Carcinogenesis Advance Access originally published online on February 26, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis, Vol. 25, No. 7, 1119-1128,
July 2004
Carcinogenesis vol.25 no.7 © Oxford University Press 2004; all rights reserved.
ARTICLE |
Indole-3-carbinol stimulates transcription of the interferon gamma receptor 1 gene and augments interferon responsiveness in human breast cancer cells
1 Department of Molecular and Cell Biology and The Cancer Research Laboratory, 2 Department of Nutritional Sciences and Toxicology, University of California at Berkeley, Berkeley, CA 94720-3200, USA, 3 Incyte Genomics, Palo Alto, California, USA and 4 Laboratory of Molecular Biology, Medical Research Center, Kochi Medical School, Okoh, Nankoku, Kochi 783-8505, Japan
5 Present address: Agilent Technologies Inc., 3500 Deer Creek, Palo Alto, CA 94304, USA
6 To whom correspondence should be addressed Email: glfire{at}uclink4.berkeley.edu
| Abstract |
|---|
|
|
|---|
Indole-3-carbinol (I3C), a naturally occurring compound of Brassica vegetables, has promising anticancer properties and activates an anti-proliferative pathway that induces a G1 cell cycle arrest of human breast cancer cells. A microarray analysis of I3C treated versus untreated MCF-7 breast cancer cells revealed that I3C increased expression of the interferon gamma receptor 1 (IFN
R1). Western blot and RTPCR analysis demonstrated that I3C strongly and rapidly stimulated IFN
R1 gene expression. Transfection of a series of 5' deletion constructs of the IFN
R1 reporter plasmids revealed that I3C significantly stimulates the promoter activity of the IFN
R1 and uncovered an I3C-responsive region between 540 and 240 bp of the IFN
R1 promoter. I3C stimulation of the IFN
R1 expression suggests that indole treatment should enhance IFN
responsiveness in breast cancer cells. A combination of I3C and IFN
synergistically activated STAT1 proteins by increasing phosphorylation at the Tyr-701 site. In addition, I3C and IFN
together more effectively induced a G1 cell cycle arrest and stimulated expression of the p21Waf1/Cip1 cell cycle inhibitor, compared with the effects of either agent alone. Our results suggest that one mechanism by which I3C mediates these anticancer effects is by stimulating expression of the IFN
R1 and augmenting the IFN
response in MCF-7 human breast cancer cells.
Abbreviations: IFN
R1, interferon gamma receptor 1; I3C, indole-3-carbinol
| Introduction |
|---|
|
|
|---|
Breast cancer is one of the leading causes of death among females in North America (1). It is a complex disease in which several distinct classes of tumors can be produced that differs in their proliferative responses to hormonal and environmental signals. Although the exact mechanisms underlying the origin and the evolution of breast cancer are poorly understood, it is generally accepted that during the initial stages of tumor development, estrogens play a stimulatory role. Approximately one-third of breast cancers rely on estrogen for their growth, and for these patients, anti-estrogen therapy with the non-steroidal anti-estrogens tamoxifen and/or raloxifen, which will inhibit or slow the growth of estrogen-dependent tumors, remains a major option for treatment (25). Unfortunately, after prolonged treatment, estrogen-responsive breast cancers eventually become resistant to the inhibitory effects of anti-estrogens (6). For the nearly two-thirds of human breast tumors that are not responsive to anti-estrogens, the best currently available options for treatment are surgical removal of the tumors, general chemotherapy and/or radiation therapy. Thus, a critical problem in controlling breast cancer is the need to develop therapeutic strategies that would effectively target a wide variety of both estrogen-responsive and non-responsive mammary tumors.
One potential source of new classes of chemotherapeutic agents to control breast cancer with reduced side effects is compounds found in the diet. Considerable epidemiological evidence shows that an increased consumption of phytochemicals from whole grains, vegetables and fruits is directly associated with a decreased risk for breast cancer, and reduced mammary tumor incidence in experimental animals (713). Moreover, differences in the diet are thought to contribute to the low incidence rates of breast cancer found in Asian countries such as Japan, China, Indonesia, Korea and Singapore, and the high incidence rates (410-fold higher) in the USA and Canada (7). These studies implicate the existence of specific biologically active compounds from this class of dietary plants that represent a largely untapped source of potentially potent chemotherapeutic molecules. One such phytochemical is indole-3-carbinol (I3C), a naturally occurring component found in the family of Brassica vegetables, such as cabbage, broccoli and Brussels sprouts (11,14,15).
I3C has promising chemopreventive properties (16), and markedly reduces the incidence of spontaneous and carcinogen-induced tumors in rodents with low levels of toxicity (17,18). Studies by our group (1921) and by others (2225) have shown that I3C has both anti-proliferative and apoptotic effects on cultured human breast cancer cells that generally depend upon the concentration of this dietary indole used in the assays. In one study, I3C was shown to alter the level of BRCA1 gene expression, although the cellular significance of this observation remains unknown (26). As reported previously, we have discovered that the direct exposure of human breast cancer cells to I3C activates a novel anti-proliferative pathway that induces a G1 cell cycle arrest accompanied by the selective and rapid down-regulation of CDK6 gene expression and strong stimulation of p21Waf1/Cip1 gene expression (1921,27). I3C was found to regulate CDK6 promoter activity by altering Sp1-promoter interactions (21,27). I3C mediated G1 cell cycle arrest and gene expression changes occur through an estrogen receptor-independent pathway (19,20). Not all of the effects of I3C take place at the transcriptional level since treatment with this indole also inhibits CDK2-specific enzymatic activity without any effects on CDK2 protein expression (19,20). I3C treatment was also shown to alter the activity of several signal transduction components including Akt/PKB (28,29). In estrogen-responsive breast cancer cells, I3C synergizes with the anti-proliferative effects of tamoxifen, an anti-estrogen currently used in breast cancer therapies (20), suggesting that I3C acts through a distinct mechanism.
To further examine the cellular effects of I3C in human breast cancer cells, a microarray analysis of I3C treated and untreated MCF-7 breast cancer cells was carried out in order to identify additional molecular targets of I3C. This analysis revealed that I3C increases expression of the interferon gamma receptor (IFN
R1). We show that I3C stimulates the transcription of the IFN
R1 gene by regulating promoter activity, and augments the IFN response in human breast cancer cells. These results implicate the I3C control of the IFN
receptor-dependent pathway as playing a key role in the anti-breast cancer properties of dietary indoles.
| Materials and methods |
|---|
|
|
|---|
Cell culture
MCF-7 human breast cancer cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 50 U/ml penicillin/streptomycin, 2 mM L-glutamine and 10 µg/ml insulin. Cells were propagated in a 37°C humidified chamber containing 5% CO2 and the medium was changed every 48 h.
Microarray analysis
MCF-7 cells were treated with 200 µM I3C or DMSO as the vector control for 48 h. Poly-A-RNA was isolated by two cycles of purification on oligo-dT cellulose. Labeled cDNA probes were prepared using fluorescent cyanine 3 and cyanine 5 dyes for the treated and control samples, respectively, and hybridized simultaneously to microarrays (Incyte Genomics, Palo Alto, CA) of 960 selected cDNAs representing human genes involved in cell cycling, apoptosis, signal transduction, motility, adhesion and angiogenesis. Differential expression was measured by the ratio of the fluorescence intensity at the wavelengths corresponding to the two probes. The samples were spiked with known concentrations of various non-human cDNA to serve as positive controls and to correct for variations in hybridization efficiency.
Western blot analysis
MCF-7 cells were treated with DMSO or 200 µM I3C for 24, 48 and 72 h. After the indicated time points, cells were harvested in RIPA buffer (150 mM NaCl, 0.5% deoxycholate, 0.1% Nonidet P-40, 0.1% SDS, 50 mM Tris) containing protease and phosphatase inhibitors (50 µg/ml PMSF, 10 µg/ml aprotinin, 5 µg/ml leupeptin, 0.1 µg/ml NaF, 1 mM DTT, 0.1 mM sodium orthovanadate and 0.1 mM ß-glycerophosphate). Equal amounts of total cellular protein were mixed with loading buffer (25% glycerol, 0.075% SDS, 1.25 ml/100 ml 2-mercaptoethanol, 10% bromophenol blue, 3.13% stacking gel buffer) and fractionated by electrophoresis on 10% polyacrylamide, 0.1% SDS resolving gels. Rainbow marker (Amersham Pharmacia Biotech, Piscataway, NJ) was used as the molecular weight standards. Proteins were electrically transferred to PVDF membranes and blocked for 2 h at 25°C with 5% non-fat dry milk in wash buffer (10 mM TrisHCl, pH 8.0, 150 mM NaCl, 0.05% Tween-20). Blots were subsequently incubated with rabbit anti-IFN
R1 antibody (1:1000) or mouse anti-p21 antibody (1:200) for 18 h at 4°C. Immunoreactive proteins were detected after 1 h incubation with horseradish peroxidase-conjugated goat-anti rabbit IgG (1:3000) or with horseradish peroxidase-conjugated goat-anti mouse IgG (1:3000) at 25°C. The bands corresponding to IFN
R1 were visualized using ECL reagent (Perkin Elmer Life Sciences, Boston, MA) and exposure to BioMax MR film (Kodak, Rochester, NY). Equal loading was ascertained by Ponceau S staining of blotted membranes, and also by probing the membranes with mouse anti-tubulin antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, 1:10 000). For detection of p-STAT1 by western blot analysis, cells were grown and treated in serum-free medium with or without 200 µM I3C for 48 h. Before harvesting, the cells were pulsed for 0, 15, 30, 60 and 90 min with 100 ng/ml IFN
. The lysates were resolved by 8% SDSPAGE and processed for western blot as described above, using the p-STAT1 antibody (Cell Signaling, Beverly, MA, 1:1000). STAT1 antibody (1:1000) was used as a loading control.
RNA extraction and RTPCR
After treatment with DMSO, 200 µM I3C and 1 µg/ml actinomycin D, cells were lysed by the addition of Tri-reagent (Molecular Research Center, Cincinnati, OH) and chloroform was used for phase separation. The aqueous upper phase was collected and total RNA was precipitated by isopropanol, washed with 75% ethanol, and dissolved in DEPC treated water. Ten micrograms of total RNA was used to synthesize cDNA using a 15 mer oligo-dT primer (Promega, Madison, WI) and reverse transcriptase. For PCR amplification, 5 µl of the cDNA reaction product was used with 20 pM IFN
R1-specific primers (Upper-5' CCAGGCATGCATACCGAAGACA 3', Lower-5' GCGATGCTGCCAGGTTCAGA 3') and amplified for 24 cycles (95°C, 1 min/55°C, 2.5 min/72°C, 2 min. Primers for GAPDH were amplified under similar conditions and served as the loading control. The PCR products were separated on a 1.5% agarose gel containing ethidium bromide and photographed under UV. For p21 transcript detection, MCF-7 cells were treated with DMSO, 200 µM I3C, 100 ng/ml IFN
and a combination of I3C and IFN
. PCR using primers specific to p21 (Upper-5' CCC GTG AGC GAT GGA ACT TC 3', Lower-5' CTG AGA GTC TCC AGG TCC AC 3') was carried out as described above.
Transfection and luciferase assay
The luciferase reporter plasmids containing the IFN
R1 promoter and the 5' deletion constructs were transiently transfected in MCF-7 cells using Fugene transfection reagent (Gibco, Carlsbad, CA). Fugene reagent (3 µl) and 1 µg DNA were mixed in plain DMEM medium, added to cells and incubated for 18 h at 37°C before treatment commenced. After treatment with DMSO, 200 µM I3C and 1 µg/ml actinomycin D for 24 h, cells were harvested by washing in PBS and lysed in 1x Reporter Lysis Buffer (Promega). Ten microliters of the cell lysate was added to 12 x 75 mm cuvettes and subsequently loaded into a luminometer (LUMAT LB 9507, EG&G Berthold, Germany). 100 µl of luciferase substrate [20 mM Tricine, 1.07 mM (MgCO3)4Mg(OH)25H2O, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT, 270 µM coenzyme A, 470 µM D-luciferin sodium salt, 530 µM ATP disodium salt, pH 7.8] was injected automatically into each sample and luminescence was measured in relative light units. The luciferase specific activity was expressed as an average of relative light units produced per microgram of protein present in the corresponding cell lysates, as measured by the Lowry Assay (Bio-Rad, Hercules, CA).
Flow cytometry
MCF-7 cells were plated at 40 000 cells/well of 6-well tissue culture dishes and treated for 24, 48, 72, 96, 120, 144 and 168 h in complete medium. I3C was added to a final concentration of 200 µM and IFN
to a final concentration of 100 ng/ml. Medium was changed every 24 h. Following treatment, cells were washed with phosphate-buffered saline and hypotonically lysed in 1 ml of DNA staining solution (0.5 mg/ml propidium iodide, 0.1% sodium citrate, 0.05% Triton X-100). Cell debris was removed by filtration through 60-mm nylon mesh (Sefar America, Kansas City, MO). Nuclear-emitted fluorescence with wavelengths of 585 nm was measured with a Coulter, XL MCL instrument (Miami, FL). 10 000 nuclei were analyzed from each sample at a rate of 300500 nuclei/s. The percentages of cells within the G1, S and G2/M phases of the cell cycle were determined by analysis with the WINCYCLE software (Phoenix Flow Systems, CA) in the Cancer Research Laboratory Flow Cytometry Facility of the University of California at Berkeley.
Quantification of autoradiography
Autoradiographic exposures were scanned with a Microtek ScanMaker 4 scanner, and band intensities were quantified using the NIH Image program. Autoradiographs from a minimum of three independent experiments were scanned per time point. The statistical differences between groups were determined using ANOVA and Student's t-test. The levels of significance are noted at level of P < 0.05. The results are expressed as means ± SE for at least three replicate determinations for each assay.
| Results |
|---|
|
|
|---|
I3C stimulates expression of IFN
R1 transcripts and protein in MCF-7 human breast cancer cellsIdentification of I3C regulated gene expression changes between 48 h I3C treated and untreated human MCF-7 breast cancer cells was initially accomplished by cDNA microarrays using Incyte gene chips containing 960 selected cDNAs representing human genes involved in cell cycling, apoptosis, signal transduction, motility, adhesion and angiogenesis. Expression profiling analysis revealed that I3C induced or repressed expression by at least 1.52.0-fold of several genes involved in signaling by the IFN family of cytokines. In particular, I3C up-regulated expression of IFN
R1, IFN receptor 2 and IFN-induced p56 whereas, this indole down-regulated expression of IFNß, IFN-related developmental regulator-2 and 2'-5'-oligoadenylate synthetase-2. The I3C stimulation of IFN
R1 expression was the most significant of all of the gene array results, and therefore examined in more detail. To confirm the microarray results and examine in more depth the I3C regulation of IFN
R1 expression, MCF-7 cells were treated with or without 200 µM I3C for 6 h in the presence or absence of actinomycin D, an inhibitor of transcription. Expression of IFN
R1 transcripts was determined by RTPCR. This optimal dose of I3C had shown previously significant growth-inhibitory effects in MCF-7 cells without any effects on cell viability (21). Oligonucleotide primers specific to the coding region of the IFN
R1 were used to detect the corresponding transcripts, whereas, GAPDH oligonucleotide primers were used as a loading control. As shown in Figure 1A, I3C strongly and rapidly induced IFN
R1 transcripts by a process that is rapid and dependent upon de novo RNA synthesis. The relatively short 6 h time point is well before steady state increase in transcript levels (data not shown). Actinomycin D treatment lowered the basal levels of IFN
R1 transcripts under conditions in which the level of GAPDH transcripts remained unaltered, suggesting that IFN
R1 transcripts have a relatively short half-life. These results are consistent with the I3C signaling pathway inducing transcription of the IFN
R1 gene, as determined by microarray analysis of I3C-treated versus untreated MCF-7 cells.
|
Western blot analysis of MCF-7 cells treated throughout a 72 h time course with or without 200 µM I3C revealed that the I3C stimulation of IFN
R1 transcripts results in a corresponding increase in the level of IFN
R1 protein (Figure 1B). A significant increase in IFN
R1 protein was observed after 24 h treatment with I3C, and by 72 h of indole treatment IFN
R1 protein was induced
7-fold compared with DMSO-treated control cells. Under these conditions, there was virtually no change in tubulin production, which was used as the loading control.
I3C activation of the IFN
R1-promoter activity and detection of an I3C-responsive region within the IFN
R1 gene promoter
The cloning and characterization of the IFN
R1 promoter has been reported previously (30). A series of IFN
R1 promoter-luciferase reporter plasmid constructs were used to determine whether or not the I3C stimulation of IFN
R1 transcripts is mediated by activation of the IFN
R1 gene promoter, and to functionally identify the cis-acting region of the IFN
R1 promoter that confers I3C transcriptional responsiveness. Serial 5' deletions of the promoter were utilized (30) that start at 840, 540, 240, 160 and 128 bp of the IFN
R1 promoter, and which each end at +28 bp of IFN
R1 gene. Each of the IFN
R1-luciferase reporter plasmids were transiently transfected into MCF-7 cells, and cells were then treated with or without 200 µM I3C for 24 h. As illustrated in Figure 2, I3C up regulated the 840 bp IFN
R1-luciferase reporter plasmid, which implicates that I3C treatment stimulates IFN
R1 promoter activity. Treatment of the transfected cells with actinomycin D inhibited the I3C mediated activation of the IFN
R1 promoter (data not shown), which provided a control for the baseline transcriptional activity of the IFN
R1 promoter.
|
Transient transfection of the other IFN
R1 promoter-luciferase reporter plasmids revealed that the constructs containing the 840 and 540 bp promoter deletions remained I3C responsive (Figure 2). In contrast, activity of the reporter plasmids containing the 240, 160 and the 128 bp IFN
R1 promoter fragments failed to be stimulated by I3C treatment. These results suggest that an I3C-responsive region can be localized within the 300 bp sequence located within the 540 to 240 bp region of the IFN
R1 promoter. Theoretical analysis of consensus transcription factor-binding sites by the TRANSFAC database search with MatInspector (31) revealed that the 300 bp I3C-responsive region of the IFN
R1 promoter contains DNA elements for the C/EBP binding site (324342), NF
B (329343), STAT (365383), Ets family member FLI (389405), CCAAT/enhancer binding protein beta (504522) and the IFN regulatory factor 3 (523537) transcription factors (Figure 2, lower panel). Interestingly, the presence of an Ets family member binding site, located between 389 and 405 bp, is generally consistent with our previous characterization of the transcriptional response to I3C in human breast cancer cells (21).
Pre-treatment with I3C increases IFN
-induced phosphorylation of STAT1 at Tyr-701 without affecting the production of STAT1 protein levels
The I3C stimulation of IFN
receptor expression predicts that I3C treatment should enhance IFN
responsiveness in MCF-7 breast cancer cells. An early and critical IFN
R1 signaling event is the IFN mediated phosphorylation of STAT1 (signaling transducer and activator of transcription 1, consisting of Stat1
, a 91 kDa isoform and Stat1ß, an 84 kDa splice variant) by the receptor-associated JAK kinases, which recruit and phosphorylate the STAT proteins (32). Phosphorylated STAT1 dimerizes, translocates to the nucleus and leads to transcription of specific target genes (33,34). Thus, phosphorylation of STAT1 is essential for induction of IFN
-mediated biological response. Immunoblotting experiments with phospho-specific antibodies that recognize Tyr-701 phospho-STAT1 were carried out to examine the effect of I3C pre-treatment on phosphorylation at this residue. MCF-7 cells were pre-incubated with 200 µM I3C for 48 h in serum-free medium and then stimulated with 100 ng/ml IFN
for 0, 15, 30, 60 and 90 min. Under these 48 h pre-treatment conditions, I3C has induced IFN
R1 gene productions to near maximal levels. The dose of IFN
was shown in an earlier study to effectively suppress the growth of MCF-7 cells (35). Cell lysates were fractionated and immunoblotted with either the phospho-specific antibodies or with anti-STAT1 antibodies to detect total STAT-1 protein. STAT1
or STATß was not phosphorylated when the cells were not stimulated with IFN
(Figure 3, 0' lanes), even when they were treated with I3C. Interestingly, the IFN-mediated phosphorylation on Tyr-701 of STAT1ß was significantly increased compared with STAT1
in MCF-7 cells that were pre-treated with I3C and subsequently stimulated by IFN
, compared with cells treated only with IFN
(Figure 3, 15', 30', 60' and 90' versus + lanes). This observation indicates that although I3C alone is unable to phosphorylate STAT1 at Tyr-701 residue, I3C pre-treatment significantly increases the magnitude of IFN
-induced phosphorylation of STAT1. In contrast to the phosphorylated form of STAT1, lysates that were immunoblotted with an anti-STAT1 antibody did not show any significant differences in total STAT1 protein levels in I3C-pre-treated or untreated cells (Figure 3, lower panel).
|
The cooperative anti-proliferative effects of I3C and IFN
in MCF-7 breast cancer cellsTo test whether the anti-proliferative effects of I3C and IFN
are enhanced when the breast cancer cells are exposed to both stimuli. MCF-7 cells were plated in 6-well tissue culture plates and treated daily with DMSO, 200 µM I3C, 100 ng/ml IFN
, or a combination of I3C and IFN
for up to 7 days. The cell culture media was changed every 24 h. At the indicated time points, the cells were hypotonically lysed in the presence of propidium iodide to stain the nuclear DNA. Flow cytometry profiles of nuclear DNA content revealed a significant time-dependent G1 cell cycle arrest of cells treated with either I3C or IFN
alone. As shown in Figure 4 (left panel), typical of growing MCF-7 cells, in the presence of DMSO 55.6% of cells displayed a G1 DNA content, 33.6% of cells were in S phase, while 10.8% of cells contained a G2/M DNA content. By 96 h treatment with either I3C or IFN
, the growth-arrested cells were shifted to a significantly higher G1 DNA content and cell number and reduced S phase DNA content with a decrease in cell number. A combination of I3C and IFN
resulted in a significant enhancement of the number of breast cancer cells arrested in the G1 phase of the cell cycle (93.2%), and loss of S phase cells (2.2%), accompanied by minor changes in G2/M DNA content. The graph in the right panel in Figure 4 shows the overall time course of G1 phase cells observed in breast cancer cells treated with combinations of I3C and IFN
. The results appear to be additive and not synergistic, suggesting that I3C and IFN
act by different mechanisms to block the cell cycle of MCF-7 cells.
|
Synergistic effects of I3C and IFN
on expression of the p21 CDK inhibitory moleculeI3C regulates the expression of CDK6 and strongly inhibits CDK2 enzymatic activity (1921). Thus, one potential mechanism by which I3C and IFN
cooperatively induce a G1 cell cycle arrest is the corresponding regulation of G1-related cell cycle components. Here we show that co-treatment of I3C and IFN
leads to an additive effect on the up regulation of p21 protein and transcript levels. Western blots revealed relatively small increases in p21 protein, in cells individually treated with either I3C or IFN
, whereas exposure to both stimuli caused a stronger induction of p21 protein (Figure 5, upper panel). Tubulin protein levels, which were used as the loading control, remained unaltered under each tested condition. RTPCR analysis revealed that the cooperative effects of I3C and IFN
on p21 production could be accounted for by corresponding changes in p21 transcript levels (Figure 5, lower panel). Parallel amplification of GAPDH transcripts was used as a loading control for this experiment.
|
| Discussion |
|---|
|
|
|---|
I3C is a promising chemotherapeutic agent for treatment of breast cancer because of its potent growth-inhibitory effects in both estrogen receptor positive and negative breast cancer cell lines (19,20,27). It has been suggested that I3C treatment may activate or repress multiple signal transduction pathways (27,28). A microarray analysis of I3C treated versus untreated breast cancer cells was used to uncover additional cellular anti-proliferative pathways that are activated by I3C. In this study, we demonstrate that in MCF-7 breast cancer cells, the IFN
R1 was up regulated as a result of I3C treatment. In addition to up regulating the expression of the IFN
R1 and augmenting the anti-proliferative effects of IFN
, I3C by itself has potent cell cycle effects (19,20). IFN
has been known to exhibit profound growth-inhibitory and apoptotic effects in human breast cancer (36), suggesting that IFN
-activated pathways may play a key role in the anti-proliferative response to I3C. Our results have established that the anti-proliferative cascades initiated by I3C and IFN
can cooperate to induce more stringent growth suppression in breast cancer cells than either agent alone. We propose that combined I3C and IFN
-activated responses are mediated by converging signal transduction pathways, in which I3C enhances the IFN
signaling pathway and renders the cells more responsive to the anti-proliferative effects of IFN
. In a complementary pathway, I3C induces a G1 cell cycle arrest by regulating cell cycle gene expression and function (Figure 6). I3C treatment can lead to apoptosis (37,38) and in human malignant T cells, drug-induced apoptosis is characterized by up regulation of the IFN
R1 expression (39). Hence, over-expression of the IFN
R1 could potentially be used to clinical advantage for treatment of breast cancer in humans through combination of the chemotherapeutic drug I3C, inhibiting cell proliferation and up-modulating IFN
R1 expression, followed by IFN
administration.
|
IFNs are potent anti-proliferative cytokines that play an important role in immune response, apoptosis and antitumor activity (40). IFN
is a product of activated T lymphocytes (41), and is used to treat various cancers (42). IFN
can mediate potent anti-proliferative actions in epithelial tumors (43) and in cultured human cancer cells (44,45) including human breast cancer cells (36). At the cellular level, IFN
causes cell growth arrest at the G1 phase of the cell cycle (46,48). The biological activity of IFN
is mediated via specific cell surface transmembrane receptors, which are internalized and degraded after binding to the ligand (42). The vast majority of human tumor cells derived from various tissue origins were found to express specific membrane receptors for IFN
(4953). The contrasting ability of IFN
to either stimulate the proliferation of malignant T cells or to induce their apoptosis, is determined by the low and high intensity of the IFN
receptor expression, respectively (39). In addition, chemical carcinogen-induced tumor development increases in IFN
R deficient mice (54) or IFN
R knockout mice (33), emphasizing the importance of expression of the IFN
R in the prevention of cancer. However, when IFN
signaling was restored in the tumor by expressing the IFN
R1, the tumor was rejected, since expression of the IFN
R on tumors renders them susceptible to the anti-proliferative effects of IFN
. Hence, the current observations strongly implicate the importance of the expression of the IFN
R1 for the prevention of tumor development.
In this study, we have demonstrated by western blot and RTPCR that I3C significantly up regulates expression of IFN
R1. This response to I3C is due to the activation of the IFN
R1 promoter and has established a direct link between I3C signaling and the control of IFN
R1 expression in MCF-7 cells. Deletion analysis revealed an I3C-responsive region between 540 and 240 bp in the IFN
R1 promoter. Within this region, there are a variety of consensus transcription factor DNA sites such as STAT, C/EBP, Ets family member FL1, IRF3, NF
B, PRE and ERE, any one of which could be a possible target for I3C signaling. I3C down regulates CDK6 promoter activity through a Sp1/Ets composite binding site (21), suggesting the potential importance of the Ets binding site within the I3C-responsive region of the IFN
R1 promoter. We are currently characterizing this region of the IFN
R1 promoter.
STAT1 phosphorylation by Jak on a single tyrosine residue (Tyr-701) is an important downstream event in the IFN
signaling pathway (30,55,56). We have shown that I3C pre-treatment leads to enhanced phosphorylation/activation of STAT1ß by IFN
in MCF-7 cells. Conceivably, this effect may be due to I3C prolonging the tyrosine kinase effects or repressing a phosphatase. In contrast, we do not observe major differences in phosphorylation of the STAT1
isoform. Earlier reports have established that STAT1
, but not STAT1ß, is responsible for IFN
-induced responsiveness (57). Hence, I3C-mediated STAT1ß phosphorylation suggests a distinct difference in signaling pathway between I3C and IFN
. Interestingly, the anti-breast cancer drug tamoxifen is also known to increase the STAT1ß isoform (58). Taken together, these data suggest that I3C mediates its anti-proliferative effects in part by enhanced activation of the IFN
-induced STAT signaling pathway.
Although it is well established that I3C and IFN
suppress the growth of certain types of tumor cells individually (19,59,60), combinations of I3C or IFN
with other agents are known to produce significant additive or synergistic antitumor activities. For example, the growth-inhibitory effects of I3C are increased in combination with the polyamine putrescine in a colon tumor cell line (61). The growth-inhibitory activity of IFNs in different tumor types demonstrate that in solid tumors, IFNs lack single-agent activity (62,63). In addition, a combination of IFN
and tamoxifen caused synergistic growth inhibition of human mammary xenografts in athymic nude mice (64), indicating the enhanced efficacy of combined treatment. Our results show that in addition to the I3C-induced increased expression of IFN
R1, I3C and IFN
cooperate to exert significant growth-inhibitory effects in human breast cancer cells. I3C and IFN
independently induce p21Waf1/Cip1 CDK inhibitor protein levels in MCF-7 cells (19,65). When I3C and IFN
are administered together, we observe an enhanced expression of both protein and transcript levels of p21Waf1/Cip1. One of the primary events of the IFN
signaling pathway is activation of STAT1. Recent studies have shown that p21Waf1/Cip1 expression can be induced through activation of STAT signal transduction pathway (56). STAT proteins recognize and bind to the palindromic sequence TTCNNNGAA (66) and such sequences have been identified in the p21 promoter region. Activation of STAT1 in response to IFN
correlates with up regulation of p21Waf1/Cip1 expression and inhibition of cell growth in a number of cell types (67,68). In addition, hypermethylation at STAT1-binding sites in the p21 promoter region inhibits IFN
signaling pathway (69). We are investigating the role of the STAT binding site in I3C stimulation of the IFN
R1 promoter, in order to unravel the precise mechanism of I3C regulation of the IFN
R1 promoter.
The oral administration of I3C, such as from dietary sources, has promising chemopreventive properties (16), although the precise concentration of indole that enters the tissues is not established. In addition, I3C is converted into several dimeric and trimeric acid catalyzed products in the low pH environment of the stomach (17,18). The minimum effective dose of orally administered I3C for breast cancer prevention is 300 mg/day in a capsule (70). Our previous studies have demonstrated that exposure of human breast cancer cells to 200 µM I3C is optimal for the growth-inhibition response without any effects on cell viability (19,20,27). We have shown that in cell lines treated with [3H]I3C only
0.3% of the extracellular indole enters the cells (27,71). Thus, the effective concentration of I3C that can induce a cell cycle arrest of human breast cancer cells is closer to 300600 nM indole. Our current studies suggest that the direct exposure of reproductive tumors with I3C, and not the oral administration of I3C, will likely result in the type of response observed with cultured breast cancer cells, including the enhancement of IFN signaling. We are currently attempting to determine the effects of I3C treatment on IFN responsiveness in a physiological context.
| Acknowledgments |
|---|
We thank Bridget A.O'Keeffe and Nicola M.Rubenstein for their critical evaluation of this manuscript and helpful experimental suggestions, as well as other members of both the Firestone and Bjeldanes laboratories for their helpful comments throughout the duration of this work. We thank Minnie Wu, Tim Labadie, Cindy Huynh, Jessie Young and Sophia Chung for their technical assistance. This work was supported by Grant CA69056 from the National Institutes of Health (to L.F.B.) and the Department of Defense Army Breast Cancer Research Program Grant DAMD17-01-1-0174 (to U.C.).
| References |
|---|
|
|
|---|
- Jemal,A., Murray,T., Samuels,A., Ghafoor,A., Ward,E. and Thun,M.J. (2003) Cancer statistics, 2003. CA Cancer J. Clin., 53, 526.
[Abstract/Free Full Text] - Jordan,V.C., Gapstur,S. and Morrow,M. (2001) Selective estrogen receptor modulation and reduction in risk of breast cancer, osteoporosis and coronary heart disease. J. Natl Cancer Inst., 93, 14491457.
[Abstract/Free Full Text] - Pennisi,E. (1996) Drugs link to genes reveals estrogens many sides. Science, 273, 1171.[CrossRef][Web of Science][Medline]
- Powles,T.J. (1997) Adjuvant therapy for early breast cancer: a time to refine. J. Natl Cancer Inst., 89, 16521654.
[Free Full Text] - Forbes,J.F. (1997) The control of breast cancer: the role of tamoxifen. Semin. Oncol., 24, S1-5S1-19.
- Houghton,J.P., Ioffe,O.B., Silverberg,S.G., McGrady,B. and McCluggage,W.G. (2003) Metastatic breast lobular carcinoma involving tamoxifen-associated endometrial polyps: report of two cases and review of tamoxifen-associated polypoid uterine lesions. Mod. Pathol., 16, 395398.[CrossRef][Web of Science][Medline]
- Lopez-Otin,C. and Diamandis,E.P. (1998) Breast and prostate cancer: an analysis of common epidemiological, genetic and biochemical features. Endocr. Rev., 19, 365396.
[Abstract/Free Full Text] - Muss,H.B. (1992) Endocrine therapy for advanced breast cancer: a review. Breast Cancer Res. Treat., 21, 1526.[CrossRef][Web of Science][Medline]
- Birt,D.F., Pelling,J.C., Nair,S. and Lepley,D. (1996) Diet intervention for modifying cancer risk. Prog. Clin. Biol. Res., 395, 223234.[Web of Science][Medline]
- Freudenheim,J.L., Marshall,J.R., Vena,J.E., Laughlin,R., Brasure,J.R., Swanson,M.K., Nemoto,T. and Graham,S. (1996) Premenopausal breast cancer risk and intake of vegetables, fruits and related nutrients. J. Natl Cancer Inst., 88, 340348.
[Abstract/Free Full Text] - Loub,W.D., Wattenberg,L.W. and Davis,D.W. (1975) Aryl hydrocarbon hydroxylase induction in rat tissues by naturally occurring indoles of cruciferous plants. J. Natl Cancer Inst., 54, 985988.[Web of Science][Medline]
- MacGregor,J.I. and Jordan,V.C. (1998) Basic guide to the mechanisms of antiestrogen action. Pharmacol. Rev., 50, 151196.
[Abstract/Free Full Text] - Safe,S.H. (1995) Environmental and dietary estrogens and human health: is there a problem? Environ. Health Perspect., 103, 346351.[Web of Science][Medline]
- Bradfield,C.A. and Bjeldanes,L.F. (1984) Effect of dietary indole-3-carbinol on intestinal and hepatic monooxygenase, glutathione S-transferase and epoxide hydrolase activities in the rat. Food Chem. Toxicol., 22, 977982.[CrossRef][Web of Science][Medline]
- Wattenberg,L.W. and Loub,W.D. (1978) Inhibition of polycyclic aromatic hydrocarbon-induced neoplasia by naturally occurring indoles. Cancer Res., 38, 14101413.
[Abstract/Free Full Text] - Sharma,S., Stutzman,J.D., Kelloff,G.J. and Steele,V.E. (1994) Screening of potential chemopreventive agents using biochemical markers of carcinogenesis. Cancer Res., 54, 58485855.
[Abstract/Free Full Text] - Bradlow,H.L., Sepkovic,D.W., Telang,N.T. and Osborne,M.P. (1995) Indole-3-carbinol. A novel approach to breast cancer prevention. Ann. N. Y. Acad. Sci., 768, 180200.[Web of Science][Medline]
- Broadbent,T.A. and Broadbent,H.S. (1998) 1. The chemistry and pharmacology of indole-3-carbinol (indole-3-methanol) and 3-(methoxymethyl)indole. [Part II]. Curr. Med. Chem., 5, 469491.[Web of Science][Medline]
- Cover,C.M., Hsieh,S.J., Tran,S.H., Hallden,G., Kim,G.S., Bjeldanes,L.F. and Firestone,G.L. (1998) Indole-3-carbinol inhibits the expression of cyclin-dependent kinase-6 and induces a G1 cell cycle arrest of human breast cancer cells independent of estrogen receptor signaling. J. Biol. Chem., 273, 38383847.
[Abstract/Free Full Text] - Cover,C.M., Hsieh,S.J., Cram,E.J., Hong,C., Riby,J.E., Bjeldanes,L.F. and Firestone,G.L. (1999) Indole-3-carbinol and tamoxifen cooperate to arrest the cell cycle of MCF-7 human breast cancer cells. Cancer Res., 59, 12441251.
[Abstract/Free Full Text] - Cram,E.J., Liu,B.D., Bjeldanes,L.F. and Firestone,G.L. (2001) Indole-3-carbinol inhibits CDK6 expression in human MCF-7 breast cancer cells by disrupting Sp1 transcription factor interactions with a composite element in the CDK6 gene promoter. J. Biol. Chem., 276, 2233222340.
[Abstract/Free Full Text] - Chinni,S.R., Li,Y., Upadhyay,S., Koppolu,P.K. and Sarkar,F.H. (2001) Indole-3-carbinol (I3C) induced cell growth inhibition, G1 cell cycle arrest and apoptosis in prostate cancer cells. Oncogene, 20, 29272936.[CrossRef][Web of Science][Medline]
- Ge,X., Fares,F.A. and Yannai,S. (1999) Induction of apoptosis in MCF-7 cells by indole-3-carbinol is independent of p53 and bax. Anticancer Res., 19, 31993203.[Web of Science][Medline]
- Meng,Q., Goldberg,I.D., Rosen,E.M. and Fan,S. (2000) Inhibitory effects of indole-3-carbinol on invasion and migration in human breast cancer cells. Breast Cancer Res. Treat., 63, 147152.[CrossRef][Web of Science][Medline]
- Rahman,K.M. and Sarkar,F.H. (2002) Steroid hormone mimics: molecular mechanisms of cell growth and apoptosis in normal and malignant mammary epithelial cells. J. Steroid Biochem. Mol. Biol., 80, 191201.[CrossRef][Web of Science][Medline]
- Meng,Q., Qi,M., Chen,D.Z., Yuan,R., Goldberg,I.D., Rosen,E.M., Auborn,K. and Fan,S. (2000) Suppression of breast cancer invasion and migration by indole-3-carbinol: associated with up-regulation of BRCA1 and E-cadherin/catenin complexes. J. Mol. Med., 78, 155165.[CrossRef][Web of Science][Medline]
- Firestone,G.L. and Bjeldanes,L.F. (2003) Indole-3-carbinol and 3-3'-diindolylmethane antiproliferative signaling pathways control cell-cycle gene transcription in human breast cancer cells by regulating promoter-Sp1 transcription factor interactions. J. Nutr., 133, 2448S2455S.
[Abstract/Free Full Text] - Ashok,B.T., Chen,Y.G., Liu,X., Garikapaty,V.P., Seplowitz,R., Tschorn,J., Roy,K., Mittelman,A. and Tiwari,R.K. (2002) Multiple molecular targets of indole-3-carbinol, a chemopreventive anti-estrogen in breast cancer. Eur. J. Cancer Prev., 11 (suppl. 2), S86S93.[Medline]
- Howells,L.M., Gallacher-Horley,B., Houghton,C.E., Manson,M.M. and Hudson,E.A. (2002) Indole-3-carbinol inhibits protein kinase B/Akt and induces apoptosis in the human breast tumor cell line MDA MB468 but not in the nontumorigenic HBL100 line. Mol. Cancer Ther., 1, 11611172.
[Abstract/Free Full Text] - Sakamoto,S. and Taniguchi,T. (2001) Identification of a phorbol ester-responsive element in the interferon-gamma receptor 1 chain gene. J. Biol. Chem., 276, 3723737241.
[Abstract/Free Full Text] - Quandt,K., Frech,K., Karas,H., Wingender,E. and Werner,T. (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res., 23, 48784884.
[Abstract/Free Full Text] - Look,D.C., Pelletier,M.R., Tidwell,R.M., Roswit,W.T. and Holtzman,M.J. (1995) Stat1 depends on transcriptional synergy with Sp1. J. Biol. Chem., 270, 3026430267.
[Abstract/Free Full Text] - Bach,E.A., Aguet,M. and Schreiber,R.D. (1997) The IFN gamma receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol., 15, 563591.[CrossRef][Web of Science][Medline]
- Park,C. and Schindler,C. (1998) Protein-DNA interactions in interferon-gamma signaling. Methods, 15, 175188.[CrossRef][Web of Science][Medline]
- Kolla,V., Lindner,D.J., Xiao,W., Borden,E.C. and Kalvakolanu,D.V. (1996) Modulation of interferon (IFN)-inducible gene expression by retinoic acid. Up-regulation of STAT1 protein in IFN-unresponsive cells. J. Biol. Chem., 271, 1050810514.
[Abstract/Free Full Text] - Pulaski,B.A., Smyth,M.J. and Ostrand-Rosenberg,S. (2002) Interferon-gamma-dependent phagocytic cells are a critical component of innate immunity against metastatic mammary carcinoma. Cancer Res., 62, 44064412.
[Abstract/Free Full Text] - Zhang,M., Guo,R., Zhai,Y. and Yang,D. (2003) LIGHT sensitizes IFNgamma-mediated apoptosis of MDA-MB-231 breast cancer cells leading to down-regulation of anti-apoptosis Bcl-2 family members. Cancer Lett., 195, 201210.[Web of Science][Medline]
- Zhang,X. and Malejka-Giganti,D. (2003) Effects of treatment of rats with indole-3-carbinol on apoptosis in the mammary gland and mammary adenocarcinomas. Anticancer Res., 23, 24732479.[Web of Science][Medline]
- Novelli,F., Allione,A., Bernabei,P., Rigamonti,L. and Forni,G. (1997) Antiblastic chemotherapy drugs up-modulate interferon-gamma receptor expression on human malignant T cells. Cancer Detect. Prev., 21, 191195.[Web of Science][Medline]
- Yamada,H., Ochi,K., Nakada,S., Takahara,S., Nemoto,T., Sekikawa,T. and Horiguchi-Yamada,J. (1995) Interferon modulates the messenger RNA of G1-controlling genes to suppress the G1-to-S transition in Daudi cells. Mol. Cell Biochem., 152, 149158.[CrossRef][Web of Science][Medline]
- Sen,G.C. and Lengyel,P. (1992) The interferon system. A bird's eye view of its biochemistry. J. Biol. Chem., 267, 50175020.
[Free Full Text] - Rubinstein,M., Novick,D. and Fischer,D.G. (1987) The human interferon-gamma receptor system. Immunol. Rev., 97, 2950.[CrossRef][Web of Science][Medline]
- Kalvakolanu,D.V. (2000) Interferons and cell growth control. Histol. Histopathol., 15, 523537.[Web of Science][Medline]
- Wadler,S. and Schwartz,E.L. (1990) Antineoplastic activity of the combination of interferon and cytotoxic agents against experimental and human malignancies: a review. Cancer Res., 50, 34733486.
[Abstract/Free Full Text] - Koshiji,M., Adachi,Y., Taketani,S., Takeuchi,K., Hioki,K. and Ikehara,S. (1997) Mechanisms underlying apoptosis induced by combination of 5-fluorouracil and interferon-gamma. Biochem. Biophys. Res. Commun., 240, 376381.[CrossRef][Web of Science][Medline]
- Balkwill,F.R. and Oliver,R.T. (1977) Growth inhibitory effects of interferon on normal and malignant human haemopoietic cells. Int. J. Cancer, 20, 500505.[Web of Science][Medline]
- Bromberg,J.F., Horvath,C.M., Wen,Z., Schreiber,R.D. and Darnell,J.E.,Jr (1996) Transcriptionally active Stat1 is required for the antiproliferative effects of both interferon alpha and interferon gamma. Proc. Natl Acad. Sci. USA, 93, 76737678.
[Abstract/Free Full Text] - Lin,T., Hu,J., Wang,D. and Stocco,D.M. (1998) Interferon-gamma inhibits the steroidogenic acute regulatory protein messenger ribonucleic acid expression and protein levels in primary cultures of rat Leydig cells. Endocrinology, 139, 22172222.
[Abstract/Free Full Text] - Ucer,U., Bartsch,H., Scheurich,P., Berkovic,D., Ertel,C. and Pfizenmaier,K. (1986) Quantitation and characterization of gamma-interferon receptors on human tumor cells. Cancer Res., 46, 53395343.
[Abstract/Free Full Text] - Ishizuka,T., Morita,K., Hisada,T., Ando,S., Adachi,M., Dobashi,K. and Mori,M. (1996) The direct effect of interferon-gamma on human eosinophilic leukemia cell lines: the induction of interleukin-5 mRNA and the presence of an interferon-gamma receptor. Inflammation, 20, 151163.[CrossRef][Web of Science][Medline]
- Detjen,K.M., Murphy,D., Welzel,M., Farwig,K., Wiedenmann,B. and Rosewicz,S. (2003) Downregulation of p21 (waf/cip-1) mediates apoptosis of human hepatocellular carcinoma cells in response to interferon-gamma. Exp. Cell Res., 282, 7889.[CrossRef][Web of Science][Medline]
- Raitano,A.B. and Korc,M. (1993) Growth inhibition of a human colorectal carcinoma cell line by interleukin 1 is associated with enhanced expression of gamma-interferon receptors. Cancer Res., 53, 636640.
[Abstract/Free Full Text] - Hawkyard,S.J., Jackson,A.M., James,K., Prescott,S., Smyth,J.F. and Chisholm,G.D. (1992) The inhibitory effects of interferon gamma on the growth of bladder cancer cells. J. Urol., 147, 13991403.[Web of Science][Medline]
- Qin,Z., Kim,H.J., Hemme,J. and Blankenstein,T. (2002) Inhibition of methylcholanthrene-induced carcinogenesis by an interferon gamma receptor-dependent foreign body reaction. J. Exp. Med., 195, 14791490.
[Abstract/Free Full Text] - Darnell,J.E.,Jr, Kerr,I.M. and Stark,G.R. (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science, 264, 14151421.
[Abstract/Free Full Text] - Darnell,J.E.,Jr (1997) STATs and gene regulation. Science, 277, 16301635.
[Abstract/Free Full Text] - Zakharova,N., Lymar,E.S., Yang,E., Zhang,J.J., Roeder,R.G. and Darnell,J.E.,Jr (2003) Distinct transcriptional activation functions of STAT1alpha and beta on DNA and chromatin templates. J. Biol. Chem., 278, 4306743073.
[Abstract/Free Full Text] - Ruvolo,V., Navarro,L., Sample,C.E., David,M., Sung,S. and Swaminathan,S. (2003) The Epstein-Barr virus SM protein induces STAT1 and interferon-stimulated gene expression. J. Virol., 77, 36903701.
[Abstract/Free Full Text] - Giovarelli,M., Cofano,F., Vecchi,A., Forni,M., Landolfo,S. and Forni,G. (1986) Interferon-activated tumor inhibition in vivo. Small amounts of interferon-gamma inhibit tumor growth by eliciting host systemic immunoreactivity. Int. J. Cancer, 37, 141148.[Web of Science][Medline]
- de la Maza,L.M. and Peterson,E.M. (1988) Dependence of the in vitro antiproliferative activity of recombinant human gamma-interferon on the concentration of tryptophan in culture media. Cancer Res., 48, 346350.
[Abstract/Free Full Text] - Hudson,E.A., Howells,L.M., Gallacher-Horley,B., Fox,L.H., Gescher,A. and Manson,M.M. (2003) Growth-inhibitory effects of the chemopreventive agent indole-3-carbinol are increased in combination with the polyamine putrescine in the SW480 colon tumour cell line. BMC Cancer, 3, 2.[CrossRef][Medline]
- Lippman,S.M., Glisson,B.S., Kavanagh,J.J., Lotan,R., Hong,W.K., Paredes-Espinoza,M., Hittelman,W.N., Holdener,E.E. and Krakoff,I.H. (1993) Retinoic acid and interferon combination studies in human cancer. Eur. J. Cancer, 29A (suppl. 5), S913.[Medline]
- Windbichler,G.H., Hensler,E., Widschwendter,M., Posch,A., Daxenbichler,G., Fritsch,E. and Marth,C. (1996) Increased radiosensitivity by a combination of 9-cis-retinoic acid and interferon-y in breast cancer cells. Gynecol. Oncol., 61, 387394.[CrossRef][Web of Science][Medline]
- Lindner,D.J., Kolla,V., Kalvakolanu,D.V. and Borden,E.C. (1997) Tamoxifen enhances interferon-regulated gene expression in breast cancer cells. Mol. Cell. Biochem., 167, 169177.[CrossRef][Web of Science][Medline]
- Gooch,J.L., Herrera,R.E. and Yee,D. (2000) The role of p21 in interferon gamma-mediated growth inhibition of human breast cancer cells. Cell Growth Differ., 11, 335342.
[Abstract/Free Full Text] - Horvath,C.M., Wen,Z. and Darnell,J.E.,Jr (1995) A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain. Genes Dev., 9, 984994.
[Abstract/Free Full Text] - Chin,Y.E., Kitagawa,M., Su,W.C., You,Z.H., Iwamoto,Y. and Fu,X.Y. (1996) Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21 WAF1/CIP1 mediated by STAT1. Science, 272, 719722.[Abstract]
- Xu,X., Fu,X.Y., Plate,J. and Chong,A.S. (1998) IFN-gamma induces cell growth inhibition by Fas-mediated apoptosis: requirement of STAT1 protein for up-regulation of Fas and FasL expression. Cancer Res., 58, 28322837.
[Abstract/Free Full Text] - Chen,B., He,L., Savell,V.H., Jenkins,J.J. and Parham,D.M. (2000) Inhibition of the interferon-gamma/signal transducers and activators of transcription (STAT) pathway by hypermethylation at a STAT-binding site in the p21WAF1 promoter region. Cancer Res., 60, 32903298.
[Abstract/Free Full Text] - Wong,G.Y., Bradlow,L., Sepkovic,D., Mehl,S., Mailman,J. and Osborne,M.P. (1997) Dose-ranging study of indole-3-carbinol for breast cancer prevention. J. Cell. Biochem., 28/29 (suppl.), 111116.[CrossRef]
- Staub,R.E., Feng,C., Onisko,B., Bailey,G.S., Firestone,G.L. and Bjeldanes,L.F. (2002) Fate of indole-3-carbinol in cultured human breast tumor cells. Chem. Res. Toxicol., 15, 101109.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
G. L. Firestone and S. N. Sundar Minireview: Modulation of Hormone Receptor Signaling by Dietary Anticancer Indoles Mol. Endocrinol., December 1, 2009; 23(12): 1940 - 1947. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Nguyen, I. Aronchik, G. A. Brar, D. H. H. Nguyen, L. F. Bjeldanes, and G. L. Firestone The dietary phytochemical indole-3-carbinol is a natural elastase enzymatic inhibitor that disrupts cyclin E protein processing PNAS, December 16, 2008; 105(50): 19750 - 19755. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, D. Liu, P. Chen, H. P. Koeffler, X. Tong, and D. Xie Negative Feedback Regulation of IFN-{gamma} Pathway by IFN Regulatory Factor 2 in Esophageal Cancers Cancer Res., February 15, 2008; 68(4): 1136 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Singhal, A. Jaiswal, V. K. Arora, and H. K. Prasad Modulation of Gamma Interferon Receptor 1 by Mycobacterium tuberculosis: a Potential Immune Response Evasive Mechanism Infect. Immun., May 1, 2007; 75(5): 2500 - 2510. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Moiseeva, R. Heukers, and M. M. Manson EGFR and Src are involved in indole-3-carbinol-induced death and cell cycle arrest of human breast cancer cells Carcinogenesis, February 1, 2007; 28(2): 435 - 445. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Riby, L. Xue, U. Chatterji, E. L. Bjeldanes, G. L. Firestone, and L. F. Bjeldanes Activation and Potentiation of Interferon-{gamma} Signaling by 3,3'-Diindolylmethane in MCF-7 Breast Cancer Cells Mol. Pharmacol., February 1, 2006; 69(2): 430 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Garcia, G. A. Brar, D. H. H. Nguyen, L. F. Bjeldanes, and G. L. Firestone Indole-3-Carbinol (I3C) Inhibits Cyclin-dependent Kinase-2 Function in Human Breast Cancer Cells by Regulating the Size Distribution, Associated Cyclin E Forms, and Subcellular Localization of the CDK2 Protein Complex J. Biol. Chem., March 11, 2005; 280(10): 8756 - 8764. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


0.05. (B) MCF-7 cells were treated with or without 200 µM I3C for 24, 48 and 72 h. Cell lysates were fractionated by electrophoresis and transferred on a PVDF membrane. Blots were probed with anti-IFN











