Carcinogenesis Advance Access originally published online on March 11, 2004
Carcinogenesis 2004 25(8):1327-1333; doi:10.1093/carcin/bgh140
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.25 no.8 © Oxford University Press 2004; all rights reserved.
ARTICLE |
Identification of one exon deletion of intestinal alkaline sphingomyelinase in colon cancer HT-29 cells and a differentiation-related expression of the wild-type enzyme in Caco-2 cells
Gastroenterology Lab, Biomedical Center B11, Lund University, S-221 84 Lund, Sweden
1 To whom correspondence should be addressed Email: rui-dong.duan{at}med.lu.se
| Abstract |
|---|
|
|
|---|
Sphingomyelin (SM) metabolism in the gut has been implicated in colonic tumorigenesis. Intestinal alkaline sphingomyelinase (alk-SMase) hydrolyses SM in the intestinal content and at the brush border. The enzyme activity is decreased in the tissues of human colorectal tumours. This study examines whether site or chain-mutation of alk-SMase occurs in colon cancer HT-29 cells and Caco-2 cells. Total RNA was isolated and the cDNA of alk-SMase was amplified by RTPCR. The size of the cDNA from HT-29 cells was smaller than that of the wild-type cDNA. DNA sequencing identified a deletion of exon 4 in alk-SMase cDNA in HT-29 cells. No mutation in genomic alk-SMase DNA from exon 3 to 5 was identified. The exon 4 deletion was caused by a shift of RNA splice site in chromosome 17q25. In Caco-2 cells, no mutation of alk-SMase cDNA was identified. Transient expression in COS-7 cells showed that the enzyme from the cDNA in HT-29 cells had little alk-SMase activity whereas that in Caco-2 cells was as active as the wild-type alk-SMase. The deleted region included residue His353, which is predicted to form a substrate-binding site of alk-SMase. H353A substitution resulted in a protein with no alk-SMase activity. In monolayer cultured Caco-2 cells and HT-29 cells the alk-SMase activities were low. However, to culture the cells under polarizing conditions increased alk-SMase activity and reduced SM level in Caco-2 cells. The alk-SMase activity varied in parallel with alkaline phosphatase activity. In conclusion, we identified an inactive deletion in alk-SMase in HT-29 cells, and a differentiation-related expression of the enzyme in Caco-2 cells. The results provide a molecular mechanism related to previous findings of reduced alk-SMase activity in human colon cancers.
Abbreviations: alk-SMase, sphingomyelinase; lyso-PC, lysophosphatidylcholine; PC, phosphatidylcholine; SM, sphingomyelin
| Introduction |
|---|
|
|
|---|
Sphingomyelin (SM) metabolism has been recognized as an important source of lipid messengers, which regulate cell proliferation, differentiation and apoptosis (1,2). Previous studies have found that SM metabolism in the intestinal tract may have important implications in colonic tumorigenesis. Administration of dietary SM was shown to inhibit the formation of colonic aberrant crypt foci and reduce the ratio of carcinoma to adenoma in animals treated with 1,2-dimethylhydrazine (3,4). Similar inhibitory effects have been found when the animals were fed with ceramide analogues (5). In addition, several anticancer drugs such as camptothecin and NSAIDs affect SM metabolism by either stimulating SM hydrolysis or ceramide synthesis (6,7). Recently SM was found to enhance the chemotherapy efficacy of 5-FU in treatment of colon cancer cells and colonic tumour xenografts (8).
In the intestinal tract, SM is mainly hydrolysed by an enzyme called alkaline sphingomyelinase (alk-SMase), which was discovered >30 years ago in the gut (9). The protein was recently purified from rat and human (10,11) and the cDNA of human alk-SMase identified in our laboratory (12). We demonstrated previously that the enzyme activity was significantly decreased in the tissues of human colorectal adenomas, carcinomas and familial adenomatous polyposis (13,14), as well as in long-standing ulcerative colitis (15), a disease with increased risk of colon cancer. The purified enzyme was found recently to inhibit cell proliferation of HT-29 cells (16). Put together, these studies indicate that alk-SMase may be a novel tumour suppressor that counteracts the colonic cells from tumorigenesis under physiological conditions. The question was therefore raised whether site or chain-mutation of alk-SMase occurs in colon cancer cells. In this initial study, we investigated the alk-SMase gene in human colon cancer HT-29 cells, a poorly differentiated cell line and in Caco-2 cells, a well-differentiated cell line.
| Materials and methods |
|---|
|
|
|---|
Materials
HT-29 cells, Caco-2 cells and COS-7 cells were purchased from American Tissue Culture Collection. SM was purified from bovine milk and labeled with [14C-CH3]choline ([14C-SM]) (17). Plasmids pCDNA4/TO/myc-His B with and without LacZ insert, LipofectamineTM 2000, ThermoScriptTM RTPCR system, AccuPrimeTM system, pfX DNApolymerase, anti-Myc antibody and all primers used were purchased from Invitrogen (Paisley, UK). QuickprepTM total RNA extraction kit, GFXTM DNA and gel band purification kit, enhanced chemiluminescence (ECL) kit for western blotting, and [3H]choline chloride were obtained from Amersham Biosciences (Uppsala, Sweden). All cell culture mediums and other chemical agents used were purchased from Sigma (Stockholm, Sweden).
Amplification and sub-cloning of alk-SMase cDNA from HT-29 and Caco-2 cells
To obtain alk-SMase cDNAs in HT-29 and Caco-2 cells, total RNA was extracted and purified from 10 x 106 cells by Total RNA Extraction kit (Amersham Biosciences) and reversely transcripted to cDNA by a Thermoscript RTPCR System (Invitrogen). The alk-SMase cDNA was amplified by PCR using sense primer 5'tcggtaccgaaagcatgagaggcccggccgtcctc3' and antisense primer 5'tagcggccgcctgcgacctcagacagaagaat3' with the cDNAs from HT-29 and Caco-2 cells as templates in a Mastercycler gradient PCR system (Eppendorf, Hamburg, Germany). The PCR programme was 95°C 2 min first, followed by 95°C 15 s, 55°C 30 s and 68°C 100 s for 40 cycles. The PCR products were isolated by 1% agarose gel electrophoresis and purified by GFXTM DNA purification kit (Amersham Biosciences). The products were digested with KpnI/NotI and constructed into KpnI and NotI sites of pcDNA4/TO/myc-His plasmid. The cDNA inserts in the recombinant plasmid were sequenced by Cybergene (Huddinge, Sweden) using sense 5'cgcaaatgggcggtaggcgtg3' and antisense 5'tagaaggcacagtcgagg3' primers of the vector and an alk-SMase primer 5'ggtggtgggacaacggca3' from the site 349 to 367, based on the mRNA sequence of human alk-SMase [(12), GenBank accession number AY230663].
Transient expression
COS-7 cells were cultured at
80% confluence. The cells were transfected with 4 µg of the constructed plasmids with wild-type alk-SMase cDNA, or the cDNAs from HT-29 cells, Caco-2 cells, and that with site-directed mutation in the presence of LipofectamineTM 2000. Transfection with 4 µg of the plasmid with LacZ gene was simultaneously performed to assess the efficiency of the transfection. Control cells were transfected with the mock plasmid in the same way as the transfected cells. The cells were then cultured for 48 h and then scraped and lysed as described previously (12). The activities of alk-SMase and ß-galactosidase in the cell lysate were determined.
H353A site-directed mutation of alk-SMase
The site mutation H353A of alk-SMase was performed by the megaprimer PCR method (18). The sense oligonucleotides used for mutagenesis is 5'cgtccagttcaacaatggggaggccggctttgacaacaaggacatg3', in which the altered codons were underlined. The sense and antisense primers for alk-SMase are 5'tcggtaccgaaagcatgagaggcccggccgtcctc3 and 5'tagcggccgcctgcgacctcagacagaagaat3'. The mutated gene as well as the wild-type cDNA (12) were cloned into the expression vector pcDNA4/TO/Myc-His B at KpnI and NotI sites as described (12) and transferred into COS-7 cells. After incubation of the cells for 48 h, the cells were lysed and the activity of alk-SMase was assayed.
Western blotting of alk-SMase expressed in Cos-7 cells
The cDNA of both wild-type and the mutated alk-SMase were subcloned into the expression vector pcDNA4/TO/Myc-His B. After expression, 75 µg cellular proteins in the lysate were subjected to 10% SDSpolyacrylamide gel electrophoresis and then transferred to nitrocellulose membrane electrophoretically. The membrane was probed with anti-Myc antibody (1:5000) for 2 h. After blocking and washing, the membranes were reacted with anti-rabbit IgG antibody conjugated with horseradish peroxidase for 1 h. The alk-SMase bands were identified by ECL advance reagents and the remitted light was recorded on Kodak X-ray film. The whole procedure followed the instructions of the manufacturer.
Genomic alk-SMase DNA extraction and sequence
HT-29 cells were lysed in lysis buffer containing 67 mM Tris, 16.6 mM ammonium sulfate, 5 mM ß-mercaptoethanol, 6.7 mM MgCl2, 6.7 µM EDTA, 1.7 µM SDS, 50 µg/ml proteinase K for 1 h at 37°C followed by a 10 min incubation at 80°C to inactive proteinase K. Using the lysate as template, the fragment of alk-SMase genomic DNA from exon 3 to 5 was amplified by PCR using sense 5'cacggcatgacgaccgtggacaaac3' and antisense 5'tagcggccgcctgcgacctcagacagaagaat3' primers. The PCR programme was 95°C 2 min first, followed by 95°C 15 s, 55°C 30 s and 68°C 180 s for 35 cycles. The 2.6 kb PCR product was sequenced by Cybergene with sense 5'cacggcatgacgaccgtggacaaac3', and 5'gccttccactacgccaacaa3' and antisense 5'tagcggccgcctgcgacctcagacagaagaat3', and 5'tgcatgaggtgctcgtgaga3' primers.
Cell culture
HT-29 cells were cultured in RPMI-1640 medium with 2 mM L-glutamine. Caco-2 cell (monolayer) and COS-7 cells were cultured in DMEM medium with 2 mM glutamine and 4500 mg/l glucose. All the mediums above contained 100 IU/ml penicillin, 10 µg/ml streptomycin and 10% heat inactivated fetal calf serum (FCS). Culturing of Caco-2 cells under polarizing condition was performed according to Traber et al. (19). In brief, 2 x 105 cells were seeded on the filter (1.0 µm) of cell culture inserts (BD Falcon, Bedford, USA), which were placed in a 6-well plate. The cells were cultured in the DMEM medium containing 20% FCS and 1% non-essential amino acids, with 2 ml medium in the insert and 2.5 ml in the well. The medium was replaced every third day until day 21. For comparison, HT-29 cells were also cultured similarly. Before the medium was replaced each time, 100 µl of samples from the medium of insert were taken for measuring alkaline phosphatase to monitor cell differentiation. At day 21, the cells were scraped and centrifuged by 3000 g at 4°C for 10 min. The pellet was lysed, sonicated and centrifuged as described previously (12). The activities of alk-SMase, alkaline phosphatase and the protein contents were determined.
Determine the levels of SM, phosphatidylcholine (PC) and lysophosphatidylcholine (lyso-PC) in Caco-2 cells
Caco-2 cells were cultured either in conventional flasks (monolayer) to
70% confluence or on the insert for 19 days. In both cases, the cells were then labeled with [3H]choline chloride (0.5 µCi/ml) and incubated for an additional 2 days as described previously (20). After washing out the remaining [3H]choline chloride, the cells were scraped and suspended in 1 ml of PBS buffer. A small portion of the cell suspension was taken and lysed. The concentration of the cellular protein was determined. The total lipids in the rest of the cells were extracted according to Bligh and Dyer (21). The SM, PC and lyso-PC were isolated by thin layer chromatography (TLC) on 60F silica plate as described (12). The phospholipid bands were scraped and the radioactivity of the lipids was counted by liquid scintillation. The levels of the phospholipids were expressed as labeled lipids per mg cell proteins.
Determination of alk-SMase, ß-galactosidase, alkaline phosphatase and proteins
The alk-SMase activities in the cell-free extracts were determined according to Duan and Nilsson (22). Briefly, 5 µl of sample were incubated in 95 µl of 50 mM TrisHCl buffer, containing 0.15 M NaCl, 2 mM EDTA, 6 mM taurocholate and 0.8 µM [14C-SM], pH 9.0, and incubated for 30 min. The reaction was stopped by adding 0.4 ml of chloroform/methanol (2:1 v/v) and the cleaved phosphocholine in the upper phase was determined by liquid scintillation. The activity of ß-galactosidase was assayed by a ß-gal assay kit (Invitrogen), using ortho-nitrophenyl-ß-galactopyranoside (ONPG) as substrate. Briefly, 5 µl of the cell-free extract was mixed with 25 µl water, 70 µl 4 mg/ml ONPG, and 100 µl cleavage buffer containing 60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgCl2 and 0.27% mercaptoethanol, pH 7.0, followed by incubation at 37°C for 30 min. The reaction was stopped by adding 500 µl of 1 M Na2CO3. The hydrolysed ONPG was read at 420 nm by a spectrophotometer and the activity was calculated according to a formula provided by the manufacturer. The alkaline phosphatase was assayed with p-nitrophenyl phosphate as substrate, as described previously (23). The protein was analysed by a kit obtained from Bio-Rad (Stockholm, Sweden) using bovine albumin as a standard.
| Results |
|---|
|
|
|---|
Comparison of sizes of alk-SMase cDNAs in HT-29 cells and Caco-2 cells with the wild-type cDNA
The cDNAs of alk-SMase in HT-29 and Caco-2 cells were amplified by RTPCR. The comparison of the size of the PCR products from these cells is shown in Figure 1. The size of alk-SMase cDNA from HT-29 cells was smaller than that from Caco-2 cells and that of the wild-type cDNA (12). The size of the cDNA from Caco-2 cells was equal to that of wild-type cDNA.
|
Identification of a deletion in alk-SMase cDNA in HT-29 cells
The human intestinal alk-SMase gene is located in chromosome 17q25, as shown in the top panel of Figure 2. To identify the molecular basis of the reduced cDNA of alk-SMase in HT-29 cells, DNA sequence was performed. It was found that in the cDNA from HT-29 cells the fourth exon was deleted (middle panel of Figure 2). To assess whether the deletion is caused by genomic mutation, the part of the genomic alk-SMase DNA from exon 3 to 5 was amplified and sequenced. No genomic mutation was identified. Based on the results the deletion is caused by a shift of the splice site from 5958 to 6814, as detailed in the bottom panel of Figure 2. The deletion involves 219 bp, which encode 73 aa as shown in Figure 3. The variation of the splice sites also resulted in an insert of 6 foreign aa residues prior to the downstream sequence encoded by exon 5. Within the deleted area, His353 (marked with *) was predicted previously to be involved in forming a potential binding site of SM (12). As for the cDNA in Caco-2 cells, no mutation was identified.
|
|
Transient expression of alk-SMase cDNA from HT-29 and Caco-2 cells
To identify whether the deletion of the exon would affect the enzyme activity, both cDNA from HT-29 and Caco-2 cells were expressed in COS-7 cells. As shown in the top panel of Figure 4, the expressed cDNA isolated from Caco-2 cells displayed full alk-SMase activity as that from the wild-type cDNA, whereas that from HT-29 cells had little activity. The loss of the activity is not due to the changes of transfection efficiency, as the cells expressed equal ß-galactosidase after simultaneous transfection with the same plasmid linked to LacZ gene (middle panel). Western blotting further confirmed that the mutated cDNA from HT29 cells was expressed to a similar extent as that of Caco-2 cells in Cos 7 cells (bottom panel).
|
Effect of site mutation of His353 on alk-SMase activity
Because the deletion of the exon in HT-29 cells caused a removal of His353, which has been predicted previously to participate in the formation of a binding site for SM (12), we further examined whether deletion of this residue could critically affect the alk-SMase activity. As shown in Figure 5, H353A mutation inactivated alk-SMase expressed in COS-7 cells (upper panel). The levels of alk-SMase expressed in both cases were similar as shown by western blotting (lower panel).
|
Expression of alk-SMase in Caco-2 cells
Although the cDNA of alk-SMase in Caco-2 cells is normal, the cells cultured in monolayer only demonstrated a very low alk-SMase activity similar to that found in HT-29 cells (middle panel of Figure 6). To examine whether expression of alk-SMase in Caco-2 cells is associated with the formation of brush border, both Caco-2 and HT-29 cells were cultured in a condition allowing polarization for 21 days. As shown in the top panel of Figure 6, the activity of alkaline phosphatase increased rapidly with the time in the cell culture medium of Caco-2 cells, whereas that in HT-29 cells only increased slightly. The results confirmed the progress of differentiation in Caco-2 cells but not in HT-29 cells. At the end of the cell culture, the activity of alk-SMase in Caco-2 cells was increased by 12-fold as compared with that found in monolayer cultured cells (middle panel) and that of alkaline phosphatase increased by 2.4-fold (bottom panel). No change of either alk-SMase or alkaline phosphatase in HT-29 cells was identified after culturing in this condition. There was no significant difference of cell protein concentrations in the lysate of Caco-2 and HT-29 cells (6.85 ± 0.64 versus 6.64 ± 0.43 mg/ml) at the end of the culture. In addition, after incorporating radiolabelled choline chloride, the levels of the radiolabelled SM, PC and lyso-PC, all are substrates of alk-SMase, were significantly lower in Caco-2 cells cultured in the insert where alk-SMase was expressed than those cultured in monolayer where no active alk-SMase was identified (Table I). The reduction of SM levels exceeded those of lyso-PC and PC.
|
|
| Discussion |
|---|
|
|
|---|
Studies from animal models and cell cultures have indicated that the generation of lipid messengers derived from SM hydrolysis may protect the colonic mucosa from tumorigenesis (24). In agreement with this hypothesis, the hydrolysis of SM was reported to be decreased and SM accumulated during the development of colonic tumours (25). Although at least three types of SMase have been identified based on the optimal pH, intestinal alk-SMase may be of specific importance, as it is present in the intestinal mucosa and is responsible for hydrolysis of SM both in the intestinal content and mucosal membrane (11,26,27). Our previous studies showed that the activity of alk-SMase was decreased by 75% in the tissues of human sporadic colon cancers compared with surrounding normal mucosa, and decreased by 90% in the patients with familial adenomatous polyposis (13,14). Mild reduction of the enzyme activity was also identified in long-standing ulcerative colitis, which is associated with an increased risk of colon cancer (15). The molecular mechanisms underlying the reduced alk-SMase activity in some colonic cancer tissues have not been elucidated.
In the present study, we, for the first time, discovered an exon (exon 4) deletion of alk-SMase gene transcript in human colon cancer HT-29 cells, which are highly malignant and poorly differentiated. The deletion not caused by a genomic mutation as the sequence of the genomic alk-SMase DNA from exon 3 to 5 is normal. The deletion thus occurred at transcript level and is caused by a shift of splice site, resulting in a complete deletion of 73 aa residues. Although the mechanism that causes the shift of splice site is not known, such a deletion results in a significant loss of the enzyme activity, as transient expression of the cDNA cloned from HT-29 cells failed to show alk-SMase activity. The finding is of importance, as it provides a molecular mechanism at genetic level that is related to the reduced alk-SMase in some human colon cancer tissues.
Why deletion of exon 4 inactivates the enzyme is not clear at the moment. In this paper, we provided one possibility that the loss of the enzyme activity may be related to the deletion of His353, which was predicted previously to be involved in the formation of a binding site for SM (12). As has been reported recently, human intestinal alk-SMase shares no similarity with acid or neutral SMase, but is weakly related to nucleotide phosphodiesterase (NPP) family (12). NPPs have two metal coordinating sites formed by conserved 6 aa, which renders the enzyme activity to be dependent on metal ions such as Zn2+, Ca2+ or Mg2+ (28). These amino acid residues are also conserved in human alk-SMase and His353 is one of them (12). Differing from NPPs, however, alk-SMase is not dependent on divalent ions and these metal-binding sites may serve as binding sites for its positively charged substrate such as SM, PC and lyso-PC (12). Deletion of the His353 may thus affect the binding of the enzyme with its substrate. However, this hypothesis can not be considered as an exclusive one, as the consequence of the deletion involved a total of 73 aa residues including a Cys and a potential protein kinase C site S372, and an insertion of 6 foreign aa, which may change the structure, stability and phosphorylation of the enzyme, thereby affecting the enzyme activity.
Development of colon cancer is a process of accumulation of a series of mutations such as APC, k-Ras, DCC and p53 (29,30) and the Wnt signalling pathway has been considered to play a central role (31). At the moment, it is not known whether or how the deletion of alk-SMase cDNA in HT-29 cells is related to any of these mutations or signal transduction pathway. We showed previously that a reduction of alk-SMase activity is not directly related to either germline or somatic mutation of APC gene in MIN mice or human sporadic colon cancers (32). Chromosome 17 has been predicted to contain tumour suppressors of colonic cancers, and previous studies have found that chromosome 17p is frequently affected by allelic losses (33). Our findings that the gene of alk-SMase is located in chromosome 17q25 and is mutated with a deletion in a colon cancer cell line shed a new light on the importance of chromosome 17 in colon cancer development. Future studies are to search the deletion or other mutations of alk-SMase in different types of human colon cancer tissues and to find out the incidence of such a deletion in human cancer patients.
It should be pointed out that although we identified a deletion in alk-SMase cDNA in HT-29 cells, it is not clear whether this is the only form of the transcript in this cell line. Transient expression of the deleted cDNA shows little alk-SMase activity, but in monolayer-cultured HT-29 cells, a small activity to hydrolyse SM at alkaline pH was detectable and the activity could be increased by some anticancer agents such as ursolic acid (34). Our finding in this paper raised a necessity to further examine whether the activity identified previously in HT29 cells was caused by a tiny expression of the normal alk-SMase in the cells or was derived from other types of phospholipase C that may have weak activity against SM.
In the present study, we found that deletion of exon 4 does not occur in Caco-2 cells and the cDNA product from Caco-2 cells displays full alk-SMase activity when expressed in COS-7 cells. However, the cells when cultured in monolayer have a low alk-SMase activity as that in HT-29 cells. It is well known that Caco-2 cells, although derived from colon carcinoma, can undergo spontaneous differentiation when cultured in filter membrane, which allows the functional polarization pattern to be formed (35). Previous studies have shown that expression and fully post-translational processing of several intestinal microvillar hydrolases are dependent on the differentiation and the formation of apical surface of the cells (36). Human alk-SMase is a type of ecto-enzyme that is located on the microvillar surface with the active site being outside of the cells (11,12). The expression of the enzyme shares some similarities as other intestinal microvillar hydrolases, because the enzyme was poorly expressed when the cells were cultured in monolayer, and the activity significantly increased in parallel with alkaline phosphatase when the cells were cultured in a way that favours differentiation. The levels of SM, lyso-PC and PC in Caco-2 cells expressing alk-SMase were significantly lower than Caco-2 cells not expressing the enzyme. The reduction of SM significantly exceeded that of PC, indicating the reduced SM was mostly probably caused by an increased hydrolysis rather than a decreased biosynthesis, as SM is synthesized by transferring a phosphocholine headgroup from PC to ceramide. HT-29 cells, when cultured in a similar way, did not exhibit an increase in either alk-SMase or alkaline phosphatase activity. The results imply that differentiation might be a prerequisite for enterocytes to express a functionally active alk-SMase. Thus, alk-SMase expression can be inhibited when differentiation of enterocytes is defective, e.g. in chronic inflammatory bowel disease and coeliac disease. The previous finding that the alk-SMase activity was decreased in human long-standing ulcerative colitis (15) could be a consequence of a disturbed differentiation of intestinal mucosa in these patients.
In summary, the present study discovered the first mutation of alk-SMase gene in poorly differentiated HT-29 colon cancer cell line and also identified a differentiation-related expression of the wild-type enzyme in less malignant Caco-2 colon cancer cell line. The findings provide a biological mechanism behind the reduced enzyme activity found in human colon cancer tissues. In addition, our study suggests that Caco-2 cells may be an optimal cell line for studying the expression of intestinal alk-SMase, which was discovered >30 years ago (9), and whose regulation and the signalling pathway require further investigation.
| Acknowledgments |
|---|
The work was supported by Swedish Cancer Foundation, Swedish Science Research Council, Albert Påhlsson Foundation, Gunnar Nilsson's Cancer Foundation, Thelma Zoegas Foundation, and The Research Foundation of Lund University Hospital.
| References |
|---|
|
|
|---|
- Hannun,Y.A. and Linardic,C.M. (1993) Sphingolipid breakdown products: anti-proliferative and tumor-suppressor lipids. Biochim. Biophys. Acta, 1154, 223236.[Medline]
- Kolesnick,R.N. (1991) Sphingomyelin and derivatives as cellular signals. Prog. Lipid Res., 30, 138.[CrossRef][Web of Science][Medline]
- Dillehay,D.L., Webb,S.K., Schmelz,E.-M. and Merrill,A.H. (1994) Dietary sphingomyelin inhibits 1,2-dimethylhydrazine-induced colon cancer in CF1 mice. J. Nutr., 124, 615620.
[Abstract/Free Full Text] - Schmelz,E.M., Bushnev,A.S., Dillehay,D.L., Liotta,D.C. and Merrill,A.H.,Jr (1997) Suppression of aberrant colonic crypt foci by synthetic sphingomyelins with saturated or unsaturated sphingoid base backbones. Nutr. Cancer, 28, 8185.[Web of Science][Medline]
- Schmelz,E., Bushnev,A., Dillehan,D.L., Sullards,M., Liotta,D. and Merrill,A.H. (1999) Ceramide-beta-D-glucuronide: synthesis, digestion and suppression of early markers of colon carcinogenesis. Cancer Res., 59, 57685772.
[Abstract/Free Full Text] - Chan,T.A., Morin,P.J., Vogelstein,B. and Kinzler,K.W. (1998) Mechanisms underlying nonsteroidal antiinflammatory drug-mediated apoptosis. Proc. Natl Acad. Sci. USA, 95, 681686.
[Abstract/Free Full Text] - Chauvier,D., Morjani,H. and Manfait,M. (2002) Ceramide involvement in homocamptothecin- and camptothecin-induced cytotoxicity and apoptosis in colon HT29 cells. Int. J. Oncol., 20, 855863.[Web of Science][Medline]
- Modrak,D.E., Rodriguez,M.D., Goldenberg,D.M., Lew,W. and Blumenthal,R.D. (2002) Sphingomyelin enhances chemotherapy efficacy and increases apoptosis in human colonic tumor xenografts. Int. J. Oncol., 20, 379384.[Web of Science][Medline]
- Nilsson,Å. (1969) The presence of sphingomyelin- and ceramide-cleaving enzymes in the small intestinal tract. Biochim. Biophys. Acta, 176, 339347.[Medline]
- Cheng,Y., Nilsson,Å., Tömquist,E. and Duan,R.D. (2002) Purification, characterization and expression of rat intestinal alkaline sphingomyelinase. J. Lipid Res., 43, 316324.
[Abstract/Free Full Text] - Duan,R.D., Cheng,Y., Hansen,G., Hertervig,E., Liu,J.J., Syk,I., Sjostrom,H. and Nilsson,Å. (2003) Purification, localization and expression of human intestinal alkaline sphingomyelinase. J. Lipid Res., 44, 12411250.
[Abstract/Free Full Text] - Duan,R.D., Bergman,T., Xu,N., Wu,J., Cheng,Y., Duan,J., Nelander,S., Palmberg,C. and Nilsson,Å. (2003) Identification of human intestinal alkaline sphingomyelinase as a novel ecto-enzyme related to the nucleotide phosphodiesterase family. J. Biol. Chem., 278, 3852838536.
[Abstract/Free Full Text] - Hertervig,E., Nilsson,Å., Nyberg,L. and Duan,R.-D. (1996) Alkaline sphingomyelinase activity is decreased in human colorectal carcinoma. Cancer, 79, 448453.
- Hertervig,E., Nilsson.Å., Björk,J., Hultkrantz,R. and Duan,R.-D. (1999) Familial adenomatous polyposis is associated with a marked decrease in alkaline sphingomyelinase activity; a key factor to the unrestrained cell proliferation. Br. J. Cancer, 81, 232236.[CrossRef][Web of Science][Medline]
- Sjöqvist,U., Hertervig,E., Nilsson,Å., Duan,R.D., Ost,A., Tribukait,B. and Lofberg,R. (2002) Chronic colitis is associated with a reduction of mucosal alkaline sphingomyelinase activity. Inflamm. Bowel Dis., 8, 258263.[CrossRef][Web of Science][Medline]
- Hertervig,E., Nilsson,Å., Cheng,Y. and Duan,R.D. (2003) Purified intestinal alkaline sphingomyelinase inhibits proliferation without inducing apoptosis in HT-29 colon carcinoma cells. J. Cancer Res. Clin. Oncol., 129, 577582.[CrossRef][Web of Science][Medline]
- Stoffel,W. (1975) Chemical synthesis of choline-labeled lacithins and sphingomyelin. Methods Enzymol., 36, 533541.
- Giebel,L.B. and Spritz,R.A. (1990) Site-directed mutagenesis using a double-stranded DNA fragment as a PCR primer. Nucleic Acids Res., 18, 4947.
[Free Full Text] - Traber,M.G., Kayden,H.J. and Rindler,M.J. (1987) Polarized secretion of newly synthesized lipoproteins by the Caco-2 human intestinal cell line. J. Lipid Res., 28, 13501363.[Abstract]
- Hedlund,M., Svensson,M., Nilsson,Å., Duan,R.D. and Svanborg,C. (1996) Role of the ceramide-signaling pathway in cytokine responses to P-fimbriated Escherichia coli. J. Exp. Med., 183, 10371044.
[Abstract/Free Full Text] - Bligh,E.H. and Dyer,W.J. (1959) A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol., 37, 911918.
- Duan,R.D. and Nilsson,Å. (1999) Enzymes hydrolysing sphingolipids in gastrointestinal tract. Methods Enzymol., 311, 276286.
- Cheng,Y., Tauschel,H.-T., Nilsson,Å. and Duan,R.-D. (1999) Administration of ursodeoxycholic acid increases the activities of alkaline sphingomyelinase and caspase-3 in rat colon. Scand. J. Gastroenterol., 34, 915920.[CrossRef][Web of Science][Medline]
- Merrill,A.H.,Jr, Schmelz,E.M., Wang,E., Schroeder,J.J., Dillehay,D.L. and Riley,R.T. (1995) Role of dietary sphingolipids and inhibitors of sphingolipid metabolism in cancer and other diseases. J. Nutr., 125, 1677S1682S.
[Abstract/Free Full Text] - Brasitus,T.A., Dudeja,P.K. and Dahiya,R. (1986) Premalignant alterations in the lipid composition and fluidity of colonic brush border membranes of rats administered 1,2 dimethylhydrazine. J. Clin. Invest., 77, 831840.[Web of Science][Medline]
- Nilsson,Å. (1968) Metabolism of sphingomyelin in the intestinal tract of the rat. Biochim. Biophys. Acta, 164, 575584.[Medline]
- Nyberg,L., Nilsson,Å., Lundgren,P. and Duan,R.-D. (1997) Localization and capacity of sphingomyelin digestion in the rat intestinal tract. J. Nutr. Biochem., 8, 112118.[CrossRef]
- Gijsbers,R., Ceulemans,H., Stalmans,W. and Bollen,M. (2001) Structural and catalytic similarities between nucleotide pyrophosphatases/phosphodiesterases and alkaline phosphatases. J. Biol. Chem., 276, 13611368.
[Abstract/Free Full Text] - Kinzler,K.W. and Vogelstein,B. (1996) Lessons from hereditary colorectal cancer. Cell, 87, 159170.[CrossRef][Web of Science][Medline]
- Fearon,E.R. and Jones,P.A. (1992) Progressing toward a molecular description of colorectal cancer development. FASEB J., 6, 27832790.[Abstract]
- Oving,I.M. and Clevers,H.C. (2002) Molecular causes of colon cancer. Eur. J. Clin. Invest., 32, 448457.[CrossRef][Web of Science][Medline]
- Hertervig,E., Nilsson,Å., Nilbert,M. and Duan,R.D. (2003) Reduction in alkaline sphingomyelinase in colorectal tumorigenesis is not related to the APC gene mutation. Int. J. Colorectal Dis., 18, 309313.[Web of Science][Medline]
- Vogelstein,B., Fearon,E.R., Hamilton,S.R., Kern,S.E., Preisinger,A.C., Leppert,M., Nakamura,Y., White,R., Smits,A.M. and Bos,J.L. (1988) Genetic alterations during colorectal-tumor development. N. Engl. J. Med., 319, 525532.[Abstract]
- Andersson,D., Liu,J.J., Nilsson,Å. and Duan,R.D. (2003) Ursolic acid inhibits proliferation and stimulates apoptosis in HT29 cells following activation of alkaline sphingomyelinase. Anticancer Res., 23, 33173322.[Web of Science][Medline]
- Pinto,M., Robine-Leon,S., Appay,M. et al. (1983) Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture. Biol. Cell, 47, 323330.[Web of Science]
- Hauri,H.P., Sterchi,E.E., Bienz,D., Fransen,J.A. and Marxer,A. (1985) Expression and intracellular transport of microvillus membrane hydrolases in human intestinal epithelial cells. J. Cell Biol., 101, 838851.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Nilsson and R.-D. Duan Absorption and lipoprotein transport of sphingomyelin J. Lipid Res., January 1, 2006; 47(1): 154 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, F. Liu, A. Nilsson, and R.-D. Duan Pancreatic trypsin cleaves intestinal alkaline sphingomyelinase from mucosa and enhances the sphingomyelinase activity Am J Physiol Gastrointest Liver Physiol, November 1, 2004; 287(5): G967 - G973. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






