µl of cold PBS plus 2 µl of phycoerythrin-conjugated anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA) and again incubated for 15 min on ice. One milliliter of cold PBS was then added and cells were washed once in cold PBS. Cells were re-suspended in cold PBS and fluorescence was measured as above.
Survival analysis following transfection of Bcl-xl
Using Lipofectamine 2000 (Invitrogen, Carlsbad, CA), RKO cells were transfected with vector alone, or an expression construct for Bcl-xl (provided by Dr James Griffin, Dana-Farber). To allow analysis of transfected cells only, cells were co-transfected with a vector for farnesylated enhanced green fluorescent protein (pEGFP-F; Clontech, Palo Alto, CA), using a 3:1 M ratio. After 18 h, medium was changed, and 24 h later cells were treated with Fas ligand. Apoptosis was assessed by flow cytometry 24 h after treatment with Fas ligand by gating on the EGFP positive cells and quantifying cells with sub-2 N DNA content.
| Results |
|---|
|
|
|---|
IL-6 induces STAT1 tyrosine phosphorylation in RKO and 228 colon carcinoma cells
Given the enhanced expression of both IL-6 and the IL-6R in colorectal carcinoma cells, we sought to determine the biochemical and biological effects of IL-6 on these cells. IL-6 is known to induce the tyrosine phosphorylation of STAT1 and STAT3 in a variety of cell types (1). To determine if this pathway is present and functional in human colorectal epithelium, RKO and 228 cells were treated with IL-6, and then STAT activation was determined by performing western blots with antibodies specific for the tyrosine phosphorylated form of individual STATs. IL-6 induced the rapid phosphorylation of STAT1
and STAT1ß in both cell types at doses as low as 5 ng/ml (Figure 1A), indicating that IL-6 can cause physiologic activation of this transcription factor in colorectal carcinoma cells. Only minimal STAT3 phosphorylation was seen in response to IL-6 in either cell type (Figure 1B).
|
IL-6 does not alter the growth or differentiation of colorectal carcinoma cells
Given the prominent STAT1 phosphorylation induced by IL-6 in colorectal carcinoma cells, and the apparent autocrine activation of this pathway in colorectal tumors, we examined the biological effects of IL-6 on colorectal carcinoma cells in vitro. We considered the possibility that IL-6 promoted the growth rate of colorectal carcinoma cells. However, the growth of RKO or 228 cells in high serum (10%) or low serum (1%) containing medium was unaffected by the addition of up to 30 ng/ml IL-6 (data not shown). We next evaluated the hypothesis that IL-6 modulated the differentiation of colonic epithelium. To assess differentiation, the expression of the brush border marker alkaline phosphatase and the accumulation of cells in the G0/G1 phase of the cell cycle were assessed. Both RKO and 228 cells showed low basal levels of alkaline phosphatase activity, which was unaltered by the addition of IL-6 (Figure 2A). Colonic epithelial differentiation can be promoted by the short-chain fatty acid butyrate, which is produced in the colon by fermentation of dietary fiber (25). Within 24 h of butyrate treatment, both RKO and 228 cells showed a 4060% increase in alkaline phosphatase expression. IL-6 had no effect on the butyrate-induced differentiation of these cells.
|
Under normal asynchronous growth conditions,
2535% of RKO and 228 cells are undergoing DNA synthesis at any one time (Figure 2B). No change in the cell cycle distribution was seen after adding IL-6 to the culture. Differentiation of these cells induced by butyrate led to a dramatic decrease in S phase fraction for each cell type, consistent with the growth arrest that occurs upon terminal differentiation. As with alkaline phosphatase activity, the butyrate-induced cell cycle arrest was unaltered by IL-6. Thus, IL-6 has no effect on the intrinsic or butyrate-modulated growth and differentiation of these colorectal carcinoma cells.
IL-6 prevents Fas-mediated apoptosis in colorectal carcinoma cells through increased expression of Bcl-xl
Malignancies arise due to the inappropriate accumulation of cells, which may occur due to over-proliferation, or a loss of differentiation or apoptosis. Cellular homeostasis in the colonic mucosa is maintained by a balance of proliferation in the intestinal crypts, and cell death at the tips of the villi. As we did not see a direct effect of IL-6 on the growth or differentiation of colorectal carcinoma cells, we examined the effect of this cytokine on apoptosis. Fas, or CD95, belongs to a family of membrane proteins that transduce apoptotic signals. Fas is normally expressed on the basolateral surface of colorectal epithelium, where it is exposed to circulating immune cells, and may allow for the targeted deletion of abnormal epithelial cells. When RKO or 228 cells are incubated with a monoclonal antibody to CD95 or soluble Fas ligand, they undergo apoptosis, which can be quantified by measuring the proportion of cells displaying a sub-2 N DNA content. Under normal growth conditions, between 10 and 15% of RKO and 228 cells contained sub-2 N DNA content (Figure 2C). Upon treatment with an antibody to CD95, the fraction of cells with sub-2 N DNA content increased by
60% in 228 cells, and more than doubled in RKO cells. This indication of apoptosis was also reflected in morphological evidence of cell death. If the cells were pre-incubated with IL-6, however, Fas-induced apoptosis decreased to baseline in 228 cells, and decreased by 75% in RKO cells. Thus, IL-6 suppresses Fas-mediated apoptosis in colorectal carcinoma cells.
One possible mechanism by which cells may become resistant to undergoing apoptosis is through loss of cell surface expression of Fas. However, IL-6 had no effect on Fas expression on RKO and 228 cells (data not shown). Alternatively, as has been reported in other systems, IL-6 might cause up-regulation of pro-survival proteins such as Bcl-xl (26). To determine whether this mechanism is operative in colorectal carcinoma cells, 228 and RKO cells were untreated, or treated with IL-6, and Bcl-xl protein expression was quantified by western blot analysis. Whereas low levels of this protein were expressed in untreated cells, the addition of IL-6 led to a prominent increase in Bcl-xl expression, which could be detected as early as 6 h after treatment, and reached maximal levels in 1624 h (Figure 3A and B). To directly test the hypothesis that the protective effects of IL-6 were mediated through Bcl-xl, an expression vector for Bcl-xl was transfected into RKO cells. Bcl-xl protected these cells from Fas-mediated apoptosis, indicating that it was sufficient to confer this pro-survival effect (Figure 3C).
|
Butyrate inhibits IL-6-induced STAT1 phosphorylation and anti-apoptotic effects through down-regulation of the IL-6R
chainThe finding that IL-6 protects against Fas-mediated apoptosis suggested that IL-6 might play an important role in the development of colorectal neoplasms. Given that beneficial effects of a high-fiber diet may be mediated by butyrate, we examined the effect of butyrate on IL-6 signaling events in colorectal carcinoma cells. Pre-incubating 228 or RKO cells with butyrate for as little as 8 h led to a prominent loss of IL-6-induced STAT1 phosphorylation (Figure 4A and B). By 24 h after butyrate treatment, STAT1 tyrosine phosphorylation was completely abolished in both cell lines. This inhibition of STAT1 phosphorylation in response to IL-6 did not represent toxicity from butyrate, as total STAT1 levels were unaffected by this agent, and the ability of IFN-
to induce STAT1 phosphorylation was unimpaired (Figure 4C and D). Small changes in IFN-
-induced STAT1 phosphorylation were occasionally noted in butyrate-treated cells, but no consistent modulation was seen. Thus, butyrate leads to a specific loss of IL-6-induced STAT1 activation. That this butyrate effect has functional consequences on the response to IL-6 was shown by the finding that in butyrate-treated cells, IL-6 no longer leads to an up-regulation of Bcl-xl (Figure 3A and B, lanes 58). To determine whether butyrate interfered with the pro-survival effects of IL-6, RKO cells were left untreated or treated with butyrate, and the protective effect of IL-6 on Fas-mediated apoptosis was determined. Butyrate by itself had no effect on the survival of these cells alone or following Fas treatment (Figure 5A). However, pre-treatment of cells with butyrate completely abrogated the anti-apoptotic effect of IL-6, indicating that butyrate inhibits both the signaling and pro-survival effects of IL-6 in colorectal carcinoma cells.
|
|
Butyrate can inhibit the activation of NF-
B, another pro-survival transcription factor, in some intestinal epithelial cells (48) but not others (49). Using an NF-
B-luciferase reporter system, RKO cells show no basal or IL-6-induced NF-
B activity (data not shown), indicating that the effects of IL-6 and butyrate are independent of this transcription factor in this system.
Given that butyrate affects IL-6 signaling specifically, we considered the hypothesis that butyrate was acting by altering expression of the IL-6R
chain (gp80). To examine this, RTPCR was performed to quantify the levels of mRNA for gp80 in 228 and RKO cells, which had been untreated or treated with butyrate for increasing times. A time-dependent loss of gp80 expression was seen in both cell types. By 24 h of treatment, butyrate induced a decrease in gp80 mRNA of 60% in RKO cells and 30% in 228 cells (Figure 5B). To determine whether the decrease in mRNA for gp80 following butyrate treatment was also reflected in changes in expression at the cell surface, flow cytometry was performed on RKO cells with an antibody specific for this protein (Figure 5C). Following treatment with butyrate, IL-6R
chain expression decreased by
50%.
Although there is evidence that an IL-6 autocrine loop may be present in colorectal carcinoma, it is unlikely that such a mechanism is operating in these cell lines, as no basal phosphorylation of STAT1 is seen. Small amounts of IL-6 mRNA can be detected in RKO cells by RTPCR (data not shown). However, this is not changed by butyrate treatment, suggesting that butyrate is not acting through inhibition of autocrine IL-6 secretion.
Soluble IL-6R
restores IL-6-induced STAT1 activation and anti-apoptotic effects to butyrate-treated cells
Although gp80 expression decreased following butyrate treatment, it was possible that other components of the IL-6 signaling apparatus were also affected in butyrate-treated cells. Cells that express gp130 and other components of the Jak-STAT pathway, but which lack gp80, can be made responsive to IL-6 if they are incubated with a soluble form of the IL-6R
chain (27). To determine if the remainder of the IL-6 signaling pathway was intact, butyrate-treated cells were treated with IL-6 in the absence or presence of sIL-6R
. Whereas butyrate led to a loss of IL-6-induced STAT1 phosphorylation in either 228 or RKO cells (Figure 6A and B, lane 6), the addition of sIL-6R
was able to restore IL-6-induced STAT1 tyrosine phosphorylation even in the presence of butyrate (Figure 6A and B, lane 7). The addition of sIL-6R
to cells not treated with butyrate led to a small increase in IL-6-induced STAT1 tyrosine phosphorylation (Figure 6A and B, lane 4). Thus, the remainder of the IL-6 signaling apparatus functions normally in butyrate-treated cells, and the loss of IL-6 signaling reflects decreased expression of gp80 in response to butyrate. Furthermore, no change in expression of gp130, the IL-6R ß chain, was seen with butyrate treatment at the mRNA level (Figure 6C) or on the cell surface (data not shown).
|
To determine whether restoration of IL-6-induced STAT1 activation was associated with the pro-survival effects of IL-6, RKO cells were treated with butyrate, and the effects of IL-6 on Fas-mediated apoptosis was assessed in the presence or absence of the sIL-6R
. Re-introduction of the sIL-6R
led to a significant protection from Fas-induced apoptosis (Figure 5A), although it did not completely reduce it to levels seen in cells not treated with butyrate. Thus, butyrate may modulate the effects of IL-6 on survival of colorectal carcinoma cells by additional mechanisms as well. | Discussion |
|---|
|
|
|---|
Extensive work has delineated the signaling pathways activated by cytokines, which are required for cellular proliferation in hematopoietic cells. In particular it has been shown that STAT transcription factors play an important role in mediating the effects of cytokines (1,4,5,28). In a variety of hematologic malignancies, cell growth is found to be autonomous of growth factors, and in many such tumors it has been shown that STAT proteins are activated (7). In other hematologic cancers, autocrine pathways are active, which appear to drive cellular proliferation (29). In addition to shedding light on the pathogenesis of hematologic malignancies, these findings have suggested potential cellular targets for anti-neoplastic therapy (30). Although much of this seminal work on cytokine signaling was performed in hematopoietic cells, many of these pathways are also present in epithelial cells. Given that the majority of human cancers arise from epithelial cells, it is of importance to determine whether such pathways may be involved in the pathogenesis of these tumors as well. We focused on colorectal cancers, as these are the second leading cause for cancer death in the United States, and their incidence seems to be increasing with progressive industrialization.
That cytokines may play a role in the biology of colorectal cancer was first suggested by the finding that expression of both IL-6 and the IL-6R were increased in malignant tissue compared with normal colonic mucosa (2). IL-6 has diverse effects on various cell populations. IL-6 can stimulate the growth of multiple myeloma cells in both an autocrine and paracrine fashion (29), and interruption of an IL-6 autocrine loop can lead to inhibition of myeloma cell survival (31). IL-6 acts as a growth factor in hairy cell leukemia (32), and elevated serum levels of IL-6 are strongly associated with poor prognosis in diffuse large cell lymphoma (33). However, the effects of IL-6 on tumor cells are not restricted to hematologic malignancies. For example, IL-6 promotes resistance to chemotherapeutic agents in renal cell carcinoma (34) and prostate cancer (35). IL-6 may also exert anti-proliferative effects in certain tumors, such as melanoma (36) and breast carcinoma (37).
As a first step in determining the role that IL-6 plays in the biology of colorectal carcinoma, we wished to demonstrate that IL-6 could induce physiologic signaling events in 228 and RKO cells, specifically the activation of STAT transcription factors. IL-6 has been shown to activate STAT1 and STAT3 in a variety of cell types (38), although predominant activation of either STAT1 or STAT3 may occur. Although IL-6 induced prominent STAT1 tyrosine phosphorylation in both cell lines, STAT3 activation was minimal. Other cytokines that signal through gp130, such as leukemia inhibitory factor, may also exert their physiologic effects through STAT1 rather than STAT3 (26,39). The mechanism by which IL-6 selectively activates STAT1 in colorectal carcinoma cells is unclear, although the ratio of STAT1 and STAT3 activation may affect the target genes activated by IL-6 in a given cell type, and may determine its biological effect.
Given that IL-6 induces transcription factor activation in colorectal carcinoma cells, we next determined the biological effects exerted by IL-6 on these cells. IL-6 can modulate cellular growth, differentiation and apoptosis in various systems, and dysregulation of any of these events can lead to the development of tumors. We failed to detect any change in the growth and differentiation of 228 and RKO cells in response to IL-6. However, given that apoptosis is an important aspect of normal colonic mucosal homeostasis, and that IL-6 can inhibit apoptosis in multiple myeloma cells (40) we examined the effect of IL-6 on apoptosis induced by Fas ligation. This is of physiologic importance as Fas is expressed normally on the basolateral surface of colorectal epithelium, and may play a role in the elimination of abnormal cells. As in hematopoietic cells, Fas activation leads to rapid and profound apoptosis in these colorectal cell lines. However, pre-treatment of these cells with IL-6 led to a prominent reduction in Fas-mediated apoptosis. Thus, we tested the hypothesis that the anti-apoptotic protein Bcl-xl, which has been shown to be up-regulated by IL-6 in cardiac myocytes (26) and multiple myeloma cells (41), might be mediating this effect. Bcl-xl expression did protect RKO cells from Fas-mediated apoptosis (Figure 3C). Furthermore, the prominent increase in Bcl-xl protein expression induced by IL-6 suggests that the anti-apoptotic effect exerted by IL-6 on colorectal carcinoma cells may be mediated by up-regulation of this protein. Thus, the increased expression of both IL-6 and the IL-6R in colonic tumors may be a mechanism to prevent normal apoptosis, and to allow the inappropriate accumulation of malignant cells. These findings suggest that interventions aimed at inhibiting IL-6 signaling, either at the level of the cytokine, its receptor (4244) or STAT transcription factors (45) may have a therapeutic benefit in colorectal carcinoma.
Although it is controversial (9), it has been suggested that the risk of colorectal cancer can be reduced by dietary modification, particularly increasing dietary fiber (1014). Understanding the mechanism by which a high-fiber diet may decrease the risk of colon cancer may have implications for other chemopreventive strategies and perhaps the treatment of colon carcinoma. It has been proposed that butyrate, a short-chain fatty acid produced in the lumen of the colon after the ingestion of fiber, may be a mediator of the protective effect of fiber. One action of butyrate is to promote cellular differentiation. However, given the potential importance of IL-6 signaling in the genesis of colon cancers and in the protection from apoptosis of colorectal carcinoma cells, we examined whether butyrate might interfere with IL-6-induced signaling events. Butyrate treatment led to the loss of IL-6-induced STAT1 activation. Given that the activation of STAT1 induced by IFN-
was unaffected by butyrate treatment, it seemed likely that the effect of butyrate was being mediated at a very proximal step of the signaling cascade. In fact butyrate led to a prominent decrease of expression of the IL-6R
chain. Some expression of the IL-6R
chain could still be detected by flow cytometry following butyrate treatment. However, this receptor may be non-functional given that no IL-6-induced STAT1 activation could be detected (Figure 4A and B), and that STAT1 activation could be restored by introduction of the sIL-6R
(Figure 6). The specific loss of expression of IL-6R
as a means to allow resistance to the effects of IL-6 has also been reported in melanoma cells (46), and may be an important means for controlling the response of cells to IL-6, without altering the response to other cytokines, which signal through gp130. The fact that reintroducing a soluble form of the IL-6R
chain fully restored IL-6-induced STAT activation, but did not completely restore resistance to apoptosis in butyrate-treated cells (Figure 5A) raises the possibility that butyrate may be acting through other mechanisms as well. In fact, there is evidence that butyrate can modulate the expression of a number of important target genes, perhaps through altering histone acetylation (49).
In summary, we have found that IL-6, a cytokine that along with its receptor is over-expressed in colorectal cancers, promotes the survival of colorectal cancer cells in vitro. Furthermore, butyrate, a compound that may mediate the protective effects of dietary fiber against the development of colorectal tumors, down-regulates IL-6 signaling in these cells at least in part through inhibiting expression of the IL-6R
chain. Further delineation of the role that IL-6 signaling events may play in colorectal tumors may allow the development of novel chemopreventive or therapeutic strategies for this prevalent disease.
| Notes |
|---|
The first two authors contributed equally to this work.
| Acknowledgments |
|---|
We thank Jennifer Gervais for experimental assistance and Suzan Lazo-Kallanian and John Daley for assistance with flow cytometry. This work was supported by the Cancer Research Foundation of America and the Rona C.Livshin family.
| References |
|---|
|
|
|---|
- Frank,D.A. and Greenberg,M.E. (1996) Signal transduction pathways activated by ciliary neurotrophic factor and related cytokines. Persp. Dev. Neurobiol., 4, 318.
- Shirota,K., LeDuy,L., Yuan,S.Y. and Jothy,S. (1990) Interleukin-6 and its receptor are expressed in human intestinal epithelial cells. Virch. Archiv. B Cell Pathol., 58, 303308.
- Jenab,S. and Morris,P.L. (1996) Differential activation of signal transducer and activator of transcription (STAT)-3 and STAT-1 transcription factors and c-fos messenger ribonucleic acid by interleukin-6 and interferon-
in Sertoli cells. Endocrinology, 137, 47384743.[Abstract]
- Darnell,J.J., Kerr,I.M. and Stark,G.R. (1994) Jak-STAT pathway and transcription activation in response to IFNs and other extracellular signaling proteins. Science, 264, 14151420.
[Abstract/Free Full Text] - Ihle,J.N. (1996) STATs: signal transducers and activators of transcription. Cell, 84, 331334.[CrossRef][Web of Science][Medline]
- Frank,D.A. (2003) STAT signaling in cancer: insights into pathogenesis and treatment strategies. Cancer Treat. Res., 115, 267291.[Medline]
- Lin,T.S., Mahajan,S. and Frank,D.A. (2000) STAT signaling in the pathogenesis and treatment of leukemias. Oncogene, 19, 24962504.[CrossRef][Web of Science][Medline]
- Burkitt,D.P. (1971) Epidemiology of cancer of the colon and rectum. Cancer, 28, 313.[CrossRef][Web of Science][Medline]
- Fuchs,C.S., Giovannucci,E.L., Colditz,G.A., Hunter,D.J., Stampfer,M.J., Rosner,B., Speizer,F.E. and Willett,W.C. (1999) Dietary fiber and the risk of colorectal cancer and adenoma in women. N. Engl. J. Med., 340, 169176.
[Abstract/Free Full Text] - Peters,U., Sinha,R., Chatterjee,N. et al. (2003) Dietary fibre and colorectal adenoma in a colorectal cancer early detection programme. Lancet, 361, 14911495.[CrossRef][Web of Science][Medline]
- Bingham,S.A., Day,N.E., Luben,R. et al. (2003) Dietary fibre in food and protection against colorectal cancer in the European Prospective Investigation into Cancer and Nutrition (EPIC): an observational study. Lancet, 361, 14961501.[CrossRef][Web of Science][Medline]
- Howe,G.R., Benito,E., Castelleto,R., Cornee,J., Esteve,J., Gallagher,R.P., Iscovich,J.M., Deng-ao,J., Kaaks,R. and Kune,G.A. (1992) Dietary intake of fiber and decreased risk of cancers of the colon and rectum: evidence from the combined analysis of 13 case-control studies. J. Natl Cancer Inst., 84, 18871896.
[Abstract/Free Full Text] - Reddy,B.S., Hedges,A.R., Laakso,K. and Wynder,E.L. (1978) Metabolic epidemiology of large bowel cancer: fecal bulk and constituents of high-risk North American and low-risk Finnish population. Cancer, 42, 28322838.[CrossRef][Web of Science][Medline]
- Trock,B., Lanza,E. and Greenwald,P. (1990) Dietary fiber, vegetables and colon cancer: critical review and meta-analyses of the epidemiologic evidence. J. Natl Cancer Inst., 82, 650661.
[Abstract/Free Full Text] - Cummings,J.H., Pomare,E.W., Branch,W.J., Naylor,C.P.E. and MacFarlane,G.T. (1987) Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut, 28, 12211227.
[Abstract/Free Full Text] - Vaziri,C., Stice,L. and Faller,D.V. (1998) Butyrate-induced G1 arrest results from p21-independent disruption of retinoblastoma protein-mediated signal. Cell Growth Diff., 9, 465474.[Abstract]
- Campisi,J., Medrano,E.E., Morreo,G. and Pardee,A. (1982) Restriction point control of cell growth by a labile protein: evidence for increased stability in transformed cells. Proc. Natl Acad. Sci. USA, 79, 436440.
[Abstract/Free Full Text] - Hague,A., Manning,M., Hanlon,K.A., Huschtscha,L.I., Hart,D.D. and Paraskeva,C. (1993) Sodium butyrate induces apoptosis in human colonic tumor cell lines in a p53-independent pathway: implications for the possible role of dietary fibre in the prevention of large bowel cancer. Int. J. Cancer, 55, 498505.[Web of Science][Medline]
- Robertson,M.J., Manley,T.J., Pichert,G., Cameron,C., Cochrane,K.J., Levine,H. and Ritz,J. (1995) Functional consequences of APO-1/Fas (CD95) antigen expression by normal and neoplastic hematopoietic cells. Leukem. Lymph., 17, 5161.
- Frank,D.A., Robertson,M., Bonni,A., Ritz,J. and Greenberg,M.E. (1995) IL-2 signaling involves the phosphorylation of novel Stat proteins. Proc. Natl Acad. Sci. USA, 92, 77797783.
[Abstract/Free Full Text] - Bonni,A., Sun,Y., Nadal-Vicens,M., Bhatt,A., Frank,D.A., Rozovsky,I., Stahl,N., Yancopoulos,G.D. and Greenberg,M.E. (1997) Regulation of gliogenesis in the central nervous system by the JAK-STAT signaling pathway. Science, 278, 477483.
[Abstract/Free Full Text] - Barnard,J.A. and Warwick,G. (1993) Butyrate rapidly induces growth inhibition and differentiation in HT-29 cells. Cell Growth Differen., 4, 495501.[Abstract]
- Chung,Y.S., Song,I.S., Erickson,R.H., Sleisenger,M.H. and Kim,Y.S. (1985) Effect of growth and sodium butyrate on brush border membrane-associated hydrolases in human colorectal cancer cell lines. Cancer Res., 45, 29762982.
[Abstract/Free Full Text] - Nathan,D.F., Burkhart,S.R. and Morin,M.J. (1990) Increased cell surface EGF receptor expression during the butyrate-induced differentiation of human HCT-116 colon tumor cell clones. Exp. Cell Res., 190, 7684.[CrossRef][Web of Science][Medline]
- Heerdt,B.G., Houston,M.A. and Audenlicht,L.H. (1994) Potentiation by specific short-chain fatty acids of differentiation and apoptosis in human colonic carcinoma cell lines. Cancer Res., 54, 32883294.
[Abstract/Free Full Text] - Fujio,Y., Kunisada,K., Hirota,H., Yamauchi-Takihara,K. and Kishimoto,T. (1997) Signals through gp130 upregulate bcl-x gene expression via STAT1-binding cis-element in cardiac myocytes. J. Clin. Invest., 99, 28982905.[Web of Science][Medline]
- Taga,T., Higi,M., Hirata,Y., Yamasaki,K., Yasukawa,K., Matsuda,T., Hirano,T. and Kishimoto,T. (1989) Interleukin-6 triggers the association of its receptor with a possible signal transducer, gp130. Cell, 58, 573581.[CrossRef][Web of Science][Medline]
- Ihle,J.N. and Kerr,I.M. (1995) Jaks and stats in signaling by the cytokine receptor superfamily. Trends Genet., 11, 6974.[CrossRef][Web of Science][Medline]
- Klein,B., Zhang,X.G., Yang,L.Z. and Bataille,R. (1995) Interleukin-6 in human multiple myeloma. Blood, 85, 863874.
[Free Full Text] - Frank,D.A. (1999) STAT signaling in the pathogenesis and treatment of cancer. Mol. Med., 5, 432456.[Web of Science][Medline]
- Levy,Y., Tsapis,A. and Brouet,J.C. (1991) Interleukin-6 antisense oligonucleotides inhibit the growth of human myeloma cell lines. J. Clin. Invest., 88, 696699.[Web of Science][Medline]
- Barut,B., Chauhan,D., Uchiyama,H. and Anderson,K.C. (1993) Interleukin-6 functions as an intracellular growth factor in hairy cell leukemia in vitro. J. Clin. Invest., 92, 23462352.[Web of Science][Medline]
- Seymour,J.F., Talpaz,M., Cabanillas,F., Wetzler,M. and Kurzrock,R. (1995) Serum interleukin-6 levels correlate with prognosis in diffuse large cell lymphoma. J. Clin. Oncol., 13, 575582.
[Abstract/Free Full Text] - Mizutani,Y., Bonavida,B., Koishihara,Y., Akamatsu,K., Ohsugi,Y. and Yoshida,O. (1995) Sensitization of human renal cell carcinoma cells to cis-diamminedichloroplatinum (II) by anti-interleukin 6 monoclonal antibody or anti-interleukin 6 receptor monoclonal antibody. Cancer Res., 55, 590596.
[Abstract/Free Full Text] - Borsellino,N., Belldegrun,A. and Bonavida,B. (1995) Endogenous interleukin 6 is a resistance factor for cis-diamminedichloroplatinum and etoposide-mediated cytotoxicity of human prostate carcinoma cell lines. Cancer Res., 55, 46334639.
[Abstract/Free Full Text] - Lu,C., Vickers,M.F. and Kerbel,R.S. (1992) Interleukin-6: a fibroblast-derived growth inhibitor of human melanoma cells from early but not advanced stages of tumor progression. Proc. Natl Acad. Sci. USA, 89, 92159219.
[Abstract/Free Full Text] - Brown,T.J., Roe,J.M., Liu,J.W. and Shoyab,M. (1991) Regulation of IL-6 expression by oncostatin M. J. Immunol., 147, 21752180.[Abstract]
- Wegenka,U.M., Buschmann,J., Lutticken,C., Heinrich,P.C. and Horn,F. (1993) Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level. Mol. Cell. Biol., 13, 276288.
[Abstract/Free Full Text] - Yuan,J., Wegenka,U.M., Lutticken,C., Buschmann,J., Decker,T., Schindler,C., Heinrich,P.C. and Horn,F. (1994) The signalling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements. Mol. Cell. Biol., 14, 16571668.
[Abstract/Free Full Text] - Chauhan,D., Kharbanda,S., Ogata,A., Urashima,M., Teoh,G., Robertson,M., Kufe,D.W. and Anderson,K.C. (1997) Interleukin-6 inhibits Fas-induced apoptosis and stress-activated protein kinase activation in multiple myeloma cells. Blood, 89, 227234.
[Abstract/Free Full Text] - Scwarze,M.M.K. and Hawly,P.G. (1995) Prevention of myeloma cell apoptosis by ectopic bcl-2 expression or interleukin 6-mediated upregulation of bcl-xl. Cancer Res., 55, 22622266.
[Abstract/Free Full Text] - Peppard,J.V., Loo,P., Sills,M.A., Munster,D., Pomponi,S.A. and Wright,A.E. (1996) Characterization of an interleukin 6 cytokine family antagonist protein from a marine sponge, Callyspongia sp. J. Biol. Chem., 271, 72817284.
[Abstract/Free Full Text] - Savino,R., Ciapponi,L., Lahm,A., Demartis,A., Cabibbo,A., Toniatti,C., Delmastro,P., Altamura,S. and Ciliberto,G. (1994) Rational design of a receptor super-antagonist of human interleukin-6. EMBO J., 13, 58635870.[Web of Science][Medline]
- Savino,R., Lahm,A., Salvati,A.L., Ciapponi,L., Sporeno,E., Altamura,S., Paonessa,G., Toniatti,C. and Ciliberto,G. (1994) Generation of interleukin-6 antagonists by molecular-modeling guided mutagenesis of residues important for gp130 activation. EMBO J., 13, 13571367.[Web of Science][Medline]
- Frank,D.A., Mahajan,S. and Ritz,J. (1999) Fludarabine-induced immunosuppression is associated with inhibition of STAT1 signaling. Nature Med., 5, 444447.[CrossRef][Web of Science][Medline]
- Silvani,A., Ferrari,G., Paonessa,G., Toniatti,C., Parmiani,G. and Colombo,M.P. (1995) Down-regulation of interleukin 6 receptor
chain in interleukin 6 transduced melanoma cells causes selective resistance to interleukin 6 but not to oncostatin M. Cancer Res., 55, 22002205.[Abstract/Free Full Text] - Battle,T.E. and Frank,D.A. (2003) STAT1 mediates differentiation of chronic lymphocytic leukemia cells in response to bryostatin 1. Blood, 102, 30163024.
[Abstract/Free Full Text] - Yin,L., Laevsky,G. and Giardina,C. (2001) Butyrate suppression of colonocyte NF-kappa B activation and cellular proteasome activity. J. Biol. Chem., 276, 4464144646.
[Abstract/Free Full Text] - Ogawa,H., Rafiee,P., Fisher,P.J., Johnson,N.A., Otterson,M.F. and Binion,D.G. (2003) Butyrate modulates gene and protein expression in human intestinal endothelial cells. Biochem. Biophys. Res. Commun., 309, 512519.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





