Carcinogenesis Advance Access originally published online on August 27, 2004
Carcinogenesis 2004 25(12):2417-2424; doi:10.1093/carcin/bgh273
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.25 no.12 © Oxford University Press 2004; all rights reserved.
ARTICLE |
Acetyl-CoA carboxylase
gene and breast cancer susceptibility
1 International Agency for Research on Cancer, 150, cours A. Thomas, 69372 Lyon, France, 2 Plate-forme Mixte de Génétique Constitutionnelle des Cancers Fréquents, Hospices Civils de Lyon/Centre Léon Bérard, 28, rue Laënnec, 69373 Lyon, France, 3 CNRSFRE 2692, Université Claude Bernard, avenue Rockefeller, 69373 Lyon, France, 4 Centre Hospitalier Lyon-Sud, Pierre-Bénite Cedex, France, 5 Centre Antoine-Lacassagne, Nice Cedex 2, France, 6 Centre Léon Bérard, 28, rue Laënnec, 69373 Lyon, France and 7 CNRSUMR 8125, Institut Gustave Roussy, rue C. Desmoulins, 94805 Villejuif, France
8 To whom correspondence should be addressed Email: sinilnikova{at}iarc.fr
| Abstract |
|---|
|
|
|---|
The identification of an interaction between BRCA1 and acetyl-CoA carboxylase
(ACC
), a key enzyme in lipid synthesis, led us to investigate the role of ACC
in breast cancer development, where it might contribute to the energy-sensing mechanisms of malignant transformation. In order to investigate if certain ACC
alleles may be high-risk breast cancer susceptibility alleles, 37 extended breast and breast/ovarian cancer families negative for BRCA1 and BRCA2 mutations were exhaustively screened for sequence variations in the entire coding sequence, intronexon junctions, 5'UTR, 3'UTR (untranslated regions) and the promoter regions of the ACC
gene. Two possibly disease-associated ACC
variants were each identified in a single family and were not present in 137 controls. Multiple polymorphisms were detected in breast cancer families, including 12 single nucleotide polymorphisms where the frequency of the rare allele estimated in controls was >0.10. The observed lack of variation in the ACC
coding region along with the presence of extended areas of linkage disequilibrium and low haplotype diversity indicates an overall high preservation of this gene. The prevalence of the ACC
haplotypes composed of common polymorphisms was determined in 453 breast cancer cases and 469 female controls. One haplotype was found to be associated with a substantial and highly significant increase in breast cancer risk (odds ratio = 3.10, 95% confidence interval 1.875.14, P < 0.0001), whereas three other haplotypes were found to have a protective effect. Our results indicate that mutations in the ACC
gene are unlikely to be a major cause of high-risk breast cancer susceptibility; however, certain common ACC
alleles may influence breast cancer risk. This study provides the first insight into the involvement of the ACC
gene in breast cancer predisposition and calls for further, large-scale studies that will be needed to understand the role of ACC
in tumour susceptibility and development.
Abbreviations: ACC
, acetyl-CoA carboxylase
; CI, confidence interval; DHPLC, denaturing high performance liquid chromatography; FAS, fatty acid synthase; htSNP, haplotype tagging SNP; LD, linkage disequilibrium; nt, not tested; OR, odds ratio; SNP, single nucleotide polymorphism; UTR, untranslated region
| Introduction |
|---|
|
|
|---|
We recently identified acetyl-CoA carboxylase (ACC
) as a novel partner of the protein coded by the breast cancer susceptibility gene BRCA1 (1). BRCA1 was found to interact in vitro and in vivo with ACC
via the tandem of BRCT domains in BRCA1. This interaction was abolished by three missense and two nonsense BRCA1 mutations found in familial breast cancer cases and which affect the BRCT domains of BRCA1 (1). These results suggest that alterations in the BRCA1ACC
interaction might play a role in breast cancer susceptibility.
ACC
is the rate-limiting enzyme for long-chain fatty acid synthesis that catalyses the carboxylation of acetyl-CoA to malonyl-CoA (reviewed in refs 2,3). Long-chain fatty acids are integral components of cellular membranes and energy storage in all organisms. The ACC
gene located on chromosome 17q12 encodes a 265 kDa protein, which is expressed in many cell types but shows elevated expression in the liver, adipose tissue, brain and in the mammary gland during lactation. Transcription of ACC
in mammals has been shown to be initiated from at least three independent promoters with different tissue specificity. The ACC
transcripts arising from these promoters were initially investigated in rodents and ruminants, and more recently in humans (418). Transcripts from the PIII promoter, giving rise to an N-terminal variant of ACC
, appear to be of particular interest since their level is specifically elevated in mammary epithelium during lactation: a 1530-fold increase as compared with a 3-fold increase of other ACC
transcripts (1416).
Numerous studies have reported that ACC
, together with fatty acid synthase (FAS), another key limiting fatty acid synthesis enzyme, is highly expressed in human breast cancer cell lines and breast carcinomas (1924). Molecular cross-talk between the HER2 and FAS signalling pathways has been demonstrated in a recent report of Kumar-Sinha et al. (25). HER2, one of the best-characterized breast cancer oncogenes, is amplified in
30% of breast cancers (26,27), and its over-expression is associated with a poor prognosis (28). A transcriptome analysis of genes induced by HER2 over-expression in breast cell lines and concomitantly repressed by HER2-inhibitors identified FAS as a HER2-inducible gene. Fatty acid metabolism has been implicated in mammary and ovary carcinogenesis through the observation of antitumour effect of cerulenin and C75 FAS inhibitors, i.e. a delay in disease progression in a xenograft model of breast and ovarian cancer and induction of apoptosis of breast carcinoma cells (2935). A role for metabolism of cellular energy resources in breast cancer development has also been suggested from the results of epidemiological studies associating breast cancer risk with high-energy intake and being overweight (36).
Based on these observations, we hypothesized that ACC
may be implicated in mammary gland carcinogenesis and that certain alleles of this gene may confer breast cancer susceptibility. In order to test this hypothesis, we screened for sequence variations in the entire coding sequence, the 5', 3'UTRs and the promoter regions of ACC
in a panel of familial breast and/or ovarian cancer cases found previously to be negative for BRCA1 and BRCA2 mutations. In this screening, in addition to rare sequence alterations, several common single nucleotide polymorphisms (SNPs) were identified and subsequently tested for breast cancer risk association in a case-control study.
| Materials and methods |
|---|
|
|
|---|
Subjects
The kindreds examined in this study were selected from a series of 111 high-risk breast cancer families followed at the Department of Preventive Medicine in Creighton University School of Medicine in Omaha that we have extensively studied for BRCA1 and BRCA2 mutations in our laboratory (3743). The 37 families, in which no deleterious mutation in the BRCA1 or BRCA2 genes has been detected, were selected for analysis of the ACC
gene. The ACC
mutation screening was performed on 49 women affected with breast or ovarian cancer from these families. Seventeen families contained both breast and ovarian cancer cases, with a mean number of breast cancer patients per pedigree of 3.6, and a mean number of ovarian cancers of 1.8. Twenty pedigrees had only breast cancers, with a mean number of cases per pedigree of 5.6.
Breast cancer cases for the association study on common ACC
polymorphisms were drawn from a population-based and a hospital-based series. 232 women diagnosed with breast cancer below the age of 46 years (mean age at breast cancer diagnosis 40.3 years, range 2546) in the Rhône region, France, through the years 19951997 provided a blood sample for DNA analysis. The hospital-based series of breast cancer cases was recruited over the period 19962002 from among women treated in the Radiotherapy Department at Lyon-Sud Hospital (Pierre-Bénite, Rhône, France), located in the same region as the area from which the set of early-onset breast cancer cases was collected (44). 221 (mean age at breast cancer diagnosis 56.3 years, range, 3581) available breast cancer cases were included in the present study. The mean age at breast cancer diagnosis of the 453 breast cancer patients was 47.5 years, range 2581. A total of 469 blood samples were available from female controls randomly selected from among blood donors from the same geographical region (mean age at sample collection 50.1 years, range 1865). 137 of these were used for the initial estimation of the frequency of the ACC
sequence variants identified. The study protocols were approved by the institutional review boards.
Gene sequence variation screening
Genomic DNA was extracted using Qiagen QIAamp kit from blood samples or lymphoblastoid cell lines established previously at IARC from purified lymphocytes of several patients included in the present study. Cells were maintained in RPMI 1640 medium (Sigma) supplemented with 10% fetal calf serum and 1% penicillin-streptomycin (Sigma) in a 5% CO2 incubator at 37°C. The entire coding sequence, intronexon junctions as well as the 5', 3'UTRs (untranslated regions) and the promoter regions of the ACC
gene (a total of 74 PCR amplicons) were screened with heteroduplex or denaturing high performance liquid chromatography (DHPLC) (Transgenomic) techniques in 49 familial breast or ovarian cancer cases. The PCR primers were selected with the Primer3 oligo design software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) (45). The sequences of PCR primers used for amplification of each exon and promoter regions are available on request.
For heteroduplex analysis, 33P-dATP-labelled PCR products were denatured for 3 min at 95°C and then gradually re-annealed by decreasing the temperature to 65°C over a period of 30 min to induce heteroduplex formation. DNA was electrophoresed through 1x MDETM gel (FMC Bioproducts), at 300600 V for 14 h using a vertical gel electrophoresis apparatus. Gels were dried and exposed to Kodak BioMax MR film. DHPLC was carried out on automated instrumentation WAVETM DNA fragment analysis system (Transgenomic). Three to ten microliters of PCR product, containing
50 ng of amplified DNA, was denatured for 3 min at 95°C and then gradually re-annealed by decreasing the temperature to 65°C over a period of 30 min. PCR products were then eluted with a linear acetonitrile gradient adjusted according to the size of the PCR fragment, at a flow rate of 0.9 ml/min and at a denaturing temperature found out with the help of DHPLC melting algorithm available at http://insertion.stanford.edu/cgi-bin/melt.html. PCR fragments showing anomalous migration were sequenced using BigDye Terminator sequencing kit on the ABI3100 DNA sequencer (Applied Biosystems).
Genotyping of ACC
polymorphisms
The frequency of the ACC
sequence variants detected in the breast cancer families was examined in 137 control DNAs using a heteroduplex technique. For the association study the ACC
haplotype tagging SNPs (htSNP) (5'UTR-86T>C, PIII-724T>G, IVS8-16T>C and IVS17 + 66T>C) were genotyped in 453 breast cancer cases and 469 controls by the TaqManTM allelic discrimination technique. The primers and the TaqManTM probes for the typing of IVS8-16T>C were selected with the Primer Express and Oligo Design Software version 2.0.0 (Applied Biosystems). The remaining htSNPs assays were designed by the Applied Biosystems Assays-by-Design service. For IVS8-16T>C TaqManTM PCR (5 µl in 96-well plates) was performed using 0.1 µl of a 1/10 dilution of a primary PCR (35 cycles at 94°C for 30 s, 60°C for 30 s and 72°C for 30 s using 10 ng of genomic DNA, forward 5'-TGTACCTCAAGAAACAGGGC and reverse 5'-GAGCCCAGCACATGTTAAAC primers), 1x TaqManTM universal PCR master mix, forward (5'-CCTGGATAGAGACTCTTGCAGTTTG) and reverse (5'-CCCAGCCAGCCCACACT) primers (900 nM), 5'FAM/3'Tamra labelled probe (ATGAATTATACTGTATTCCCT for IVS8-16T) and 5'TET/3'Tamra labelled probe (TGAATTATATTGTATTCCC for IVS8-16C) (200 nM, MWG Biotech AG). For the other SNPs TaqManTM PCRs (5 µl in 384-well plates) were performed using 10 ng of genomic DNA, 1x TaqManTM universal PCR master mix, forward (5'-GGGTGAAGAGGGTGCGTTT for 5'UTR-86T>C, 5'-CAGCATTTTGATGGGAATAAATTTTTTATGGTT for PIII-724T>G and 5'-ACAGATGCTGGGATTGGGTTTT for IVS17 + 66T>C) and reverse (5'-GGCCTCTGAAGCCCAAAGA for 5'UTR-86T>C, 5'-AGAAAGACAACTTCCTGAGGCAAG for PIII-724T>G and 5'-TTTTTCCAGGTAGATCAAGAACCATTTACA for IVS17 + 66T>C) primers (900 nM), 5'FAM/3'MGB labelled probe (5'-ATCAGATGCTCCTGGAAC for 5'UTR-86T, 5'-TCCTCAGGACTGTACAC for PIII-724T and 5'-ATGTAGTGGCAGGGAT for IVS17 + 66T) and 5'VIC/3'MGB labelled probe (5'-CAATCAGATGCTTCTGGAAC for 5'UTR-86C, 5'-CCTCAGGCCTGTACAC for PIII-724G and 5'-TTCATGTAGTGACAGGGAT for IVS17 + 66C) (200 nM, Applied Biosystems). Amplification conditions were 95°C for 10 min followed by 40 cycles of 92°C for 15 s and 60°C for 1 min for 5'UTR-86T>C and IVS17 + 66T>C; by 40 cycles of 92°C for 15 s and 64°C for 1 min for PIII-724T>G; by 35 cycles of 92°C for 15 s and 59°C for 1 min for IVS8-16T>G. Genotypes were assigned using the Allelic Discrimination Sequence Detection Software of the ABI PRISM 7900HT Sequence Detector (Applied Biosystems). After the first plate was analysed, the corresponding amplicons of nine individuals carrying the three possible genotypes for each variant were sequenced (ABI 3100 Applied Biosytems), to confirm the genotyping calls and provide controls for each possible genotype. The genotype controls and two no template controls were then included in each subsequent plate.
ACC
transcript analysis
Total RNA was isolated using Rneasy kit (Qiagen) from 10 lymphoblastoid cell lines carrying ACC
intronic variants identified in breast cancer familial cases to test for possible consequences on the ACC
mRNA splicing (Table I). Total RNA (1.5 µg) was reverse-transcribed with Superscript Reverse Transcriptase (Invitrogen) using random hexanucleotide primer in a 20 µl reaction volume for complementary DNA (cDNA) synthesis. PCR was performed on 1 µl of cDNA in a 15 µl reaction volume containing specific primers (10 pmol each) (Invitrogen) (the sequences of PCR primers are available on request), dNTPs (4 nmol) (Promega), 1x PCR buffer (Invitrogen), 1.5 mM MgCl2 (Invitrogen) and 0.15 U Platinium Taq DNA polymerase (Invitrogen). Amplification conditions were: 3 min at 94°C, followed by 35 cycles: 30 s at 94°C, 30 s at 60°C and 30 s at 72°C. The resulting PCR products were analysed following migration on a 1.2% agarose gel.
|
|
Statistical methods
The genotype-specific risks were estimated as odds ratios (ORs) by unconditional logistic regression. Linkage disequilibrium was measured in a pair-wise fashion across the 12 common SNPs (allelic frequency >0.10) providing D' coefficient estimations and their linkage disequilibrium (LD) pattern is presented in Figure 1B (46). The SNPs tagging the haplotypes composed of all 12 polymorphisms were selected using the tagsnps software of Stram et al. (47). The frequencies of the haplotypes formed by these four htSNPs were estimated from the unphased genotype data, and probabilities were estimated for the assignment of haplotypes to individuals (47). The association between haplotypes and breast cancer risk was simultaneously modelled using a single unconditional logistic regression, thus avoiding multiple testing, to obtain ORs and 95% confidence intervals (CI), taking the estimated haplotype probabilities as the independent variables. The most common haplotype was defined as the referent, and the ORs are for a single copy of the haplotype, assuming that the relative risk of carrying two haplotypes is the square of that of carrying one (Stata software, Version 6.0). The genotype- and haplotype-specific risk estimations were adjusted for age.
| Results |
|---|
|
|
|---|
ACC
mutation screening in breast/ovarian cancer familiesForty-nine patients belonging to 37 independent high-risk breast cancer families were screened for sequence variants in the ACC
gene. The entire coding sequence (exons 1, 4, 5, 5A, 5B, 658), 5'UTR (exons 1, 1C, 2, 4, 5, 5A), 3'UTR (exon 58) and promoter regions (promoters PI, PIA, PII and PIII) corresponding to different ACC
isoforms (Figure 1) were examined by heteroduplex and DHPLC techniques. This analysis identified 16 rare changes each observed once or twice in our sample set and several common polymorphisms (Table I). Only one of these variants resulted in an amino acid substitution (Ala2271Val). The other variants were all located in the intronic sequences flanking exons, in the 5'UTR, the 3'UTR or the promoter sequences. The Ala2271Val substitution was found in a woman diagnosed with ovarian cancer at the age of 45 years who had a sister affected with ovarian cancer at the age of 38 years, her mother and grandmother were affected with breast cancer and her brother with prostate cancer. Unfortunately, the segregation of disease with the Val2271 allele could not be tested, as no samples from affected family members other than the index case were available. The Ala2271Val substitution is situated outside any of the known functional domains of ACC
. The Val2271 allele was not detected among 274 control chromosomes. The analogous residue in the ACC
protein in rodents and ruminants is valine. As no data on the primate ACC
sequences were available in GenBank we sequenced the corresponding region of the ACC
gene in gorilla and chimpanzee DNA and found that, as in humans, an alanine residue is present at this position.
For nine out of the 10 carriers of rare intronic variants, for which lymphoblastoid cell lines were available, possible alterations in ACC
mRNA exon splicing were examined. No altered transcripts were detected.
The frequencies of the remaining variants, detected once or twice in our breast cancer family set, located in the PIII-promoter (PIII-120A>G), intron 6 (IVS6 + 86T>C) and the 3'UTR (7041 + 267G>A, 7041 + 713G>A, 7041 + 940del4 and 7041 + 1335ins5), were examined in 137 control DNAs. The PIII-120A>G was not detected in any of the control samples, whereas the other variants were each found in two to six samples, suggesting that they may represent polymorphisms.
The PIII-120A>G variant was detected in a breast cancer patient diagnosed at age 41. The genotyping of the available DNAs from the members of this family showed that the PIII-variant was also carried by the affected mother (breast cancer diagnosed at age 54) of the patient but not by two other breast cancer patients (a niece and a cousin of the patient).
ACC
common polymorphisms and breast cancer associated risk
Twelve of the 24 ACC
sequence variants detected in the breast cancer families and tested in controls had a frequency greater than 0.10 in a set of 137 control samples (Table I). All of these polymorphisms were non-coding. Linkage disequilibrium was measured in a pair-wise fashion across the 12 common SNPs. Their LD pattern indicates that the region covered by these SNPs corresponds to a block of strong linkage disequilibrium, although several SNP pairs show evidence of recombination (Figure 1). This LD structure reflects a low recombination rate over the ACC
genomic sequence of 330 kb of length.
To investigate whether common ACC
variants are associated with the risk of breast cancer, we carried out a case-control study including 453 breast cancer patients and 469 female controls. We studied the frequencies of genotypes of the four ACC
htSNPs (5'UTR-86T>C, PIII-724T>G, IVS8-16T>C and IVS17 + 66T>C) selected using the software of Stram et al. (47). These polymorphisms showed no significant difference between cases and controls, except IVS17 + 66 CC homozygotes having a marginal protective effect (OR = 0.31, 95% CI 0.111.85, P = 0.022) (Table II).
|
We also estimated in cases and controls the frequencies of the ACC
haplotypes composed of the four htSNPs. The five haplotypes with a frequency higher than 0.05 were found to represent nearly 90% of chromosomes in the study population (Table III). This observation is in line with the ACC
low recombination rate suggested by the LD analysis. Three haplotypes were found to have a protective effect, whereas the 5'UTR-86T/PIII-724G/IVS8-16T/IVS17 + 66T haplotype, including the PIII-724G variant in promoter PIII, was identified as associated with a substantial and highly significant increase in breast cancer risk (OR = 3.10, 95% CI 1.875.14, P < 0.0001) (Table III). These results show the absence of a significant association with breast cancer risk in the majority of the ACC
htSNPs genotypes analysed individually, but the presence of such an association when performing haplotype analysis, suggests an influence of the haplotype context on the effect of certain ACC
SNPs on cancer risk, or the presence on the risk-modifying haplotypes of causal variants yet to be identified.
|
| Discussion |
|---|
|
|
|---|
The identification of an interaction between BRCA1 and ACC
(1), a key player in the regulation of fatty acid synthesis, led us to investigate the potential role of ACC
as a risk factor for breast cancer development. In order to examine this possibility, we carried out mutation screening of the coding and regulatory regions of ACC
, particularly focusing on the PIII-controlled mammary gland lactation-induced ACC
isoform, in a set of breast and breast/ovarian cancer families negative for BRCA1 and BRCA2 mutations. One of the 37 families analysed carried a rare variant PIII-120A>G affecting the ACC
PIII-promoter. PIII-120A is conserved between humans and ruminants, both species having a functional PIII-promoter, whereas in rodents, in which this promoter seems to be non-functional, the sequence is different at this position (17). The PIII-120A>G substitution is located in a minimal PIII-promoter corresponding to the region associated with a hypersensitivity to DNase I treatment indicative of chromatin domains easily accessible to transcription factors (16). Although there is no direct evidence of regulation of the human PIII-promoter by sterols via sterol regulatory element binding proteins (SREBPs), it is tempting to speculate that the PIII-120A>G substitution might affect the SREBP-dependant PIII-regulation since PIII-120A is closely surrounded by one potential Sp1-binding site (5'-GGGAGG-3') and three, direct or inverted, repeat elements (5'-PyCAPy-3') described as SREBP-binding half sites (50). The finding of this putative mutation in a high-risk breast cancer family, although showing partial co-segregation with breast cancer, raises the question of whether the ACC
isoform expressed from the PIII-promoter is involved in breast cancer susceptibility, and emphasizes the importance of establishing its precise role in mammary epithelium and its mode of tissue-specific regulation and corresponding responsive elements.
While searching for mutations in the coding region of ACC
, we observed a complete lack of variation in the coding sequence; in fact, no polymorphisms resulting in an amino acid substitution were detected in the 49 samples analysed by highly sensitive techniques. We thus suspect that the one missense change (Ala2271Val) that we identified among the familial breast/ovarian cancer cases might be a disease-associated mutation. However, while residue 2271 is alanine in humans and great apes, it is valine in ruminants and rodents. If one were to argue that disease mutations predominantly occur at the amino acid positions most conserved throughout evolution (51), then the Ala2271Val substitution would not be estimated to have a high potential to be associated with disease. On the other hand, the analysis of multiple genes by Miller and Kumar (51) showed that alanine to valine substitutions were observed as frequently in interspecies comparisons as in disease patients. It will thus be critical to assess the functional significance of the Ala2271Val substitution, which might affect ACC
enzymatic activity, its tissue-specificity or interaction with BRCA1. In view of the observed lack of variation in the human ACC
coding sequence, it would be likely that only relatively conservative substitutions could be tolerated, whereas more severe mutations might be lethal. The high degree of conservation of the ACC
coding region along with a low recombination rate across its genomic sequence, reflected by the presence of extended areas of linkage disequilibrium and by the fact that five common haplotypes represent almost 90% of all chromosomes, indicates an overall high preservation of this gene. This lack of variability may be related to the need to maintain a certain level of functional complexity and specificity achieved through rigorous selection of an enzyme playing a critical role in nearly every living organism.
The identification of common ACC
polymorphisms and the selection of the SNPs tagging the haplotypes composed of these polymorphisms allowed us to perform an association study to investigate if some common ACC
alleles influence the risk of breast cancer. Our study of breast cancer cases compared with controls suggested that several common ACC
haplotypes were associated with altered breast cancer risk. Breast cancer risk conferred by these haplotypes might be due to the combined effect of the ACC
polymorphisms composing these haplotypes, or the presence of a causal, but not yet identified, variant that is in linkage disequilibrium with a risk-associated haplotype. In the list of the exhaustively searched ACC
sequence variants, not a single polymorphism was found to affect the ACC
coding region. Some of the intronic polymorphisms, for which lymphoblastoid cell lines were available, were tested for potential effects on the ACC
transcript splicing, but no alterations were detected. The common sequence variants identified in the ACC
regulatory regions, 5'UTR and PIII-promoter, present on the haplotypes associated with modified breast cancer risk might be expected to influence the ACC
transcription level (Figure 1, Table III). In this respect, it is interesting to note that the PIII-724T>G polymorphism is situated in one of two DNase I hypersensitive sites identified in the ACC
PIII-promoter (16).
A number of previous studies have demonstrated high levels of FAS expression in a wide variety of human malignancies and their precursor lesions, including carcinoma of the colon, prostate, ovary, endometrium and breast (20,21,5256). An elevated expression of FAS in human tumours and its association with aggressive disease in breast, ovarian and prostate cancer suggests that fatty acid synthesis provides an advantage for tumour growth (57). In addition, the high-energy western diet and a low rate of energy expenditure lifestyle have been implicated in the development of these human malignancies (36). The spectrum of these cancers strongly resembles that of the BRCA1 mutation-associated tumours (58,59). Based on these results it is possible to envisage a role of BRCA1 in energy metabolism regulation through its interaction with ACC
. It is also tempting to suggest that the PIII-promoter-controlled ACC
expression specifically elevated in mammary epithelium during lactation might provide an explanation to the as yet unresolved tissue-specificity of the BRCA1-associated cancer susceptibility.
Our results indicate that mutations in the ACC
gene might underlie a small proportion of breast cancer families but are unlikely to be a major cause of high-risk breast cancer susceptibility. However, certain common ACC
alleles, particularly those carrying variants in regulatory regions that might influence the ACC
transcription level, may have an effect on breast cancer risk. This study provides the first insight into the involvement of the ACC
gene in breast cancer predisposition and calls for further studies to understand the role of ACC
and other cellular fatty acid metabolism factors/genes in tumour susceptibility and development.
| Acknowledgments |
|---|
We thank Henry T.Lynch for a long-term collaboration on the study of breast cancer families; Colette Bonnardel, Valérie Gaborieau, Nicole Martel, Fabrice Odefrey and Sandrine Burlinchon for their expert assistance; John Witte for suggestions with regards to the haplotype estimations; Sean V.Tavtigian for a critical reading of the manuscript. This work was supported by grants from the Fondation Carrefour, France, and the Association pour la Recherche sur le Cancer, France (Grant No. 4777). S.M.G. was the recipient of the fellowship from the Association pour la Recherche sur le Cancer, France and then the recipient of the fellowship from the Fondation de France. C.M. was the recipient of the fellowship from the Ligue Nationale Contre le Cancer, Comité Départemental de la Haute-Savoie, France. D.H. is funded by the US Department of Defense Breast Cancer Research Program (DAMD17-02-1-0421). This work was carried out during the tenure of Special Training Awards from the International Agency for Research on Cancer (M.L., O.A., D.T. and C.C.).
| References |
|---|
|
|
|---|
- Magnard,C., Bachelier,R., Vincent,A., Jaquinod,M., Kieffer,S., Lenoir,G.M. and Venezia,N.D. (2002) BRCA1 interacts with acetyl-CoA carboxylase through its tandem of BRCT domains. Oncogene, 21, 67296739.[CrossRef][Web of Science][Medline]
- Brownsey,R.W., Zhande,R. and Boone,A.N. (1997) Isoforms of acetyl-CoA carboxylase: structures, regulatory properties and metabolic functions. Biochem. Soc. Trans., 25, 12321238.[Web of Science][Medline]
- Kim,K.H. (1997) Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr., 17, 7799.[CrossRef][Web of Science][Medline]
- Luo,X.C., Park,K., Lopez-Casillas,F. and Kim,K.H. (1989) Structural features of the acetyl-CoA carboxylase gene: mechanisms for the generation of mRNAs with 5' end heterogeneity. Proc. Natl Acad. Sci. USA, 86, 40424046.
[Abstract/Free Full Text] - Luo,X.C. and Kim,K.H. (1990) An enhancer element in the house-keeping promoter for acetyl-CoA carboxylase gene. Nucleic Acids Res., 18, 32493254.
[Abstract/Free Full Text] - Lopez-Casillas,F., Ponce-Castaneda,M.V. and Kim,K.H. (1991) In vivo regulation of the activity of the two promoters of the rat acetyl coenzyme-A carboxylase gene. Endocrinology, 129, 10491058.
[Abstract/Free Full Text] - Abu-Elheiga,L., Jayakumar,A., Baldini,A., Chirala,S.S. and Wakil,S.J. (1995) Human acetyl-CoA carboxylase: characterization, molecular cloning, and evidence for two isoforms. Proc. Natl Acad. Sci. USA, 92, 40114015.
[Abstract/Free Full Text] - Ha,J., Daniel,S., Kong,I.S., Park,K., Tae,H.J. and Kim,K.H. (1994) Cloning of human acetyl-CoA carboxylase cDNA. Eur. J. Biochem., 219, 297306.[Web of Science][Medline]
- Tae,H.J., Luo,X. and Kim,K.H. (1994) Roles of CCAAT/enhancer-binding protein and its binding site on repression and derepression of acetyl-CoA carboxylase gene. J. Biol. Chem., 269, 1047510484.
[Abstract/Free Full Text] - Daniel,S. and Kim,K.H. (1996) Sp1 mediates glucose activation of the acetyl-CoA carboxylase promoter. J. Biol. Chem., 271, 13851392.
[Abstract/Free Full Text] - Travers,M.T., Vallance,A.J., Gourlay,H.T., Gill,C.A., Klein,I., Bottema,C.B. and Barber,M.C. (2001) Promoter I of the ovine acetyl-CoA carboxylase-alpha gene: an E-box motif at 114 in the proximal promoter binds upstream stimulatory factor (USF)-1 and USF-2 and acts as an insulin-response sequence in differentiating adipocytes. Biochem. J., 359, 273284.[CrossRef][Web of Science][Medline]
- Mao,J., Marcos,S., Davis,S.K., Burzlaff,J. and Seyfert,H.M. (2001) Genomic distribution of three promoters of the bovine gene encoding acetyl-CoA carboxylase alpha and evidence that the nutritionally regulated promoter I contains a repressive element different from that in rat. Biochem. J., 358, 127135.[CrossRef][Web of Science][Medline]
- Yin,L., Zhang,Y. and Hillgartner,F.B. (2002) Sterol regulatory element-binding protein-1 interacts with the nuclear thyroid hormone receptor to enhance acetyl-CoA carboxylase-alpha transcription in hepatocytes. J. Biol. Chem., 277, 1955419565.
[Abstract/Free Full Text] - Barber,M.C. and Travers,M.T. (1998) Elucidation of a promoter activity that directs the expression of acetyl-CoA carboxylase alpha with an alternative N-terminus in a tissue-restricted fashion. Biochem. J., 333, 1725.
- Mao,J., Molenaar,A.J., Wheeler,T.T. and Seyfert,H.M. (2002) STAT5 binding contributes to lactational stimulation of promoter III expressing the bovine acetyl-CoA carboxylase alpha-encoding gene in the mammary gland. J. Mol. Endocrinol., 29, 7388.[Abstract]
- Barber,M.C., Vallance,A.J., Kennedy,H.T. and Travers,M.T. (2003) Induction of transcripts derived from promoter III of the acetyl-CoA carboxylase-alpha gene in mammary gland is associated with recruitment of SREBP-1 to a region of the proximal promoter defined by a DNase I hypersensitive site. Biochem. J., 375, 489501.[CrossRef][Web of Science][Medline]
- Travers,M.T., Vallance,A.J., Clegg,R.A., Thomson,R., Price,N.T. and Barber,M.C. (2003) Characterisation of an N-terminal variant of acetyl-CoA carboxylase-alpha: expression in human tissues and evolutionary aspects. Biochim. Biophys. Acta, 1634, 97106.[Medline]
- Mao,J., Chirala,S.S. and Wakil,S.J. (2003) Human acetyl-CoA carboxylase 1 gene: presence of three promoters and heterogeneity at the 5'-untranslated mRNA region. Proc. Natl Acad. Sci. USA, 100, 75157520.
[Abstract/Free Full Text] - Witters,L.A., Widmer,J., King,A.N., Fassihi,K. and Kuhajda,F. (1994) Identification of human acetyl-CoA carboxylase isozymes in tissue and in breast cancer cells. Int. J. Biochem., 26, 589594.[CrossRef][Web of Science][Medline]
- Milgraum,L.Z., Witters,L.A., Pasternack,G.R. and Kuhajda,F.P. (1997) Enzymes of the fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clin. Cancer Res., 3, 21152120.[Abstract]
- Alo,P.L., Visca,P., Trombetta,G., Mangoni,A., Lenti,L., Monaco,S., Botti,C., Serpieri,D.E. and Di Tondo,U. (1999) Fatty acid synthase (FAS) predictive strength in poorly differentiated early breast carcinomas. Tumori, 85, 3540.[CrossRef][Web of Science][Medline]
- Nakamura,I., Kimijima,I., Zhang,G.J., Onogi,H., Endo,Y., Suzuki,S., Tuchiya,A., Takenoshita,S., Kusakabe,T. and Suzuki,T. (1999) Fatty acid synthase expression in Japanese breast carcinoma patients. Int. J. Mol. Med., 4, 381387.[Web of Science][Medline]
- Wang,Y., Kuhajda,F.P., Li,J.N., Pizer,E.S., Han,W.F., Sokoll,L.J. and Chan,D.W. (2001) Fatty acid synthase (FAS) expression in human breast cancer cell culture supernatants and in breast cancer patients. Cancer Lett., 167, 99104.[CrossRef][Web of Science][Medline]
- Alo,P.L., Visca,P., Botti,C., Galati,G.M., Sebastiani,V., Andreano,T., Di Tondo,U. and Pizer,E.S. (2001) Immunohistochemical expression of human erythrocyte glucose transporter and fatty acid synthase in infiltrating breast carcinomas and adjacent typical/atypical hyperplastic or normal breast tissue. Am. J. Clin. Pathol., 116, 129134.[CrossRef][Web of Science][Medline]
- Kumar-Sinha,C., Ignatoski,K.W., Lippman,M.E., Ethier,S.P. and Chinnaiyan,A.M. (2003) Transcriptome analysis of HER2 reveals a molecular connection to fatty acid synthesis. Cancer Res., 63, 132139.
[Abstract/Free Full Text] - Slamon,D.J., Godolphin,W., Jones,L.A., Holt,J.A., Wong,S.G., Keith,D.E., Levin,W.J., Stuart,S.G., Udove,J. and Ullrich,A. (1989) Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science, 244, 707712.
[Abstract/Free Full Text] - Isola,J., Chu,L., DeVries,S., Matsumura,K., Chew,K., Ljung,B.M. and Waldman,F.M. (1999) Genetic alterations in ERBB2-amplified breast carcinomas. Clin. Cancer Res., 5, 41404145.
[Abstract/Free Full Text] - Albanell,J., Bellmunt,J., Molina,R. et al. (1996) Node-negative breast cancers with p53()/HER2-neu() status may identify women with very good prognosis. Anticancer Res., 16, 10271032.[Web of Science][Medline]
- Kuhajda,F.P., Jenner,K., Wood,F.D., Hennigar,R.A., Jacobs,L.B., Dick,J.D. and Pasternack,G.R. (1994) Fatty acid synthesis: a potential selective target for antineoplastic therapy. Proc. Natl Acad. Sci. USA, 91, 63796383.
[Abstract/Free Full Text] - Pizer,E.S., Wood,F.D., Heine,H.S., Romantsev,E., Pasternack,G.R. and Kuhajda,F.P. (1996) Inhibition of fatty acid synthesis delays disease progression in a xenograft model of ovarian cancer. Cancer Res., 56, 11891193.
[Abstract/Free Full Text] - Pizer,E.S., Chrest,F.J., DiGiuseppe,J.A. and Han,W.F. (1998) Pharmacological inhibitors of mammalian fatty acid synthase suppress DNA replication and induce apoptosis in tumor cell lines. Cancer Res., 58, 46114615.
[Abstract/Free Full Text] - Pizer,E.S., Thupari,J., Han,W.F., Pinn,M.L., Chrest,F.J., Frehywot,G.L., Townsend,C.A. and Kuhajda,F.P. (2000) Malonyl-coenzyme-A is a potential mediator of cytotoxicity induced by fatty-acid synthase inhibition in human breast cancer cells and xenografts. Cancer Res., 60, 213218.
[Abstract/Free Full Text] - Kuhajda,F.P., Pizer,E.S., Li,J.N., Mani,N.S., Frehywot,G.L. and Townsend,C.A. (2000) Synthesis and antitumor activity of an inhibitor of fatty acid synthase. Proc. Natl Acad. Sci. USA, 97, 34503454.
[Abstract/Free Full Text] - Thupari,J.N., Pinn,M.L. and Kuhajda,F.P. (2001) Fatty acid synthase inhibition in human breast cancer cells leads to malonyl-CoA-induced inhibition of fatty acid oxidation and cytotoxicity. Biochem. Biophys. Res. Commun., 285, 217223.[CrossRef][Web of Science][Medline]
- Zhou,W., Simpson,P.J., McFadden,J.M., Townsend,C.A., Medghalchi,S.M., Vadlamudi,A., Pinn,M.L., Ronnett,G.V. and Kuhajda,F.P. (2003) Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells. Cancer Res., 63, 73307337.
[Abstract/Free Full Text] - Bianchini,F., Kaaks,R. and Vainio,H. (2002) Overweight, obesity, and cancer risk. Lancet Oncol., 3, 565574.[CrossRef][Web of Science][Medline]
- Serova,O., Montagna,M., Torchard,D., Narod,S.A., Tonin,P., Sylla,B., Lynch,H.T., Feunteun,J. and Lenoir,G.M. (1996) A high incidence of BRCA1 mutations in 20 breast-ovarian cancer families. Am. J. Hum. Genet., 58, 4251.[Web of Science][Medline]
- Serova,O.M., Mazoyer,S., Puget,N., Dubois,V., Tonin,P., Shugart,Y.Y., Goldgar,D., Narod,S.A., Lynch,H.T. and Lenoir,G.M. (1997) Mutations in BRCA1 and BRCA2 in breast cancer families: are there more breast cancer-susceptibility genes? Am. J. Hum. Genet., 60, 486495.[Web of Science][Medline]
- Puget,N., Torchard,D., Serova-Sinilnikova,O.M., Lynch,H.T., Feunteun,J., Lenoir,G.M. and Mazoyer,S. (1997) A 1-kb Alu-mediated germ-line deletion removing BRCA1 exon 17. Cancer Res., 57, 828831.
[Abstract/Free Full Text] - Mazoyer,S., Puget,N., Perrin-Vidoz,L., Lynch,H.T., Serova-Sinilnikova,O.M. and Lenoir,G.M. (1998) A BRCA1 nonsense mutation causes exon skipping. Am. J. Hum. Genet., 62, 713715.[CrossRef][Web of Science][Medline]
- Puget,N., Stoppa-Lyonnet,D., Sinilnikova,O.M., Pages,S., Lynch,H.T., Lenoir,G.M. and Mazoyer,S. (1999) Screening for germ-line rearrangements and regulatory mutations in BRCA1 led to the identification of four new deletions. Cancer Res., 59, 455461.
[Abstract/Free Full Text] - Puget,N., Sinilnikova,O.M., Stoppa-Lyonnet,D., Audoynaud,C., Pages,S., Lynch,H.T., Goldgar,D., Lenoir,G.M. and Mazoyer,S. (1999) An Alu-mediated 6-kb duplication in the BRCA1 gene: a new founder mutation? Am. J. Hum. Genet., 64, 300302.[CrossRef][Web of Science][Medline]
- Puget,N., Gad,S., Perrin-Vidoz,L., Sinilnikova,O.M., Stoppa-Lyonnet,D., Lenoir,G.M. and Mazoyer,S. (2002) Distinct BRCA1 rearrangements involving the BRCA1 pseudogene suggest the existence of a recombination hot spot. Am. J. Hum. Genet., 70, 858865.[CrossRef][Web of Science][Medline]
- Angele,S., Romestaing,P., Moullan,N. et al. (2003) ATM haplotypes and cellular response to DNA damage: association with breast cancer risk and clinical radiosensitivity. Cancer Res., 63, 87178725.
[Abstract/Free Full Text] - Rozen,S. and Skaletsky,H.J. (2000) Primer3 on the WWW for general users and for biologist programmers. In Krawetz,S., Misener,S., Totowa,N.J. (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365386.
- Abecasis,G.R. and Cookson,W.O.C. (2000) GOLDGraphical overview of linkage disequilibrium. Bioinformatics, 16, 182183.
[Abstract/Free Full Text] - Stram,D.O., Haiman,C.A., Kolonel,L.N., Henderson,B.E. and Pike,M.C. (2003) Choosing haplotype-tagging snps based on unphased genotype data using a preliminary sample of unrelated subjects with an example from the multiethnic cohort study. Hum. Hered., 55, 2736.[CrossRef][Web of Science][Medline]
- Antonarakis,S.E. (1998) Recommendations for a nomenclature system for human gene mutations. Hum. Mutat., 11, 13.[CrossRef][Web of Science][Medline]
- den Dunnen,J.T. and Antonarakis,S.E. (2000) Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum. Mutat., 15, 712.[CrossRef][Web of Science][Medline]
- Magaria,M.M., Lin,S.S., Dooley,K.A. and Osborne,T.F. (1997) Sterol regulation of acetyl coenzyme A carboxylase promoter requires two interdependent binding sites for sterol regulatory element binding proteins. J. Lipid. Res., 38, 16301638.[Abstract]
- Miller,M.P. and Kumar,S. (2001) Understanding human disease mutations through the use of interspecific genetic variation. Hum. Mol. Genet., 10, 23192328.
[Abstract/Free Full Text] - Shurbaji,M.S., Kalbfleisch,J.H. and Thurmond,T.S. (1996) Immunohistochemical detection of a fatty acid synthase (OA-519) as a predictor of progression of prostate cancer. Hum. Pathol., 27, 91721.[CrossRef][Web of Science][Medline]
- Rashid,A., Pizer,E.S., Moga,M., Milgraum,L.Z., Zahurak,M., Pasternack,G.R., Kuhajda,F.P. and Hamilton,S.R. (1997) Elevated expression of fatty acid synthase and fatty acid synthetic activity in colorectal neoplasia. Am. J. Pathol., 150, 201208.[Abstract]
- Pizer,E.S., Lax,S.F., Kuhajda,F.P., Pasternack,G.R. and Kurman,R.J. (1998) Fatty acid synthase expression in endometrial carcinoma: correlation with cell proliferation and hormone receptors. Cancer, 83, 528537.[CrossRef][Web of Science][Medline]
- Swinnen,J.V., Vanderhoydonc,F., Elgamal,A.A. et al. (2000) Selective activation of the fatty acid synthesis pathway in human prostate cancer. Int. J. Cancer, 88, 176179.[CrossRef][Web of Science][Medline]
- Swinnen,J.V., Roskams,T., Joniau,S., Van Poppel,H., Oyen,R., Baert,L., Heyns,W. and Verhoeven,G. (2002) Overexpression of fatty acid synthase is an early and common event in the development of prostate cancer. Int. J. Cancer, 98, 1922.[CrossRef][Web of Science][Medline]
- Kuhajda,F.P. (2000) Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition, 16, 202208.[CrossRef][Web of Science][Medline]
- Ford,D., Easton,D.F., Bishop,D.T., Narod,S.A. and Goldgar,D.E. (1994) Risks of cancer in BRCA1-mutation carriers Breast Cancer Linkage Consortium. Lancet, 343, 692695.[CrossRef][Web of Science][Medline]
- Thompson,D., Easton,D.F. and Breast Cancer Linkage Consortium. (2002) Cancer Incidence in BRCA1 mutation carriers. J. Natl Cancer Inst., 94, 13581365.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
O. M. Sinilnikova, J. D. McKay, S. V. Tavtigian, F. Canzian, D. DeSilva, C. Biessy, S. Monnier, L. Dossus, C. Boillot, L. Gioia, et al. Haplotype-Based Analysis of Common Variation in the Acetyl-CoA Carboxylase {alpha} Gene and Breast Cancer Risk: A Case-Control Study Nested within the European Prospective Investigation into Cancer and Nutrition Cancer Epidemiol. Biomarkers Prev., March 1, 2007; 16(3): 409 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lupu and J. A. Menendez Targeting Fatty Acid Synthase in Breast and Endometrial Cancer: An Alternative to Selective Estrogen Receptor Modulators? Endocrinology, September 1, 2006; 147(9): 4056 - 4066. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Moreau, E. Dizin, H. Ray, C. Luquain, E. Lefai, F. Foufelle, M. Billaud, G. M. Lenoir, and N. D. Venezia BRCA1 Affects Lipid Synthesis through Its Interaction with Acetyl-CoA Carboxylase J. Biol. Chem., February 10, 2006; 281(6): 3172 - 3181. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Meyer, B. Schneider, M. Reichel, S. Angermueller, S. Strehl, S. Schnittger, C. Schoch, M. W. J. C. Jansen, J. J. van Dongen, R. Pieters, et al. Diagnostic tool for the identification of MLL rearrangements including unknown partner genes PNAS, January 11, 2005; 102(2): 449 - 454. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




