Carcinogenesis Advance Access originally published online on December 4, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 25, No. 4, 637-643,
April 2004
Carcinogenesis vol.25 no.4 © Oxford University Press 2004; all rights reserved.
CARCINOGENESIS |
Mammary carcinogenesis and molecular analysis of in vivo cII gene mutations in the mammary tissue of female transgenic rats treated with the environmental pollutant 6-nitrochrysene
1 American Health Foundation Cancer Center, Institute for Cancer Prevention, Valhalla, NY 10595, USA, 2 Department of Basic Science, New York University Dental Center, New York, NY 10010, USA and 3 Department of Environmental Medicine, New York University, Medical Center, New York, NY 10016, USA
| Abstract |
|---|
|
|
|---|
We determined the mutant fractions (MF) and mutational specificities in the cII gene in histologically confirmed normal, non-involved and tumor mammary tissues of female transgenic (Big Blue F344 x Sprague-Dawley)F1 rats treated with the environmental pollutant 6-nitrochrysene (6-NC). At 30 days of age, three groups were set up for oral treatment with 6-NC dissolved in trioctanoin, or trioctanoin alone once a week for 8 weeks. Two dose levels of 6-NC (100 and 200 µmol/rat) were selected on the basis of our previous carcinogenicity bioassays with CD rats. The rats were decapitated 32 weeks after the last carcinogen dose. Both incidence and multiplicity of mammary adenocarcinomas were significantly elevated in the high dose (36%, 0.57, P < 0.01) group but at the low dose these outcomes (16%, 0.23, P < 0.1) were not significantly different from those of control rats (3%, 0.03). The MF in normal, non-involved and tumor tissues from the mammary glands of 6-NC-treated rats were comparable. At the high and low doses, respectively (4.8 ± 2.0, 3.2 ± 2.1) the MF of 6-NC-treated rats, were significantly higher (P < 0.05) than that observed in control rats (1.2 ± 0.6). Control mutants consisted primarily of GC
AT transitions, whereas 6-NC-induced mutants were comprised of several major classes of mutations with GC
TA, GC
CG, AT
GC and AT
TA as the most prevalent. Further studies indicated that the structures of 6-NCDNA adducts in the mammary tissue are consistent with the mutational specificities. This is the first report that defines the relationship between carcinogenesis and mutagenesis, as well as between structures of 6-NCDNA adducts and mutation characteristics in the target organ in vivo.
Abbreviations: BBR, Big Blue transgenic Fisher 344 rats; 6-NC, 6-nitrochrysene; MF, mutant fraction; NO2-PAH, nitropolynuclear aromatic hydrocarbon
| Introduction |
|---|
|
|
|---|
Breast cancer is second only to lung cancer as the leading cause of cancer-related deaths in American women (1,2). The etiology of most breast cancers remains obscure. In addition to genetic disposition, a significant portion of cancer incidence in the US is related to environmental factors and lifestyles, including diet (37). Consequently, the search for carcinogens that exist in the human environment challenges both scientists and regulatory agencies.
Ubiquitous environmental agents that are known to induce mammary cancer in rodents must be regarded as potential human risk factors and need to be evaluated more closely. An example of such environmental carcinogens is the class of nitropolynuclear aromatic hydrocarbons (NO2-PAHs)3 (810); 6-nitrochrysene (6-NC) is a representative example of this class of carcinogens. The significant carcinogenic activity of 6-NC in the rat mammary gland, its environmental occurrence, the ability of human liver, lung and breast tissue to convert 6-NC into DNA-reactive metabolites, as well as the finding of its hemoglobin adducts in humans suggest that it probably contributes to the development of human breast cancer (1116). In fact, several studies reported on the detection of DNA adducts in human breast tissue; however, the nature of these adducts remains unknown (1721).
Environmental carcinogens responsible for genomic alterations in human breast cancer have not been defined clearly. 6-NC can be activated by two pathways. The first pathway proceeds via simple nitro-reduction to form N-hydroxy-6-aminochrysene (N-OH-6-AC) that yields three DNA adducts; the structures of these adducts have been characterized (22) (Figure 1: adducts 1, 2 and 3). The second pathway involves a combination of nitro-reduction and ring-oxidation yielding a very reactive electrophile, trans-1,2-dihydroxy-1,2-dihydro-N-hydroxy-6-aminochrysene, that primarily leads to the formation of a major adduct, yet to be structurally characterized (Figure 1: adduct 4). We hypothesized that, in the absence of DNA repair, these adducts will cause mutations in important cancer genes (e.g. p53), and these mutations may lead to the development of breast cancer. Characteristic mutations in human cancer genes can potentially serve as molecular markers of past exposure to specific carcinogens. However, as exposures often arise from complex mixtures, and other factors may also be important in inducing mutations, it is generally difficult to identify signature mutations of human carcinogens. Transgenic animals containing retrievable reporter genes, provide a highly feasible system to identify signature mutations of carcinogens that can be compared with mutational spectra of oncogenes or tumor suppressor genes, and such information may be useful in risk assessment. In the present study, we determined the frequencies and types of mutations induced by 6-NC in the cII gene in histologically confirmed normal, non-involved and tumor tissues from the mammary glands of transgenic female rats, following treatment with carcinogenic doses of 6-NC. A follow-up short-term bioassay was initiated to determine the types of 6-NCDNA adducts in the rat mammary gland and their possible relationship to different types of mutations.
|
| Materials and methods |
|---|
|
|
|---|
Chemicals and enzymes
6-NC was synthesized using the procedure described by Newman and Cathcart (23). [
-32P]ATP and T4 polynucleotide kinase were purchased from Amersham Bioscience (Piscataway, NJ). All other enzymes were purchased from Sigma (St Louis, MO).
Animals
Male Big Blue transgenic Fisher 344 rats (BBR) with the genetic background of the F344 strain were purchased from Stratagene (La Jolla, CA) and female SpragueDawley rats were purchased from Charles River (Kingston, NY). Rats were housed in an animal facility maintained on a 12-h light/dark cycle, at a constant temperature (22 ± 2°C) and relative humidity (55 ± 15%) controlled room. A total of 96 female (BBR x CD)F1 rats were produced by mating two male BBR and six female CD rats. The rats were fed NIH-07 diet during breeding and AIN-76A (high fat) diet after weaning; the latter was used to mimic the Western diet. The presence of the lambda/LIZ shuttle vector in the hybrid rats (which also contains cII gene) was confirmed by the ability of packaged DNA from lacI rats to form phage plaques on Escherichia coli 1250, and the presence of the cII sequence in the phage DNA (see below).
Carcinogenesis assay
At 30 days of age, groups of 31, 14 and 33 of the transgenic rats were treated orally with 6-NC at two dose levels in 500 µl of trioctanoin, or with trioctanoin alone as control once a week for 8 weeks. The carcinogenic doses of 6-NC (total dose: 100 or 200 µmol/rat, respectively) were selected on the basis of our previous bioassays with CD rats (24). Rats were weighed and palpated weekly after carcinogen treatment to determine the incidence and multiplicity of mammary tumors. Thirty-two weeks after the last carcinogen dose, the rats were decapitated. All animals were necropsied and the mammary glands were examined macroscopically for any gross lesions or abnormalities. Portions of the mammary gland (tumors, non-involved and normal tissues) were stored at -80°C for mutagenesis assays. The remaining mammary tissues were fixed in 10% buffered formalin solution, processed for paraffin sections and stained with hematoxylin and eosin. Histological diagnosis of mammary tumors was based on criteria outlined by Russo et al. (25).
The cII mutagenesis assay
The BBR contains a lambda shuttle vector that includes the bacterial lacI locus and also the cII gene, which is the target for the mutagenesis studies. It also obviates the potential for ex vivo mutations that could complicate results. This assay detects mutations at the cII locus and possibly the regulator cI locus (2630). The cII protein is a positive regulator of gene transcription that controls the decision between lytic or lysogenic development pathways in phage-infected cells. In appropriate E.coli (E.coli 1250) host cells, under specified conditions (25°C) only mutants give rise to phage plaques, whereas at 37°C all infected cells give rise to plaques, providing a phage titer (2630). The ratio of mutant to non-mutant plaques is the measure of mutagenesis, the mutant fraction (MF).
Mammary tissue from control and 6-NC-treated rats was ground under liquid nitrogen; the ground tissue was homogenized in a dounce homogenizer, and nuclei were separated by centrifugation. The nuclei were digested with protease K and RNase was added before layering this mixture onto 0.45 µ pore-size membranes and dialyzing overnight. After extraction, the DNA was packaged into phage particles using a Transpack phage packaging extract (Stratagene, La Jolla, CA) mixed with the appropriate host strain of E.coli (1250) and assayed for plaque-forming units and mutants (26). Fifteen to 43 mutants/animal were observed in the 6-NC-treated groups and 1021 mutants were seen in each of the control animals. Mammary tissue from eight control rats, 14 low-dose and nine high-dose 6-NC-treated rats was assayed for mutagenesis. The differences between MF in the three groups were analyzed using Student's t-test.
Mutational specificities
Mutant plaques were selected at random, removed from Petri dishes with a wide bore pipette tip and re-suspended in phage buffer. Plaques for amplification and sequencing were taken at random from packaged DNA from 14 different animals from the 6-NC-treated groups and four different rats from the control group. The cII gene in the mutant phages was amplified by PCR of the target region, for which Taq DNA polymerase (Promega, Madison, WI), a forward primer (positions -88 to -66), 5'-d(AAAAAGGGCATCAAATTAAACC)-3' and a reverse primer (positions 335 to 358), 5'-d(CCGAAGTTGAGTATTTTTGCTGT)-3' were employed. The cII gene length is 294 bp and the total PCR fragment length is 446 bp. The amplified cII gene was purified on a QIAquick PCR-purification column (Qiagen, Valencia, CA), and sequenced by Dr R.Haesevoets (University of Victoria, Canada). Mutations in the cII gene were detected by automated fluorescent DNA cycle sequencing on LI-COR 4200 DNA sequencers (Lincoln, NE). The gene was bi-directionally sequenced. The sequencing primers were: cII forward (-69 to -51) 5'-ACCACACCTATGGTGTATG-3'; cII reverse (331 to 312); 5'-GTCATAATGACTCCTGTTGA-3'. The mutant sequence with the wild-type sequence was compared with SeqMan v5.05 (DNAStar, Madison, WI).
6-NCDNA binding assay
We conducted a short-term bioassay using a single dose of 6-NC to determine: (i) whether 6-NCDNA adducts can be detected in the mammary gland in vivo in the transgenic rats, (ii) whether the structures of these adducts were identical to those observed in 6-NC-treated non-transgenic CD rats (22), (iii) whether the individual 6-NCDNA adducts persisted to varying degrees after carcinogen treatment and to characterize the relationship between structures of 6-NCDNA adducts and mutational specificities in the rat mammary gland. Eighteen female hybrid rats, 30 days of age, were divided into six groups of three rats each and treated orally with a single dose of 6-NC (50 µmol/rat) in 500 µl of trioctanoin, or with trioctanoin alone as vehicle control. Rats were housed and treated with 6-NC under conditions identical to those of the bioassay but to avoid toxicity due to the single treatment, the dose of 6-NC is equivalent to one-half the low dose (100 µmol/rat) used in the bioassay. Rats were killed 24, 48, 72, 168 or 336 h, respectively, after carcinogen treatment. Mammary tissue was excised and stored at -80°C until DNA was isolated and quantified by measuring the absorbance at 260 nm (22). The values of A260/A280 for all DNA samples were >1.8. The yields of mammary DNA ranged from 0.5 to 0.8 mg/g tissue. DNA (20 µg) was hydrolyzed to nucleoside-3'-monophosphate and 32P-postlabeled as described previously; synthetic standards were prepared as described by Chae et al. (22).
Statistical methods
Tumor incidence was compared among the groups using the
2 test, adjusted for multiple comparisons with the Bonferroni correction (31). Tumor multiplicity was compared among the groups using one-way analysis of variance (ANOVA), followed by Tukey's multiple comparisons procedure (32). Linear regression was used to test for doseresponse associations between adduct level and time points. Repeated measures ANOVA models were used to assess group differences in body weights measured over time (33).
| Results |
|---|
|
|
|---|
Mammary cancer induction by the oral administration of 6-NC to female (BBR x CD)F1 rats
The body weights of rats treated with 6-NC were virtually identical to those of control rats over the course of the experiment (data not shown). Survival was 100% in all groups. The incidence and multiplicity of palpable mammary tumor induced by 6-NC (high dose: 57%, 0.92; low dose: 52%, 0.80) were significantly higher (P < 0.01) than those in control rats (3%, 0.03). Following histopathological examination, both incidence and multiplicity of mammary adenocarcinomas were significantly elevated in the high-dose group (36%, 0.57, P < 0.01), while in the low-dose group (16%, 0.23, P < 0.1) they were not statistically significant from those in control rats (3%, 0.03) (Table I). On the other hand, the incidence and multiplicity of mammary fibroadenomas were significantly higher in both the high-dose (P < 0.05) and low-dose (P < 0.01) 6-NC-treatment groups compared with the control. Rats in the low- and high-dose 6-NC-treatment groups developed 3 and 7% adenomas, respectively; one rat (3%) in the low-dose group had a fibroma; none of these tumors was significantly different from controls.
|
Mutagenesis
Both the 100 and 200 µmol/rat of 6-NC led to highly significant increases (P < 0.05) in the MF in mammary tissue compared with spontaneous background levels (Figure 2). The low- and high-dose caused the MF to rise about two and three times over background levels, respectively. The difference between the MF induced at the low- and high-dose was not statistically significant. DNA from several 6-NC-induced mammary tumors was also assayed (results not shown) and no difference between MF in tumor and non-involved tissue was noted.
|
Mutational specificities
A significant difference in the mutational specificities was observed in mammary tissues from control and 6-NC-treated rats (Table II). Control mutants consisted primarily of GC
AT transitions, whereas 6-NC-induced mutants were comprised of several major classes of mutations; GC
TA, GC
CG, AT
CG and AT
TA mutations were the most prevalent. Tables III and IV show the positions, sequence context as well as the specific mutations in the cII gene (sequenced from -48 to 294) in DNA isolated from the mammary gland of 6-NC-treated and control rats, respectively. A high percentage of the GC
AT transitions in the control animals were located at CpG sites. This is typical for spontaneous mutagenesis in a number of organs in lacI and lacZ rodents in cII, lacI and lacZ genes (3437). In cases where identical mutations were observed, the mutants were obtained from different animals (Table III). Three identical mutations were also observed in mutants from the same animal. These presumably resulted from clonal expansion and only one of these was included in the results. As the mutations were spread among a number of different types there were too few mutants in each category to detect any differences between the high- and low-dose groups.
|
|
|
6-NCDNA binding
Figure 3B depicts five DNA adducts that were detected 24 h after 32P-postlabeling of the mammary tissue of rats treated with 6-NC; these adducts were not detected in the trioctanoin-treated control (Figure 3A). Adducts derived from simple nitroreduction: adduct 1, N-(dG-8-yl)-6-AC; adduct 2, N-(dI-8-yl)6-AC and adduct 3, 5-(dG-N2-yl)-6-AC and an adduct resulting from the combination of nitro-reduction and ring oxidation: adduct 4 (compare with Figure 1) were identified by comparison of their 32P-postlabeled autoradiograms with those of synthetic standards (22). One new adduct (adduct 5) was detected but not identified due to lack of a synthetic standard. Adduct levels decreased with time after carcinogen treatment (Figure 4). For each adduct, the test for linear adduct levels over time was significant at P < 0.01. Adducts 4 and 1 persisted for 1 and 2 weeks, respectively, whereas adducts 2 and 3 were apparently repaired after 3 days.
|
|
| Discussion |
|---|
|
|
|---|
Studies aimed at defining the relationship between carcinogenesis and mutagenesis, as well as those assessing the relationship between the types (structures) of carcinogenDNA adduct and mutation characteristics in the target organ in vivo, are scarce. Toward this end the present investigation reveals for the first time that, following oral administration, 6-NC is capable of inducing mammary tumors in the (BBR x CD)F1 rat. In this animal model, mutation frequency parallels carcinogenesis following 6-NC treatment. Of particular importance is that the mutational specificities, exhibited by several major types of mutations in the mammary tissues of rats treated with 6-NC, are consistent with the presence of several types of 6-NCDNA adducts in this target organ. Furthermore, the observation that certain types of mutations (e.g. GC
TA and AT
GC substitutions) in the mammary tissue of rats treated with 6-NC have also been reported in significant percentages among mutations in the p53 gene in human breast tumors (38) suggests a possible contribution of 6-NC to the etiology of this disease. However, to date, environmental agents responsible for genomic alterations in human breast cancer have not been clearly defined. Mammary cancer induction by 6-NC has been established in numerous investigations conducted previously in our laboratory in female CD rats (13,24). In the present investigation, our aim was to determine the relationship between mutagenesis and carcinogenesis in vivo. Prior to the initiation of this study, female CD rats that harbor the lacI gene were not available. Thus, to achieve our goal, commercially available male lacI homozygous BBR and female CD rats were mated to provide sufficient numbers of female (BBR x CD)F1 rats. The presence of the lambda/lacI shuttle vector (which also contains cII gene) was confirmed prior to the initiation of bioassays conducted in this study. The doses (100 and 200 µmol of 6-NC/rat) and the age (30 days) of (BBR x CD)F1 rats were identical to those employed in our previous studies with female CD rats (24). Mammary tumors were induced in the (BBR x CD)F1 rats at a somewhat lower incidence than in CD rats (24). From 30 to 55 days of age, rats are highly susceptible to mammary cancer induction by chemical carcinogens. Russo et al. (39) attributed the high incidence of mammary tumors, obtained upon treatment of virgin rats (3055 days of age) with chemical carcinogens such as 7,12-dimethylbenz[a]anthracene, to the existence of undifferentiated terminal end buds whose component cells exhibited a relatively high DNA labeling index.
It is intriguing that the administration of 6-NC to CD rats by intraperitoneal (i.p.) injection elicited adenomas and adenocarcinomas in the colon (40), while the oral administration led to mammary tumors (13,24, and the present study). Thus, organ specificity (mammary cancer versus colon cancer) is dependent on the route of administration (oral versus i.p.), among other factors, including the dose and age of the rat. The precise mechanism that accounts for such organ specificity remains unknown. We used oral administration in this study, because it is more relevant to the route of exposure of humans to environmental NO2-PAHs (11,41). The present investigation also provides an appropriate animal model system [male and female (BBR x CD)F1 rats] to study the relationship between carcinogenesis, mutagenesis (frequency and spectrum) and the type of DNA adducts in the colon of rats when treated i.p. with 6-NC in vivo (40).
This is the first report on mutation frequency induced by 6-NC in the mammary gland in vivo. Mutation frequencies were measured at termination (32 weeks) in normal, non-involved and tumor mammary tissues as confirmed by histological examination. The significant elevation in the MF by 6-NC at both dose levels over that in control rats appears to be in line with mammary cancer incidence. Literature data clearly demonstrate that carcinogen-induced mutation frequencies are elevated in tissues that are actual targets for carcinogenesis (4247) although certain non-target tissues may also be elevated. These tissues may be initiated, but do not develop tumors during the course of the carcinogenicity assays. Future studies will compare MFs in a non-target organ, such as liver or lymphocytes, with those in the target organ in order to determine factors that can account for susceptibility of the mammary gland to carcinogenesis by 6-NC; lymphocytes can also be utilized in molecular epidemiologic studies (48) as a surrogate for breast tissue. Furthermore, MFs induced by 6-NC at various time points during the progress of the carcinogenesis bioassay require future investigations.
The mutants in DNA from control breast tissue consisted mainly of GC
AT transitions. In a previous study aimed at the analysis of MF and mutation specificities in breast tissue of DMBA-treated and control lacI rats, the DNA from controls also revealed mainly GC
AT transitions (48). The origin of these spontaneous mutations remains uncertain, however, deamination of 5-methylcytosine at CpG sites to yield thymine (which then pairs with adenine) has been suggested (34). The types of mutations found in the mammary tissue of 6-NC-treated rats were different from those found in control animals that received trioctanoin only. The predominant mutations in breast tissue from 6-NC-treated rats were: AT
GC (31%), AT
TA (24%), GC
TA (17%), GC
CG (10%) and GC
AT (10%). The latter class of mutations may result from spontaneous mutants among those collected from the 6-NC-treated rats. The demonstration of several types of 6-NC-induced mutations is consistent with the observation of different DNA adducts (Figure 3) and with previous results (22) showing that metabolic activation of 6-NC can lead to active electrophiles that can react with dG and dA.
To provide insights into the relationship between the types of 6-NCDNA adducts in the rat mammary gland and mutational characteristics described above, we initiated a short-term study following a single oral administration of 6-NC to female (BBR x CD)F1 rats. On the basis of synthetic DNA adduct standards and using the 32P-postlabeling technique, we characterized several 6-NCDNA adducts; all of which have been established previously (22). These adducts were derived from simple nitroreduction namely N-(deoxyguanosin-8-yl)-6-aminochrysene [N-(dG-8-yl)-6-AC], N-(deoxyinosin-8-yl)-6-aminochrysene [N-(dI-8-yl)-6-AC] and 5-(deoxyguanosin-N2-yl)-6-aminochrysene [5-(dG-N2-yl)-6-AC], respectively, and from a combination of nitroreduction and ring oxidation (adduct 4); the latter adduct has not yet been fully characterized. The observation of several 6-NC adducts is consistent with the mutational specificities observed in the mammary tissue of 6-NC-treated rats in this study.
In summary, upon comparison with our previous studies that employed CD rats (24), (BBR x CD)F1 rats appear to be less susceptible to mammary cancer induction by 6-NC. The MF appears to follow the same dose response as mammary carcinogenesis induced by 6-NC. The observation of several 6-NCDNA adducts appears to be consistent with the mutational specificities, which exhibit several significant classes of mutations. This study also demonstrates that the mutational signature of 6-NC is different from that of spontaneous mutations and also different from that induced by the polyaromatic hydrocarbon benzo[a]pyrene (B[a]P) (38,49). Thus, the mutational signature of a NO2-PAH (e.g. 6-NC) is distinct from that of PAHs (e.g. B[a]P). An extension of this type of investigation to other carcinogens in target and non-target organs may prove relevant to molecular epidemiological studies aimed at exposure and risk assessment.
| Notes |
|---|
4 To whom correspondence should be addressed Email: kelbayou{at}ifcp.us
| Acknowledgments |
|---|
We thank the staff of the Research Animal Facility, Mrs Ilse Hoffmann (editorial assistance), Mrs Patricia Sellazzo for preparing the manuscript and Mrs Beth Appel for help with on-line submission. This work was supported by National Cancer Institute Grant CA 35519 and the Cancer Center Support Grant P30 CA-17613.
| References |
|---|
|
|
|---|
- Jemal,A., Murray,T., Samuels,A., Ghafuor,A., Ward,E. and Thun,M.J. (2003) Cancer statistics, 2003. CA Cancer J. Clin., 53, 526.
[Abstract/Free Full Text] - WHO The World Health Report. World Health Organization, Geneva, 1997.
- Wynder,E.L., Cohen,L.A., Muscat,J.E., Winters,B., Dwyer,J.T. and Blackburn,G. (1997) Breast cancer: weighing the evidence for a promoting role of dietary fat. J. Natl Cancer Inst., 89, 766775.
[Abstract/Free Full Text] - Lipworth,L. (1995) Epidemiology of breast cancer. Eur. J. Cancer Prev., 4, 730.[ISI][Medline]
- Doll,R. (1996) Nature and nurture: possibilities for cancer control (commentary). Carcinogenesis, 17, 177184.
[Abstract/Free Full Text] - Willett,W.C., Colditz,G.A. and Mueller,N. (1996) Strategies for minimizing cancer risk. Sci. Am., 8895.
- Cohen,L.A., Rose,D.P. and Wynder,E.L. (1993) A rationale for dietary intervention in postmenopausal breast cancer patients: an update. Nutr. Cancer, 19, 110.[ISI][Medline]
- El-Bayoumy,K., Johnson,B.E., Roy,A.K., Upadhyaya,P. and Partian,S.J. (1994) Biomonitoring of nitropolynuclear aromatic hydrocarbons via protein and DNA adducts. Health Effects Institute, Research Report Number 64, April.
- Fu,P.P. and Herreno-Saenz,D. (1999) Nitro-polycyclic aromatic hydrocarbons: a class of genotoxic environmental pollutants. Environ. Carcinogen. Ecotoxicol. Rev., C17, 143.
- Tokiwa,H., Sera,N., Horikawa,K., Nakanishi,Y. and Shigematu,N. (1993) The presence of mutagens/carcinogens in the excised lung and analysis of lung cancer induction. Carcinogenesis, 14, 19331938.
[Abstract/Free Full Text] - IARC Monographs on the Evaluation of Carcinogenic Risk to Humans (1989) Diesel and Gasoline Engine Exhausts and Some Nitroarenes. IARC Scientific Publications, IARC, Lyon, vol. 46, pp. 1458.
- Eighth Report on Carcinogens, National Toxicology Program (full report) (1998) US Department of Health and Human Services, Washington DC.
- El-Bayoumy,K., Rivenson,A., Upadhyaya,P., Chae,Y.-H. and Hecht,S.S. (1993) Induction of mammary cancer by 6-nitrochrysene in female CD rats. Cancer Res., 53, 37193722.
[Abstract/Free Full Text] - Chae,Y.-H., Yun,C.-H., Guengerich,F.P., Kadlubar,F.F. and El-Bayoumy,K. (1993) Roles of human hepatic and pulmonary cytochrome P450 enzymes in the metabolism of the environmental carcinogen 6-nitrochrysene. Cancer Res., 53, 20282034.
[Abstract/Free Full Text] - Boyiri,T., Leszczynska,J., Desai,D., Amin,S., Nixon,D.W. and El-Bayoumy,K. (2002) Metabolism and DNA binding of the environmental pollutant 6-nitrochrysene in primary culture of human breast cells and in cultured MCF-10A, MCF-7 and MDA-MB-435 s cell lines. Int. J. Cancer, 100, 395400.[CrossRef][ISI][Medline]
- Zwirner-Baier,I. and Neumann,H.-G. (1999) Genetic toxicology and environmental mutagenesis. Mutat. Res., 441, 135144.[ISI][Medline]
- Seidman,L.A., Moore,C.J. and Gould,M.N. (1988) 32P-Postlabelling analysis of DNA adducts in human and rat mammary epithelial cells. Carcinogenesis, 9, 10711072.
[Abstract/Free Full Text] - Perera,F.P., Estabrook,A., Hewer,A., Channing,K., Rundle,A., Mooney,L.A., Whyatt,R. and Phillips,D.H. (1995) Carcinogen-DNA adducts in human breast tissue. Cancer Epidemiol. Biomarkers Prev., 4, 233238.[Abstract]
- Li,D., Wang,M., Dhingra,K. and Hittleman,W.N. (1996) Aromatic DNA adducts in adjacent tissues of breast cancer patients: clues to breast cancer etiology. Cancer Res., 56, 287293.
[Abstract/Free Full Text] - Pfau,W., Stone,E.M., Brockstedt,U., Carmichael,P.L., Marquardt,H. and Phillips,D.H. (1998) DNA adducts in human breast tissue: association with N-acetyltransferase-2 (NAT2) and NAT1 genotypes. Cancer Epidemiol. Biomarkers Prev., 7, 10191025.[Abstract]
- Wang,M., Dhingra,K., Hittleman,W.N., Liehr,J.G., de Andrade,M. and Li,D. (1996) Lipid peroxidation-induced putative malondialdehyde-DNA adducts in human breast tissues. Cancer Epidemiol. Biomarkers Prev., 5, 705710.
[Abstract/Free Full Text] - Chae,Y.-H., Delclos,K.B., Blaydes,B. and El-Bayoumy,K. (1996) Metabolism and DNA binding of the environmental colon carcinogen 6-nitrochrysene in rats. Cancer Res., 56, 20522058.
[Abstract/Free Full Text] - Neumann,M.S. and Cathcart,J.A. (1940) The orientation of chrysene. J. Org. Chem., 5, 618622.[CrossRef][ISI]
- El-Bayoumy,K., Desai,D., Boyiri,T., Rosa,J., Krzeminki,J., Sharma,A.K., Pittman,B. and Amin,S. (2002) Comparative tumorigenicity of the environmental pollutant 6-nitrochrysene and its metabolites in the rat mammary gland. Chem. Res. Toxicol., 15, 972978.[CrossRef][ISI][Medline]
- Russo,A., Grasso,G., Sanfilippo,G. and Giannone,G. (1976) [Criteria for applying target biopsy and histological features in the diagnosis of gastric cancer in situ (author's transl)]. Tumori., 62, 3946.[ISI][Medline]
- Jakubczak,J.L., Merlino,G., French,J.E., Muller,W.J., Paul,B., Adhya,S. and Garges,S. (1996) Analysis of genetic instability during mammary tumor progression using a novel selection-based assay for in vivo mutations in a bacteriophage transgene target. Proc. Natl Acad. Sci. USA, 93, 90739078.
[Abstract/Free Full Text] - Zimmer,D.M., Harbach,P.R., Mattes,W.B. and Aaron,C.S. (1999) Comparison of mutant frequencies at the transgenic lambda lacl and cll/cl loci in control and ENU-treated Big Blue mice. Environ. Mol. Mutagen., 33, 249256.[CrossRef][ISI][Medline]
- Gollapudi,B.B., Jackson,K.M. and Stott,W.T. (1999) Hepatic lacl and cll mutation in transgenic (LIZ) rats treated with dimethylnitrosamine. Mutat. Res., 419, 131135.
- Davies,R., Gant,T.W., Smith,L.L. and Styles,J.A. (1999) Tamoxifen induces G,C
T,A mutations in the cll gene in the liver of lambda/lacI transgenic rats but not at 5'-CpG-3' dinucleotide sequences as found in the lacI transgene. Carcinogenesis, 20, 13511356.[Abstract/Free Full Text] - Swiger,R.R., Cosentino,L., Shima,N., Bielas,J.H., Cruz-Munoz,W. and Heddle,J.A. (1999) The cll locus in the MutaTM Mouse System. Environ. Mol. Mutagen., 34, 201207.[CrossRef][ISI][Medline]
- Hochberg,Y. and Tamhane,A.C. (1987) Multiple Comparisons Procedures. John Wiley & Sons, New York, pp. 35.
- Miller,R.G. (1981) Simultaneous Statistical Inference. Springer-Verlag, New York, 2nd Edn, p. 37.
- Fleiss,J.L. (1986) The Design and Analysis of Clinical Experiments. Wiley & Sons, New York, pp. 220240.
- Zhang,S., Glickman,B.W. and de Boer,J.G. (2001) Spontaneous mutation of the lacI transgene in rodents: absence of species, strain and insertion-site influence. Environ. Mol. Mutagen., 37, 141146.[CrossRef][ISI][Medline]
- Shane,B.S., Smith-Dunn,D.L., de Boer,J.G., Glickman,B.W. and Cunningham,M.L. (2000) Mutant frequencies and mutation spectra of dimethylnitrosamine (DMN) at the lacI and cII loci in the livers of Big Blue transgenic mice. Mutat. Res., 452, 197210.[ISI][Medline]
- Stuart,G.R., Thorleifson,E., Okochi,E., de Boer,J.G., Ushijima,T., Nagao,M. and Glickman,B.W. (2000) Interpretation of mutational spectra from different genes: analyses of PhIP-induced mutational specificity in the lacI and cII transgenes from colon of Big Blue rats. Mutat. Res., 452, 101121.[ISI][Medline]
- Ono,T., Ikehata,H., Nakamura,S., Saito,Y., Hosoi,Y., Takai,Y., Yamada,S., Onodera,J. and Yamamoto,K. (2000) Age-associated increase of spontaneous mutant frequency and molecular nature of mutation in newborn and old lacZ-transgenic mouse. Mutat. Res., 447, 165177.[ISI][Medline]
- Greenblatt,M.S., Bennett,W.P., Hollstein,M. and Harris,C.C. (1994) Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res., 54, 48554878.
[Free Full Text] - Russo,J., Tay,L.K. and Russo,I.H. (1982) Differentiation of the mammary gland and susceptibility to carcinogenesis. Breast Cancer Res. Treat., 2, 573.[CrossRef][Medline]
- Imaida,K., Uneyama,C., Ogasawara,H., Hayashi,S., Fukuhara,K., Miyata,N. and Takahashi,M. (1992) Induction of colon adenocarcinomas in CD rats and lung adenomas in ICR mice by 6-nitrochrysene: comparison of carcinogenicity and aryl hydrocarbon hydroxylase induction in the target organs of each species. Cancer Res., 52, 15421545.
[Abstract/Free Full Text] - El-Bayoumy,K. (1992) Environmental carcinogens that may be involved in human breast cancer etiology. Chem. Res. Toxicol., 5, 585590.[CrossRef][ISI][Medline]
- Okochi,E., Watanabe,N., Shimade,U., Takahashi,S., Wakazono,K., Shirai,T., Sugimura,T., Nagao,M. and Ushijima,T. (1999) Preferential induction of guanine deletion at 5'-GGGA-3 in rat mammary glands by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. Carcinogenesis, 20, 19331938.
[Abstract/Free Full Text] - Okonogi,H., Stuart,G.R., Okochi,E., Ushijima,T., Sugimura,T., Glickman,B.W. and Nagao,M. (1997) Effects of gender and species on spectra of mutation induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine in the lacI transgene. Mutat. Res., 395, 9399.[ISI][Medline]
- Dycaico,M.J., Stuart,G.R., Tobal,G.M., deBoer,J.G., Glickman,B.W. and Provost,G.S. (1996) Species-specific differences in hepatic mutant frequency and mutational spectrum among lambda/lacI transgenic rats and mice following exposure to aflatoxin, B1. Carcinogenesis, 17, 23472356.
[Abstract/Free Full Text] - Dycaico,M.J., Provost,G.S., Kretz,P.L., Ransom,S.L., Moores,J.C. and Short,J.M. (1994) The use of shuttle vectors for mutation analysis in transgenic mice and rats. Mutat. Res., 307, 461468.[ISI][Medline]
- Stuart,G.R., Holcroft,J., de Boer,J.G. and Glickman,B.W. (2000) Prostate mutations in rats induced by the suspected human carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. Cancer Res., 60, 266268.
[Abstract/Free Full Text] - Lefevre,P.A., Tinwell,H. and Ashby,J. (1997) Mutagenicity of the potent rat hepatocarcinogen 6BT to the liver of transgenic (lacI) rats: consideration of a reduced mutation assay protocol. Mutagenesis, 12, 4547.
[Abstract/Free Full Text] - Manjanatha,M.G., Shelton,S.D., Culp,S.J., Blankenship,L.R. and Casciano,D.A. (2000) DNA adduct formation and molecular analysis of in vivo lacI mutations in the mammary tissue of Big Blue rats treated with 7,12-dimethylbenz(a)anthracene. Carcinogenesis, 21, 265273.
[Abstract/Free Full Text] - Ruggeri,B., DiRado,M., Zhang,S.Y., Bauer,B., Goodrow,T. and Klein-Szanto,A.J. (1993) Benzo[a]pyrene-induced murine skin tumors exhibit frequent and characteristic G to T mutations in the p53 gene. Proc. Natl Acad. Sci. USA, 90, 10131017.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. B. Guttenplan, Z.-l. Zhao, W. Kosinska, R. G. Norman, J. Krzeminski, Y.-W. Sun, S. Amin, and K. El-Bayoumy Comparative mutational profiles of the environmental mammary carcinogen, 6-nitrochrysene and its metabolites in a lacI mammary epithelial cell line Carcinogenesis, November 1, 2007; 28(11): 2391 - 2397. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




