Carcinogenesis Advance Access originally published online on October 24, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 25, No. 2, 157-167,
February 2004
© Oxford University Press; all rights reserved
CANCER BIOLOGY |
RING protein Trim32 associated with skin carcinogenesis has anti-apoptotic and E3-ubiquitin ligase properties
1 Department of Dermatology and Department of Cell and Developmental Biology, Oregon Health and Science University, Portland, OR 97239, USA, 2 Department of Pharmacology and Therapeutics, Roswell Park Cancer Institute, State University of New York at Buffalo, Buffalo, NY 14263, USA, 3 Department of Radiation Oncology, University of Arizona, Tucson, AZ 85724, USA, 4 Laboratory of Cellular Carcinogenesis and Tumor Promotion, National Cancer Institute/National Institutes of Health, Bethesda, MD 20892, USA, 5 Department of Molecular Genetics, The University of Texas M.D. Anderson Cancer Center Houston, TX 77030, USA and 6 Laboratory of Immunobiology, US Food and Drug Administration, Rockville, MD 20857, USA
| Abstract |
|---|
|
|
|---|
Tripartite motif protein 32, Trim32, mRNA and protein expression was elevated in independently transformed and tumorigenic keratinocytes of a mouse epidermal carcinogenesis model, in ultraviolet B (UVB)-induced squamous cell carcinomas (SCC), and in
2025% of chemically induced mouse papillomas and human head and neck SCCs. This suggests that elevated Trim32 expression occurs frequently in experimental epidermal carcinogenesis and is relevant to human cancer. Transduced Trim32 increased colony number in an epidermal in vitro transformation assay and epidermal thickening in vivo when skin-grafted to athymic nu/nu mice. These effects were not associated with proliferation and were not sufficient for tumorigenesis, even with 12-O-tetradecanoylphorbol-13-acetate treatment or defects in the tumor suppressor p53. However, transduced Trim32 inhibited the synergistic effect of tumor necrosis factor
(TNF
) on UVB-induced apoptosis of keratinocytes in vitro and the apoptotic response of keratinocyte grafts exposed to UVB-light in vivo. Consistent with its RING domain, Trim32 exhibited characteristics of E3-ubiquitin ligases, including being ubiquitylated itself and interacting with ubiquitylated proteins, with increases in these properties following treatment of cultured keratinocytes with TNF
/UVB. Interestingly, missense point mutation of human TRIM32 has been reported in Limb-Girdle Muscular Dystrophy Type 2H, an autosomal recessive disease. We propose a model in which Trim32 activities as an E3-ubiquitin ligase favor initiated cell survival in carcinogenesis by blocking UVB-induced TNF
apoptotic signaling.
Abbreviations: EGF, epidermal growth factor; GFP, green fluorescent protein; GST, glutathione S-transferase; HCEM, high calcium Eagle's medium; HNSCC, head and neck SCC; LCEM, low calcium Eagle's medium; LGMD2H, Limb-Girdle Muscular Dystrophy type 2H; qPCR, quantitative real-time PCR; SBC, sunburn cell; SCC, squamous cell carcinoma; TPA, 12-O-tetradecanoylphorbol-13-acetate; TNF
, tumor necrosis factor alpha; Trim32, Tripartite motif protein 32; UVB, ultraviolet B
| Introduction |
|---|
|
|
|---|
The TRIM protein family, originally described as the RBCC family, has been extended and re-named based on a characteristic tripartite motif that includes the RING, B1 and/or B2 Boxes, and the coiled-coil domain (1). Several TRIM family members are involved in human developmental disorders or cancer. TRIM20 (PYRIN/MARENOSTRIN), TRIM18 (Midline one/MID1) and TRIM37 (Multiple/MUL) are mutated in familial Mediterranean fever, X-linked Opitz/GBBB syndrome and mulibrey nanism (dwarfism), respectively. TRIM19 (promyelocytic leukemia/PML), TRIM27 (Ret finger protein/RFP) and TRIM24 (transcriptional intermediary factor 1/TIF1) form oncogenic fusion proteins with RAR
(retinoic acid receptor alpha), RET (Ret proto-oncogene) and B-RAF (v-raf murine sarcoma viral oncogene homolog B1), respectively (1), while TRIM25 (estrogen responsive finger protein/EFP) enhances breast tumor growth (2). TRIM25 and Trim32, the focus of this study, are unique among TRIM proteins so far in being linked to cancer without being oncogenic fusion proteins. Further, the TRIM32 gene is mutated in Limb-Girdle Muscular Dystrophy type 2H (LGMD2H), a mild autosomal recessive myopathy (3).
While the biochemical activity of TRIM32 is currently unknown, the conserved TRIM domains give clues to its function. The RING and B-box domains are zinc fingers with conserved cysteine residues. RING domains are present in E3-ubiquitin ligases and mediate interaction with E2-ubiquitin conjugating enzymes (4), while the coiled-coil domain mediates homo- and heterodimerization (5). TRIM32 also contains a C-terminal NHL domain (6). The RING domain suggests that TRIM32 is an E3-ubiquitin ligase, as proposed by Frosk et al. (3). The RING domain is characteristic of proteins with E3-ubiquitin ligase activity, including proteins involved in the control of apoptosis (cIAP1, cIAP2, XIAP and all TRAF proteins except TRAF1), transcription (Sina, Rbx1 and Mdm2), cell cycle (APC11), tyrosine kinase growth factor receptor signaling (CBL family members) and the tumor suppressor protein BRCA1 (4). Furthermore, other TRIM proteins are E3-ubiquitin ligases, including TRIM18, which targets the degradation of phosphatase 2A, PP2Ac (7) and TRIM25, which targets the degradation of 14-3-3-
(2).
In this study, we report evidence for Trim32 association with epidermal carcinogenesis and a fraction of human head and neck squamous cell carcinomas (HNSCC). Transduced Trim32 induced in vitro transformation of epidermal keratinocytes and epidermal thickening in vivo. These effects of wild-type Trim32 over-expression were coupled with inhibition of tumor necrosis factor
(TNF
)/ultraviolet B (UVB)-induced apoptosis in vitro and UVB-induced apoptosis in vivo. Furthermore, Trim32 expressed in keratinocytes had features of an E3-ubiquitin ligase that increased in response to TNF
/UVB treatment. Our results suggest that Trim32 contributes to cellular transformation and tumorigenesis by fostering the survival of cells that would otherwise undergo apoptosis.
| Materials and methods |
|---|
|
|
|---|
Cell culture
The clonal epidermal model of carcinogenesis (summarized in Figure 1) was derived and described previously (8). Non-transformed 291 keratinocytes exhibit characteristics of primary epidermal cultures, including regulation of proliferation and terminal differentiation by extracellular Ca2+, keratin patterns and cornification envelope formation indistinguishable from that of primary epidermal cultures, and lack of tumorigenicity in syngeneic newborn mice. These cells were grown in low calcium Eagle's medium (LCEM), composed of Eagle's minimal essential medium (EMEM) with Eagle's salts without CaCl2 (Invitrogen, Carlsbad, CA), supplemented with 5% (v/v) fetal calf serum [pre-treated with Chelex-100 resin (Bio-Rad, Hercules, CA), to reduce calcium concentration], 10% (v/v) mouse dermal fibroblast conditioned media, 10 ng/ml EGF (UBI), 1% (v/v) antibiotic-antimycotic (Invitrogen) and 0.04 mM CaCl2. Transduced keratinocytes were selected and maintained with 100 µg/ml G418 (Invitrogen). The 09C, 05C and 03C initiated cells and the 09R tumorigenic cells were grown in high calcium Eagle's medium (HCEM), composed of EMEM supplemented with 5% (v/v) fetal calf serum, 10 ng/ml EGF, 1% (v/v) antibiotic-antimycotic and 1.4 mM CaCl2. Tumorigenic 05R and 03R cells were grown in HCEM medium without EGF supplementation. All cells were cultured under identical conditions in LCEM 24 h prior to RNA or protein harvest.
|
Cloning of mouse Trim32
mRNA differential display was performed as described (9). The complete Trim32 cDNA (GenBank AF347694, NM_053084) was obtained by screening a normal adult mouse testis cDNA library (Stratagene, Cedar Creek, TX) and performing ligation-anchored PCR using the Marathon cDNA Amplification Kit (Clontech, Palo Alto, CA) and Balb/C adult mouse brain mRNA template.
Human tumor collection
Patients with HNSCC who gave informed consent were selected for the study. Tumor and uninvolved mucosa samples were removed during surgery. Tumors were macrodissected to remove non-cancerous tissue and samples were snap-frozen immediately for biochemical studies.
Northern blotting and qPCR
RNAs were extracted from cells at
70% confluence using TRIzol reagent, and normal adult Balb/C mouse tissues and human tumor and tissue samples were homogenized in TRIzol Reagent using a Polytron (Kinematica, Littau-Lucerne). Ten micrograms of RNA was separated on a denaturing formaldehyde agarose gel, transferred to a nylon membrane, and incubated with [32P]dCTP-labeled 1.5 kb Trim32 probe (3 x 106 c.p.m./ml). After washing, radioactive signals were visualized by autoradiography and quantified by phosphorimaging (Amersham, Piscataway, NJ).
For quantitative real-time PCR (qPCR), total RNA was treated with DNase I (Invitrogen), and cDNA was generated using AMV reverse transcriptase (Roche, Indianapolis, IN) and random hexamers (Integrated DNA Technologies, Coralville, CA). Gene expression data were collected using the 7900HT thermocycler (Applied Biosystems, Foster City, CA) and gene-specific primers for human TRIM32 [qTRIM1 (TGTCCCTTTTGCAGCAAGATT) and qTRIM2 (GATCTTTAGCACTGTCAGATTGTCTGT)] and 18S [18S1(CGGCTACCACATCCAAGGAA) and 18S2 (CCTGTATTGTTATTTTTCGTCACTACCT)] in the presence of SYBR-Green I dye (Applied Biosystems). SYBR-Green I fluoresces upon binding to the minor groove of double-stranded DNA, allowing the quantification of the double-stranded amplicon in real time. Data were analyzed using the D
CT method (ABI user bulletin #2, December 11, 1997).
Trim32-specific antibodies and immunoblotting
Trim32 cDNA was cloned into pGEX (Amersham), and an N-terminal GSTTrim32 fusion protein was produced in bacteria and purified as described (10). GSTTrim32 was injected into three female New Zealand white rabbits (RPCI Laboratory Animal Resources, Buffalo, NY). Antisera specificity and titer for Trim32 antigen were tested by immunoblotting cell lysates and recombinant protein.
Cultured cells at 70% confluence were lysed at 4°C for 1 h in extraction buffer (20 mM HEPES, pH 7.5, 20% glycerol, 500 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 1 mM Na3VO4, 50 mM NaF, 1 mM DTT, 0.4 mM Pefabloc, 5 µl/ml PSC protector, 1 µM leupeptin, 1 µM pepstatin and 0.1 µM aprotinin), and lysates cleared by centrifugation at 12 000 g for 15 min. Tumors and normal skin were isolated from SKH-1 hairless mice treated with UVB (9.0 kJ/m2 cumulative dose UVB) for 26 weeks or Sencar mice treated with a sub-threshold dose of DMBA (5 µg DMBA/0.2 ml acetone) and treated with 12-O-tetradecanoylphorbol-13-acetate (TPA) (2 µg TPA/0.2 ml acetone once weekly) or mezerein (4 µg mezerein/0.2 ml acetone twice weekly) for 20 weeks. Mouse tumor samples were pulverized in liquid nitrogen, and protein was isolated from TRIzol lysates according to the manufacturer's instructions. Protein was quantified using the Bradford colorimetric assay (Bio-Rad) according to manufacturer's instructions.
Lysates (40 µg total protein) were resolved in SDSPAGE, transferred onto nitrocellulose membranes (Schleicher & Schuller, Keene, NH) and immunoblotted with Trim32 antiserum or with monoclonal antibodies for green fluorescent protein (GFP) (Santa Cruz Biotechnology, Santa Cruz, CA) or Hsp70 (Stressgen, San Diego, CA). Immuno-complexes were visualized by chemiluminescence and quantified using an Epson Perfection 1650 Photo Scanner and OptiQuant (Packard) software. Fast-Green staining of total protein was used as a loading control.
Transformation assays
The in vitro transformation assay is based on altered response to extracellular calcium ion (Ca2+) as described (11). Non-transformed 291 keratinocytes proliferate in culture media with 0.04 mM extracellular Ca2+ supplemented with EGF and fibroblast conditioned media. When the extracellular Ca2+ concentration is elevated (>1 mM), and EGF and conditioned media are removed, non-transformed keratinocytes accumulate differentiation-specific keratins, terminally differentiate and slough from the culture dish, while transformed keratinocytes continue to proliferate. In addition, 291 cells have a spontaneous transformation frequency of <0.001, indicating that the background of this assay is very low (11).
For transduction of 291 cells, full-length Trim32, GFP and activated (mutant) Ha-Ras (GenBank J00277) were cloned into the pLXSN vector (Clontech) and transfected into ecotropic
NX packaging cells (provided by Dr Gary Nolan, Stanford University). Viral supernatant was titered in NIH-3T3 cells. Multiplicity of infection (MOI) was 0.6 p.f.u./cell for Trim32, anti(
)-sense Trim32, and GFP viruses and 0.006 p.f.u./cell for Ha-Ras. For each transformation assay, three independent 291 cultures were grown in LCEM and infected with retroviral supernatant in the presence of 5 mg/ml polybrene at 32°C. Twenty-four hours post-infection, cells were trypsinized and plated at clonal density (
100 surviving colonies/60-mm dish, 12 dishes per treatment group) in LCEM with 100 µg/ml G418 (Invitrogen) at 37°C. Due to a lower MOI, Ras-transduced cells were plated at least 10x greater density than Trim32-,
-sense Trim32- or GFP-transduced cells. After 10 days, three dishes were removed, cell colonies were fixed in methanol, stained with 10% Giemsa and counted to calculate plating efficiency (%PE = [number of colonies grown at 0.04 mM Ca2+/number of viable cells plated]x 100). In the remaining dishes, HCEM media with 100 µg/ml G418 was added and exchanged twice weekly. Four weeks after the media switch to HCEM (day 38) colonies were fixed with formalin, stained with the keratin selective stain rhodamine (0.36% in water), and counted to calculate transformation frequency (%TF = [number colonies grown at 1.4 mM Ca2+/number of colonies grown at 0.04 mM Ca2+]x 100). Where indicated, cells were treated with 10 ng/ml TPA beginning at day 5 and continued twice weekly to day 38.
Cell strain generation
Primary keratinocytes were isolated as described previously (8) from neonatal p53R172HDg transgenic mice and their wild-type siblings (12) or neonatal p53 -/- and p53 +/- mice (13). Epidermal cells were infected with Trim32 or GFP retroviral supernatant as described above to generate 291-Trim32, 291-GFP, 291-Ha-Ras and respective p53R172HDg, p53 -/- and p53 +/- Trim32 or GFP-expressing cell strains. Dishes expressing the same virus were pooled and maintained in LCEM with 100 µg/ml G418. RNA expression levels were tested by northern blotting (Trim32, GFP and activated Ha-Ras), genotype of p53-defective cells was tested by PCR, and Trim32, GFP and p53 protein expression levels were tested by immunoblotting.
Tumorigenesis studies
Cells were grown in LCEM with G418 (100 µg/ml), and engrafted to the skin biopsy sites of athymic nu/nu mice using an established skin-grafting technique (8). 5 x 106 cells were placed on each graft site. Two weeks after grafting, where indicated, TPA was applied topically once per week for 20 weeks (16 nmol or 2 µg TPA/0.2 ml acetone) to the backs of mice. Mice were killed when a tumor reached 1 cm in diameter. Samples of tumor and uninvolved skin were placed in formalin for histopathological analysis and snap-frozen for biochemical analysis (genotyping of p53 status and immunoblotting for Trim32 and GFP protein).
Apoptosis assays
291-Trim32 or 291-GFP cells (described above) were treated at 50% confluence with 5 ng/ml mouse TNF
(R&D Systems, Minneapolis, MN) and/or 230 J/m2 UVB (using two Westinghouse FS20T12 sun lamps with maximum emission at 310 nm) alone or in combination. After 18 h cells were stained with 5 mg/ml Hoechst 33342 (Molecular Probes, Eugene, OR) and 10 nM mitotracker (Molecular Probes). Hoechst dye intercalates into DNA, and mitotracker accumulates in intact mitochondria in response to mitochondrial oxidation. Cells were observed under phase contrast and fluorescence microscopy using an X170 Olympus Inverted Microscope and images captured with a Magnafire digital camera. Apoptotic and non-apoptotic cells (
300 cells/condition) were counted visually on the captured digital images.
To measure caspase-3 proteolytic activity, cytoplasmic lysates were prepared by freeze thawing of the cell pellets in hypotonic buffer (14) 4.5 h after treatment with TNF
/UVB. Reactions were performed with 30 µg cytosolic protein extract in 230 ml buffer containing 100 mM HEPES, pH 7.5, 20% glycerol, 0.1% CHAPS, 10 mM DTT, 0.1 mg/ml BSA and 200 µM Ac-DEVD-NA (a colorimetric substrate for active caspase-3). Absorbance was measured at 405 nm every 30 min for up to 4 h inside a microplate spectrophotometer, and results were plotted as 405 nm absorbance versus incubation time and fitted to a straight line (typical correlation coefficients of 0.989 or better). The slope of the line is proportional to caspase-3 proteolytic activity.
291-Trim32 and 291-GFP cells were engrafted to skin biopsy sites of athymic nu/nu mice (as described above). Nine days post-grafting, mice were anaesthetized and irradiated with 600, 1200 or 1800 J/m2 (as described above) and killed 24 h later. Grafts were harvested and placed in formalin for histopathological analysis. Sunburn cells (SBC) were counted per number of basal cells in four serial sections. Apoptosis was confirmed by in situ oligo ligation (ISOL) (Seralogicals Corporation, Norcross, GA), which measures duplex blunt end DNA, a hallmark of apoptosis. Staining was performed by the OHSU Cancer Institute cancer pathology shared resource.
Ubiquitylation studies
291 cells were transfected with myc-tagged ubiquitin (provided by Dr David Ransom, Oregon Health & Science University) and GFP or GFP-Trim32 expression plasmids. Transfected cells were treated with TNF
/UVB (as described above), and protein extracts were prepared 4.5 h after treatment. The proteosome inhibitor MG132 (20 µM) was added to the culture medium 2.5 h prior to protein extraction. Cells were lysed in a buffer containing 50 mM HEPES, pH 7.5, 0.1% Triton X-100, 150 mM NaCl and 20% glycerol with 1 µM leupeptin, 1 µM pepstatin and 1 mM PMSF. Protein concentration was determined by the Bradford colorimetric assay. Lysates were diluted to a final protein concentration of 1 µg/µl, and a total of 400 µg of lysate protein was incubated with a 1/100 dilution of the myc-epitope-specific 9E10 ascites fluid (Sigma-Aldrich, St Louis, MO) or 2 µg of the GFP-specific monoclonal antibody B-2 (Santa Cruz Biotechnology). Samples were incubated overnight at 4°C, and proteinantibody complexes were collected with Sepharoseprotein A beads and eluted with 2x sample buffer. Samples were resolved in SDSPAGE as described above. Myc-immunoprecipitated proteins were immunoblotted with a GFP-specific rabbit polyclonal antibody (Santa Cruz Biotechnology), while GFP-immunoprecipitated proteins were immunoblotted with 9E10.
| Results |
|---|
|
|
|---|
Expression of Trim32 in an epidermal carcinogenesis model and in normal mouse tissues
The clonal epidermal model of carcinogenesis (Figure 1) consists of non-transformed progenitor cells and three independently initiated lineages with distinct tumor fates (8). Although tumors are morphologically identical to sporadic tumors induced by DMBA/TPA (7,12-dimethylbenz[a] anthracene/12-O-tetradecanoylphorbol-13-acetate) treatment in vivo, they lack Ha-Ras gene over-expression or mutation (15), providing an opportunity to explore other cancer genes (9,16,17). The cell lineages cryopreserved at different stages of transformation and tumorigenesis also lend themselves to functional testing of candidate oncogene activities in growth, apoptosis and in vitro transformation. Trim32 elevation in the epidermal model, originally detected by differential display (data not shown), was confirmed by detection of a single 3 kb mRNA by northern blotting (Figure 2A). All initiated (09C, 05C and 03C) and tumorigenic (09R, 05R and 03R) cells exhibited 25-fold elevated expression compared with non-transformed 291 cells, suggesting that Trim32 mRNA is frequently elevated at initiation and persists with tumorigenic progression and malignancy. Trim32 mRNA was present in all normal mouse tissues examined by northern blotting, indicating ubiquitous expression (Figure 2B). The elevated expression of Trim32 protein in mouse brain was confirmed in human brain by immunoblotting with Trim32 antibody (data not shown). Our results are consistent with Frosk et al. (3) who found TRIM32 mRNA elevated in human brain and Reymond et al. (1) who reported ubiquitous expression of Trim32 mRNA in adult tissues and in developing mouse brain (http://www.tigem.it/TRIM/ish/ish/trim32ish.htm).
|
Mouse Trim32 cDNA was cloned and identified as the ortholog of human HT2A. HT2A protein was originally discovered by binding to TAT, the transcriptional activator of HIV (18) and renamed TRIM32 based on functional motifs (1). The cloned mouse Trim32 cDNA sequence (GenBank AF347694, NM_053084) comprises a 1968 nt open reading frame encoding a 655 amino acid protein and is over 96% identical to human TRIM32 in deduced amino acid sequence (Figure 3). Mouse Trim32, like human TRIM32, contains a RING domain (differing from the human sequence by 1 amino acid), a B-box, and a coiled-coil domain, characteristic of the tripartite motif (TRIM) family (1), and the C-terminal NHL domain. The NHL domain in human TRIM32 is responsible for TAT protein interaction (18) and is mutated in LGMD2H from aspartic acid to asparagine at amino acid 487 (3). Trim32 sequencing at the genomic level indicated that both the 291 non-transformed and 03R squamous cell carcinoma (SCC) cells had wild-type Trim32 (data not shown), verifying association of transformation-related changes with over-expression of wild-type protein.
|
Trim32 protein and TRIM32 mRNA elevated expression in independently derived tumors
Consistent with findings for Trim32 mRNA, Trim32 protein levels (26-fold) were elevated in all initiated (09C, 05C and 03C) and tumorigenic (09R, 05R and 03R) cells of the clonal epidermal cell model, compared with non-transformed 291 cells (Figure 4A). To determine the broader relevance of elevated Trim32 expression to epidermal cancers, protein levels were measured in mouse tumors derived by UVB-irradiation or two-stage carcinogenesis protocols (Figure 4B). Trim32 was present in all samples examined, and all tumors (6/6) induced by UVB had elevated Trim32 protein levels, ranging from 2 to 6 times non-irradiated skin from the same mouse. Interestingly, two samples of non-tumorous UVB-irradiated skin taken from the back of these mice (lanes 5I and 6I, Figure 4B) showed elevation of Trim32 expression, suggesting that UVB-initiated skin may already have elevated Trim32 expression. A single treatment with 1500 J/m2 UVB failed to increase Trim32 expression in mouse skin up to 8 days after irradiation (data not shown), ruling out the possibility that elevated Trim32 expression seen in tumors was an acute keratinocyte response to UVB irradiation. Twenty-four percent of tumors induced by DMBATPA or DMBAmezerein had elevated Trim32 protein levels >2-fold (2/12 and 3/9, respectively) compared with uninvolved skin from age-matched control mice. Histopathology confirmed UVB-induced tumors (6/6) as SCCs and chemically induced tumors (21/21) as benign papillomas. These results suggest that elevation of Trim32 expression is common in UVB-induced carcinomas and present, although less frequently, in papillomas induced by two-stage chemical carcinogenesis protocols. They further support findings in the clonal model that elevation of Trim32 occurred in benign as well as in malignant stages of tumorigenesis.
|
To determine the relevance of TRIM32 elevation to human cancer development, qPCR was used to examine TRIM32 mRNA levels in HNSCC compared with uninvolved mucosa from the same patient. HNSCC samples from three of 14 patients (21%, see patient number with asterisk) had elevated TRIM32 mRNA expression levels compared with uninvolved mucosa, P < 0.05 (Figure 4C). Because HNSCC is associated with risk factors of alcohol and tobacco use, paired tumor and uninvolved mucosa samples from the same patient may have been exposed to the same carcinogenic factors. For this reason, TRIM32 expression levels were examined in normal mucosa from six sleep apnea patients. Relative TRIM32 expression levels were significantly higher in HNSCC patient uninvolved mucosa samples compared with normal mucosa, P < 0.05 Wilcoxon Rank Sum test (Figure 4C, inset). Thus, TRIM32 was elevated in a fraction of human HNSCC samples, similar to the fraction of chemically induced mouse epidermal cancers (2124%). While verification in a larger cohort is necessary, the data from human samples support the findings in the mouse model that TRIM32 expression can be elevated early, prior to malignancy, and maintained or further increased in malignant tumors.
Keratinocyte transformation in vitro and epidermal thickening in vivo by transduced Trim32
Given this association of Trim32 expression with experimental carcinogenesis and human tumors, we next used an in vitro transformation assay (11) to test whether Trim32 was sufficient for epidermal cell transformation. This assay, based on altered response to extracellular Ca2+, measures an early step in epidermal cell transformation in response to a variety of chemical (19), physical or viral oncogenic factors applied in vitro or in vivo (20). The ability to maintain colonies under conditions that induce terminal differentiation in vitro correlates with initiation, whether carcinogen is applied in vitro or in vivo (21). The in vitro transformation assay (summarized in Figure 5A) was applied to 291 cells retrovirally transduced with GFP, Trim32,
-sense Trim32 or activated Ha-Ras, and selected with G418. As shown in Figure 5B, Trim32 increased transformation frequency 23-fold that of GFP or
-sense Trim32 negative controls (P < 0.0001, Wilcoxon Rank Sum test). A similar 23-fold increase in transformation frequency in Trim32 cells compared with GFP cells was observed in cells treated with TPA (P < 0.0001), and activated Ha-Ras as a positive control efficiently induced transformation. Ha- Ras-transduced transformed colonies were larger with more darkly stained, tightly packed cells than Trim32 transformed colonies, suggestive of greater proliferative activity. Doubling times of the stably transduced cells (
2 days) and plating efficiencies in the transformation assays were equivalent between groups, although decreased in the presence of TPA (data not shown).
|
To assess Trim32 activity in cellular transformation in vivo, 291 cells were retrovirally transduced with Trim32, GFP or mutant Ha-Ras and selected with G418, to obtain the 291-Trim32, 291-GFP and 291-Ras cells, respectively. Expression levels of Trim32, GFP and mutant Ha-Ras were confirmed by immunoblotting (data not shown). Then, cells were engrafted to skin biopsy sites of athymic nu/nu mice (8) and exposed to TPA. Trim32:TPA-treated mice (3/6) exhibited thickened skin compared with GFP:TPA-treated mice or Trim32:solvent control. A biopsy of Trim32:TPA mice (Figure 6A, upper left panel) revealed spongiosis (edema) and thickened epidermis with occasional dyskeratotic keratinocytes reminiscent of Bowen's Disease, a SCC in situ found on sun exposed skin (22), shown for comparison (Figure 6A, lower left panel). Few mitotic figures were present, suggesting that epidermal thickening was not due to increased proliferation. Small erythematous nodules were seen on the backs of Ras:TPA-treated mice (3/5), and biopsy revealed parakeratosis (nuclei within the cornified cell layers), loss of polarity, inflammation, breakdown of the epidermal/dermal junction and dysplasia consistent with early neoplasia (Figure 6A, lower right panel). Phenotypic abnormalities were absent in GFP:TPA (Figure 6A, upper right panel) and Trim32:solvent control mice (data not shown). The epidermal thickening seen in the Trim32:TPA mice persisted 12 months post-grafting (5 months after the last TPA treatment), but was seen in only a portion of the grafts and was not associated with enhanced proliferative features or papilloma formation, suggesting that additional carcinogenic events or cofactors are required.
|
Therefore, we combined elevated Trim32 expression with a malignant conversion-associated defect, loss of p53 function. The p53 gene is mutated in over 50% of human cancers (23) and p53 function is altered at malignant conversion in the clonal epidermal model [(16) and Knights and Kulesz-Martin, unpublished]. p53-defective keratinocytes [p53 +/-, p53 -/- (12)] [p53 -/R172H, p53 +/+ (13)] were transduced with Trim32 or GFP retrovirus and engrafted to athymic nu/nu mice (8). Prior to implantation, p53 genotype and Trim32 and GFP protein levels were verified. Trim32-expressing cells had 2.54-fold elevated Trim32 protein compared with their respective GFP-expressing control cell lines (data not shown). All cell strains were keratinocytes, as indicated by keratin 14 detection by immunoblotting (data not shown).
Tumors formed in p53 -/- Trim32 grafts (two tumors per 24 graft sites) beginning at 12 weeks compared with p53 -/- GFP grafts (0/24). When combined with mutant p53, tumors formed on 2533% of 24 graft sites, with no statistically significant differences between p53 -/R172H Trim32 and p53 -/R172H GFP groups (KaplanMeier analysis, data not shown). Histopathological examination indicated high-grade, anaplastic, spindle cell tumors in all groups that formed tumors. Thus, Trim32 over-expression was insufficient or weakly favorable to tumorigenesis in p53-null keratinocytes and offered little advantage to genetically unstable malignant keratinocytes with the mutant p53 gene.
However, Trim32 significantly accelerated and increased the incidence of epidermal thickening (annular plaque formation) in p53 -/- Trim32 compared with p53 -/- GFP groups (KaplanMeier analysis, shown in days, Figure 6B). Annular plaques radiated out from the original graft site beginning at 9 weeks post-grafting, peaking at 16 weeks at 12 cm in diameter (data not shown), and then gradually subsiding until unapparent. Histopathology of the annular plaque revealed compacted collagen bundling (collagen similar to scar tissue or the graft site) compared with uninvolved skin (Figure 6C, upper left compared with upper right panel) and an increased number and length of hair follicles compared with uninvolved skin (Figure 6C, lower left compared with lower right panel). The annular plaque phenotype has not been observed previously in hundreds of grafts of cultured cells or skin. Genotyping of tumors confirmed expression of the p53 mutant or null alleles, while the null allele was absent in the annular plaque (determined by PCR specific for the null cassette, data not shown), indicating that tumors arose from the engrafted epidermal cells as expected, whereas annular plaques were comprised of host cells. Thus, elevated Trim32 expression was sufficient for an early stage of cellular transformation in vitro, but not sufficient for tumorigenesis in vivo in the presence of TPA or defects in the p53 gene.
Protection of Trim32-transduced keratinocytes from apoptosis induced by TNF
/UVB in vitro and UVB in vivo
The common phenotype of Trim32 cells in vivo was thickening of skin, due to epidermal hyperplasia or increased number of hair follicles. This was not associated with increases in mitotic figures in vivo or cellular proliferation rates in vitro, suggesting that Trim32 may function in enhancing cellular survival, and led us to evaluate keratinocytes in response to inducers of apoptosis. UVB was chosen because of its well-documented role in inducing apoptosis in normal epidermis, its significance in human skin cancer and the elevated expression of Trim32 in the UVB-induced mouse skin tumors observed in the current study. Apoptosis underlies the sunburn reaction, a mechanism that eliminates keratinocytes with irreparable UV-induced damage (24). In addition, TNF
is released by skin keratinocytes upon UVB-irradiation, enhancing its apoptotic effects, and is a key mediator of sunburn (25). Therefore, stable retrovirally transduced 291-Trim32 and 291-GFP cells, previously used for in vivo transformation assays (Figure 6A) were treated in vitro with TNF
/UVB and examined for apoptosis. Apoptotic and non-apoptotic cells were distinguished in vitro by phase contrast microscopy, DNA and mitochondrial fluorescence staining, or caspase-3 activation. 291-Trim32 cells were 77% less sensitive to TNF
/UVB treatment than 291-GFP cells (Figure 7A). Furthermore, 291-Trim32 cells exhibited 23-fold reduction in caspase-3 activity after TNF
/UVB treatment (Figure 7A, inset). Representative morphology of cells 24 h after treatment with TNF
/UVB is shown (Figure 7B). Non-apoptotic cells have faint blue Hoechst nuclear fluorescence and intense red cytoplasmic mitotracker fluorescence, while apoptotic cells have intense Hoechst fluorescence and faint cytoplasmic red mitotracker fluorescence. The apoptotic response of 291-GFP cells was equal to that of the parental 291 cells, indicating that cell line generation alone did not alter apoptotic potential (data not shown).
|
On the basis of this anti-apoptotic effect of Trim32, we next examined the response of Trim32-transduced cells to UVB-irradiation in vivo. Apoptotic cells in the epidermis called SBCs are distinguished by their condensed, pycknotic nuclei and shrunken, eosinophilic cytoplasm (26). They are evident in mouse skin within 24 h post-irradiation with 500750 J/m2 UVB-light (27), a dose also shown to induce human keratinocyte apoptosis (28). TNF
was not added in our in vivo experiments because it is present in epidermis (29) and increases after UVB-irradiation (30). Grafted non-initiated keratinocytes have a lifespan of
21 days (31), and grafts were treated and harvested within 10 days.
Trim32 grafts were 22.6-fold less sensitive to apoptosis than GFP grafts irradiated with 600 J/m2 UVB (P < 0.02, Wilcoxon rank sum test) based on fewer SBCs in the Trim32 grafts in two experiments. In the experiments shown in Figure 7C, SBCs in GFP grafts increased 1020 times with increasing UVB doses of 600 and 1200 J/m2, respectively, with Trim32 grafts 2-fold less sensitive to apoptosis (P < 0.02, Wilcoxon rank sum test) than GFP grafts (Figure 7C). Representative UVB-irradiated grafts are shown with SBCs indicated (Figure 7D). Apoptosis in UVB-irradiated grafts was confirmed by ISOL, a refinement of the TUNEL assay (data not shown). The in vivo results indicate that cells expressing Trim32 were less sensitive to UVB-induced apoptosis than cells expressing GFP, suggesting Trim32 fosters cellular survival in the epidermis in response to UVB-irradiation. The in vitro results indicate an inhibition of the synergy between TNF
and UVB-irradiation in inducing apoptosis. We next sought to determine whether Trim32 could exhibit properties of an E3-ubiquitin ligase, as expected because of its RING domain, and whether these properties were responsive to TNF
/UVB treatment.
Trim32 a putative E3-ubiquitin ligase with increased activity after TNF
/UVB treatment
The RING domain of Trim32 suggests activity as an E3-ubiqutin ligase, as proven for TRIM family members TRIM18 (7) and TRIM25 (2). E3-ligases link ubiquitin groups to substrate proteins and often self-ubiquitylate. To examine E3-ubiquitin ligase activity of Trim32 in keratinocytes, we determined Trim32's ubiquitylation state and interaction with ubiquitylated proteins with or without TNF
/UVB treatment. First we ensured that the GFPTrim32 protein localized predominantly in the cytoplasm, as expected from studies of GFPTRIM32 (1) and endogenous TRIM32 localization in human fibroblasts (Dr Klaus Wrogemann, University of Manitoba, personal communication). GFPTrim32 fluorescence was concentrated in bright dots over a diffuse cytoplasmic staining (Figure 8A, right lower panel). Treatment with TNF
/UVB had no effect on GFP or GFPTrim32 protein levels compared with untreated lysates (Figure 8B). Upon immunoprecipitation with a myc-specific antibody (that recognizes transfected, myc-tagged ubiquitin) and immunoblotting with a GFP-specific antibody, several bands corresponding to ubiquitylated GFPTrim32 proteins were detected (Figure 8C, lane 3), and intensity of these bands increased after TNF
/UVB treatment (Figure 8C, lane 4 compared with lane 3). To determine if the GFPTrim32 fusion protein was interacting with other ubiquitylated proteins, lysates were immunoprecipitated with a GFP-specific antibody and immunoblotted with a myc- ubiquitin-specific antibody. Myc-positive proteins were detected in the high molecular weight range (>150 kDa), corresponding to ubiquitylated cellular proteins interacting with GFPTrim32 (Figure 8D, lane 3). Signal intensity increased after TNF
/UVB treatment (Figure 8D, lane 4 compared with lane 3). These results indicate that Trim32 has properties of an E3-ubiquitin ligase and that Trim32-associated ubiquitylation is stimulated by TNF
/UVB treatment.
|
| Discussion |
|---|
|
|
|---|
Trim32 was associated with carcinogenesis in benign and malignant tumorigenic keratinocytes and in early cellular transformation in vitro. The finding that Trim32 protein expression was uniformly elevated in sporadic cases of UVB-induced SCCs and in a fraction of chemically induced papillomas indicates that association of Trim32 expression with cancer was not limited to the clonal epidermal model and is likely to be of more general significance. Supporting relevance of the mouse model to human cancer, TRIM32 elevation in human HNSCC samples and adjacent mucosa suggests that TRIM32 is elevated early in HNSCC development and, as in the clonal keratinocyte model, maintained in malignant progression. In normal tissues, Trim32 expression was particularly high in brain and testis, two tissues that have very low rates of apoptosis and a blood-barrier that ensures tissue integrity. These observations support speculation that Trim32 has a role in cell survival of normal tissues.
Activated Ha-Ras is associated with proliferation of keratinocytes in the in vitro transformation assays and in vivo (32). Our results failed to provide evidence for proliferative stimulus by Trim32 in vitro or in vivo, and showed that Trim32 expression lowered the apoptotic response to UVB stimulation in vitro and in vivo. Thus, Trim32 may primarily confer a survival advantage, in contrast to activated Ha-Ras, which may confer a growth advantage. Tumor formation rates of Trim32-transduced epidermal cells with p53 null genotype or mutant p53 were similar to that of their respective GFP control epidermal cells, while others have shown that p53 -/- or p53 +/- cells transduced with activated Ha-Ras produced SCCs or papillomas (12). We speculate that the absence of an oncogenic proliferation stimulus may explain the insufficiency of Trim32 for tumorigenesis even in p53 null keratinocytes.
Trim32 did induce an in vivo phenotype of epidermal thickening and annular plaque formation, predominantly in mice engrafted with Trim32-transduced cells null for p53. A similar phenotype is seen in annulary erythema centrifigum, in which an annular rash indicates paraneoplastic changes in human skin (33). Hair follicle density amplification within the annular plaque may be a precursor to tumorigenesis, as suggested by transgenic mouse models of beta-catenin (34) or ornithine decarboxylase (35). Hair cycling in mouse skin occurs in a wave pattern with interactive signaling between neighboring follicles with 10% of the follicles in anagen, the proliferative phase and 90% in telogen, the resting phase. By morphology, hair follicles of the annular plaque were in late anagen, contributing to the thickened appearance (36), and did not progress to telogen, as in the uninvolved skin, potentially due to anti-apoptotic signaling from the engrafted cells.
Evidence from in vitro and in vivo apoptosis studies suggests Trim32 is involved in the cellular survival response. In vitro Trim32 expression inhibited the synergistic induction of apoptosis by TNF
/UVB treatment but not by UVB alone, suggesting Trim32 may function in TNF
pathways. TNF
is secreted by keratinocytes in response to UVB-irradiation, and the TNF
pathway is required for efficient UVB-induced apoptosis of skin in vivo (25). Consequently, it is reasonable to hypothesize that Trim32 confers cellular survival by dampening the apoptotic cellular response to TNF
after UVB-induced damage, expanding the pool of target cells for further oncogenic events. TNF
type I receptor is essential for the keratinocyte apoptotic response (25). Binding of TNF
to its type I receptor induces activation of the caspase cascade, JNK/p38 kinases, and the NF
B transcription factor (37). While the JNK/p38 pathway has a pro-apoptotic effect, and inhibition of p38 prevents UVB-induced apoptosis (38), our results indicate that Trim32 inhibited apoptosis induced by combined TNF
/UVB treatment but not UVB alone. Therefore, it is unlikely that Trim32 functions by inhibiting the pro-apoptotic JNK/p38 activation in keratinocytes. NF
B is not well understood as a regulator of keratinocyte pathways, but is anti-apoptotic in certain experimental conditions. Expression of inactivation-resistant I
B sensitizes keratinocytes to TNF
-induced apoptosis, and transgenic mice expressing a constitutively active I
B form show increased apoptosis in epidermal cells (39). However, inhibition of NF
B strongly promotes Ha-Ras tumorigenesis in human keratinocytes (40). Future experiments will be directed toward determining the effect of Trim32 expression on these TNF
signaling pathways and their contribution to transformation and inhibition of apoptosis.
Trim32 involvement in TNF
pathways is particularly intriguing due to TRIM32 gene mutation in LGMD2H (3). LGMD2H has an autosomal recessive inheritance, suggesting this mutation inactivates TRIM32. LGMD2A, another myopathy, is caused by null mutation of the calpain-3 gene resulting in inhibition of NF
B activation (41). It will be of interest to test whether TRIM32 positively modulates muscle survival in response to TNF
or other stress, and whether this effect is lost in the LGMD2H mutant.
The current evidence that Trim32 is ubiquitylated and co-immunoprecipitates with ubiquitylated proteins supports the prediction of Frosk et al. (3) that Trim32 is an E3-ubiquitin ligase. The relevance of these activities to the survival phenotype is supported by their increases after treatment with TNF
/UVB. An additional feature of TRIM proteins as E3-ligases remaining to be tested is RING domain-mediated interaction with E2-ubiquitin conjugating enzymes (42). TRIM19, a nuclear protein, has been shown to interact with UbcH9, an E2-SUMO conjugating enzyme (43), consistent with the observation that most sumoylation occurs in the nucleus and distinct from Trim32, which appears to be predominantly cytoplasmic.
Taken together, these results suggest that Trim32 imparts a survival phenotype to epidermal cells responding to TNF
/UVB-induced stress, whereby these epidermal cells persist and can accumulate additional UVB-induced DNA damage or other oncogenic events, leading to cancer development. Future studies will be directed towards elucidating the role of Trim32 in carcinogenesis, in cellular survival, and as an E3-ubiquitin ligase. We propose a model in which Trim32 activation promotes carcinogenesis by blocking certain stress-induced apoptotic signaling pathways, while inactivation of Trim32 signaling may exacerbate apoptotic signaling in muscle dystrophy. Understanding Trim32 function should provide insights into the control of cell growth and apoptosis in cancer development and muscular dystrophy.
| Notes |
|---|
7 To whom correspondence should be addressed Email: kuleszma{at}ohsu.edu
| Acknowledgments |
|---|
We thank Dr James Cohen, Dr Peter Anderson, Dr Frank Warren and Dr Mark Wax, OHSU OtolaryngologyHead and Neck Surgery, for head and neck specimens. We are grateful to Dr Christopher Corless and Dr Clifton White for histopathological examination and helpful discussion, Barbara Lisafeld and Laura Lee for technical expertise, and Jodi Johnson for assistance with preparation of this manuscript. This study was supported by NIH CA31101, Oregon Health Sciences Foundation, OHSU Cancer Center grant CA69533, The Tartar Trust, Portland, OR, The Mark Diamond Research Foundation, Buffalo, NY and Roswell Park Cancer Institute center grant CA16056.
| References |
|---|
|
|
|---|
- Reymond,A., Meroni,G., Fantozzi,A. et al. (2001) The tripartite motif family identifies cell compartments. EMBO J., 20, 21402151.[CrossRef][ISI][Medline]
- Urano,T., Saito,T., Tsukui,T., Fujita,M., Hosoi,T., Muramatsu,M., Ouchi,Y. and Inoue,S. (2002) Efp targets 14-3-3 sigma for proteolysis and promotes breast tumour growth. Nature, 417, 871875.[CrossRef][Medline]
- Frosk,P., Weiler,T., Nylen,E., Sudha,T., Greenberg,C.R., Morgan,K., Fujiwara,T.M. and Wrogemann,K. (2002) Limb-girdle muscular dystrophy Type 2H associated with mutation in TRIM32, a putative E3-ubiquitin-ligase gene. Am. J. Hum. Genet., 70, 663672.
- Joazeiro,C.A. and Weissman,A.M. (2000) RING finger proteins: mediators of ubiquitin ligase activity. Cell, 102, 549552.[CrossRef][ISI][Medline]
- Lupas,A. (1996) Coiled coils: new structures and new functions. Trends Biochem. Sci., 21, 375382.[CrossRef][ISI][Medline]
- Slack,F.J. and Ruvkun,G. (1998) A novel repeat domain that is often associated with RING finger and B-box motifs. Trends Biochem. Sci., 23, 474475.[CrossRef][ISI][Medline]
- Trockenbacher,A., Suckow,V., Foerster,J., Winter,J., Krauss,S., Ropers,H.H., Schneider,R. and Schweiger,S. (2001) MID1, mutated in Opitz syndrome, encodes an ubiquitin ligase that targets phosphatase 2A for degradation. Nature Genet., 29, 287294.[CrossRef][ISI][Medline]
- Kulesz-Martin,M.F., Penetrante,R. and East,C.J. (1988) Benign and malignant tumor stages in a mouse keratinocyte cell line treated with 7,12-dimethylbenz[
]anthracene in vitro. Carcinogenesis, 9, 171174.[Abstract/Free Full Text] - Liu,Y. and Kulesz-Martin,M.F. (1998) Altered gene expression in a clonal epidermal cell model of carcinogenesis identified by RNA differential display. Carcinogenesis, 19, 683686.
[Abstract/Free Full Text] - Albor,A., Kaku,S. and Kulesz-Martin,M.F. (1998) Wild type and mutant forms of p53 activate human topoisomerase I: a possible mechanism for the gain of function in mutants. Cancer Res., 58, 20912094.
[Abstract/Free Full Text] - Kulesz-Martin,M.F., Yoshida,M., Prestine,L., Yuspa,S.H. and Bertram,J.S. (1985) Mouse cell clones for improved quantitation of carcinogen-induced altered differentiation. Carcinogenesis, 6, 12451254.
[Abstract/Free Full Text] - Weinberg,W.C., Azzoli,C.G., Kadiwar,N. and Yuspa,S.H. (1994) P53 gene dosage modifies growth and malignant progression of keratinocytes expressing the v-ras(Ha) oncogene. Cancer Res., 54, 55845592.
[Abstract/Free Full Text] - Liu,G., McDonnell,T.J., Montes de Oca Luna,R., Kapoor,M., Mims,B., El-Naggar,A.K. and Lozano,G. (2000) High metastatic potential in mice inheriting a targeted p53 missense mutation. Proc. Natl Acad. Sci. USA, 97, 41744179.
[Abstract/Free Full Text] - Rathbun,R.K., Christianson,T.A., Faulkner,G.R., Jones,G., Keeble,W., O'Dwyer,M. and Bagby,G.C. (2000) Interferon-gamma-induced apoptotic responses of Fanconi anemia group C hematopoietic progenitor cells involve caspase 8-dependent activation of caspase 3 family members. Blood, 96, 42044211.
[Abstract/Free Full Text] - Schneider,B.L., Kulesz-Martin,M. and Bowden,G.T. (1995) Induced terminal differentiation and tumorigenic suppression in murine keratinocyte somatic-cell hybrids. Mol. Carcinogen., 13, 614.[ISI][Medline]
- Han,K.-A. and Kulesz-Martin,M. (1992) Altered expression of wild-type p53 tumor suppressor gene during murine epithelial cell transformation. Cancer Res., 52, 749753.
[Abstract/Free Full Text] - Wang,Z., Liu,Y., Mori,M. and Kulesz-Martin,M. (2002) Gene expression profiling of initiated epidermal cells with benign or malignant tumor fates. Carcinogenesis, 23, 635643.
[Abstract/Free Full Text] - Fridell,R.A., Harding,L.S., Bogerd,H.P. and Cullen,B.R. (1995) Identification of a novel human zinc finger protein that specifically interacts with the activation domain of lentiviral Tat proteins. Virology, 209, 347357.[CrossRef][ISI][Medline]
- Kulesz-Martin,M., Kilkenny,A.E., Holbrook,K.A., Digernes,V. and Yuspa,S.H. (1983) Properties of carcinogen altered mouse epidermal cells resistant to calcium-induced terminal differentiation. Carcinogenesis, 4, 13671377.
[Abstract/Free Full Text] - Kilkenny,A.E., Morgan,D., Spangler,E.F. and Yuspa,S.H. (1985) Correlation of initiating potency of skin carcinogens with potency to induce resistance to terminal differentiation in cultured mouse keratinocytes. Cancer Res., 45, 22192225.
[Abstract/Free Full Text] - Kawamura,H., Strickland,J.E. and Yuspa,S.H. (1985) Association of resistance to terminal differentiation with initiation of carcinogenesis in adult mouse epidermal cells. Cancer Res., 45, 27482752.
[Abstract/Free Full Text] - Burg,G. (2000) Atlas of Cancer of the Skin. Churchill Livingstone, Philadelphia.
- Levine,A.J. (1997) p53, the cellular gatekeeper for growth and division. Cell, 88, 323331.[CrossRef][ISI][Medline]
- Zhuang,L., Wang,B. and Sauder,D.N. (2000) Molecular mechanism of ultraviolet-induced keratinocyte apoptosis. J. Interf. Cytok. Res., 20, 445454.
- Zhuang,L., Wang,B., Shinder,G.A., Shivji,G.M., Mak,T.W. and Sauder,D.N. (1999) TNF receptor p55 plays a pivotal role in murine keratinocyte apoptosis induced by ultraviolet B irradiation. J. Immunol., 162, 14401447.
[Abstract/Free Full Text] - Ziegler,A., Jonason,A.S., Leffell,D.J., Simon,J.A., Sharma,H.W., Kimmelman,J., Remington,L., Jacks,T. and Brash,D.E. (1994) Sunburn and p53 in the onset of skin cancer. Nature, 372, 773776.[CrossRef][Medline]
- Okamoto,H., Mizuno,K., Itoh,T., Tanaka,K. and Horio,T. (1999) Evaluation of apoptotic cells induced by ultraviolet light B radiation in epidermal sheets stained by the TUNEL technique. J. Invest. Dermatol., 113, 802807.[CrossRef][ISI][Medline]
- Cotton,J. and Spandau,D.F. (1997) Ultraviolet B-radiation dose influences the induction of apoptosis and p53 in human keratinocytes. Radiat. Res., 147, 148155.[ISI][Medline]
- Tsai,J.C., Feingold,K.R., Crumrine,D., Wood,L.C., Grunfeld,C. and Elias,P.M. (1994) Permeability barrier disruption alters the localization and expression of TNF alpha/protein in the epidermis. Arch. Dermatol. Res., 286, 242248.[CrossRef][ISI][Medline]
- Oxholm,A., Oxholm,P., Staberg,B. and Bendtzen,K. (1988) Immunohistological detection of interleukin I-like molecules and tumour necrosis factor in human epidermis before and after UVB-irradiation in vivo. Br. J. Dermatol., 118, 369376.[CrossRef][ISI][Medline]
- Campbell,C., Hultman,S., Cairns,B., DeSerres,S. and Meyer,A. (2003) Green fluorescent protein-adenoviral construct as a model for transient gene therapy for human cultured keratinocytes in an athymic mouse model. J. Trauma-Inj. Infect. Crit. Care, 54, 7279.[CrossRef]
- Boukamp,P., Stanbridge,E.J., Foo,D.Y., Cerutti,P.A. and Fusenig,N.E. (1990) c-Ha-ras oncogene expression in immortalized human keratinocytes (HaCaT) alters growth potential in vivo but lacks correlation with malignancy. Cancer Res., 50, 28402847.
[Abstract/Free Full Text] - Elder,D.E., Elenitsas,R., Johnson,B.L.,Jr, Ioffreda,M., Miller,J.J. and Miller,O.F.,III (1999) Synopsis and Atlas of Lever's Histopathology of the Skin. Lippincott Williams & Wilkins, Philadelphia, PA.
- Gat,U., DasGupta,R., Degenstein,L. and Fuchs,E. (1998) De novo hair follicle morphogenesis and hair tumors in mice expressing a truncated beta-catenin in skin. Cell, 95, 605614.[CrossRef][ISI][Medline]
- Megosh,L., Gilmour,S.K., Rosson,D., Soler,A.P., Blessing,M., Sawicki,J.A. and O'Brien,T.G. (1995) Increased frequency of spontaneous skin tumors in transgenic mice which overexpress ornithine decarboxylase. Cancer Res., 55, 42054209.
[Abstract/Free Full Text] - Hansen,L.S., Coggle,J.E., Wells,J. and Charles,M.W. (1984) The influence of the hair cycle on the thickness of mouse skin. Anatom. Rec., 210, 569573.[CrossRef][Medline]
- Chan,F.K., Siegel,R.M. and Lenardo,M.J. (2000) Signaling by the TNF receptor superfamily and T cell homeostasis. Immunity, 419422.
- Assefa,Z., Vantieghem,A., Garmyn,M., Declercq,W., Vandenabeele,P., Vandenheede,J.R., Bouillon,R., Merlevede,W. and Agostinis,P. (2000) p38 mitogen-activated protein kinase regulates a novel, caspase-independent pathway for the mitochondrial cytochrome c release in ultraviolet B radiation-induced apoptosis. J. Biol. Chem., 275, 2141621421.
[Abstract/Free Full Text] - Seitz,C.S., Freiberg,R.A., Hinata,K. and Khavari,P.A. (2000) NF-kappaB determines localization and features of cell death in epidermis. J. Clin. Invest, 105, 253260.[ISI][Medline]
- Dajee,M., Lazarov,M., Zhang,J.Y. et al. (2003) NF-kappaB blockade and oncogenic Ras trigger invasive human epidermal neoplasia. Nature, 421, 639643.[CrossRef][Medline]
- Baghdiguian,S., Martin,M., Richard,I. et al. (1999) Calpain 3 deficiency is associated with myonuclear apoptosis and profound perturbation of the IkappaB alpha/NF-kappaB pathway in limb-girdle muscular dystrophy type 2A. Nature Med., 5, 503511.[CrossRef][ISI][Medline]
- Lorick,K.L., Jensen,J.P., Fang,S., Ong,A.M., Hatakeyama,S. and Weissman,A.M. (1999) RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc. Natl Acad. Sci. USA, 96, 1136411369.
[Abstract/Free Full Text] - Duprez,E., Saurin,A.J., Desterro,J.M., Lallemand-Breitenbach,V., Howe,K., Boddy,M.N., Solomon,E., de The,H., Hay,R.T. and Freemont,P.S. (1999) SUMO-1 modification of the acute promyelocytic leukaemia protein PML: implications for nuclear localisation. J. Cell Sci., 112, 381393.[Abstract]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
|
|







