Skip Navigation


Carcinogenesis Advance Access originally published online on March 19, 2004
Carcinogenesis 2004 25(8):1387-1394; doi:10.1093/carcin/bgh143
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/8/1387    most recent
bgh143v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Seo, B.-R.
Right arrow Articles by Lee, K.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seo, B.-R.
Right arrow Articles by Lee, K.-T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis vol.25 no.8 © Oxford University Press 2004; all rights reserved.

ARTICLE

Saucernetin-7 isolated from Saururus chinensis inhibits proliferation of human promyelocytic HL-60 leukemia cells via G0/G1 phase arrest and induction of differentiation

Bo-Rim Seo, Kyung-Won Lee, Joohun Ha1, Hee-Jun Park2, Jong-Won Choi3 and Kyung-Tae Lee4

College of Pharmacy, Kyung-Hee University, Hoegi-Dong, Seoul 130-701, Korea, 1 College of Medicine, Kyung Hee University, Hoegi-Dong, Seoul 130-701, Korea, 2 Division of Applied Plant Sciences, Sang-Ji University, Woosan-Dong, Wonju 220-702, Korea and 3 College of Pharmacy, Kyungsung University, Dayeon-Dong, Pusan, 608-736, Korea

4 To whom correspondence should be addressed Email: ktlee{at}khu.ac.kr


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Disussion
 References
 
In the present study, we investigated the in vitro effect of saucernetin-7, which is a dineolignan isolated from Saururus chinensis, on the proliferation, cell cycle-regulation and differentiation of HL-60 human promyelocytic leukemia cells. Saucernetin-7 potently inhibited the proliferation of HL-60 cells in both a dose- and time-dependent manner with an IC50, ~5 µM. DNA flow-cytometry indicated that saucernetin-7 markedly induced a G1 phase arrest of HL-60 cells. Among the G1 phase cell cycle-related proteins, the levels of cyclin-dependent kinase (CDK)6 and cyclin D1 were reduced by saucernetin-7, whereas the steady-state levels of CDK2, CDK4, cyclin D2, cyclin D3 and cyclin E were unaffected. The protein and mRNA levels of a CDK inhibitor p21CIP1/WAF1, but not p27KIP1, were markedly increased by saucernetin-7 and p21CIP1/WAF1 induction is likely to occur at the transcriptional level because actinomycin D blocked this induction. In addition, saucernetin-7 markedly enhanced the binding of p21CIP1/WAF1 with CDK2 and CDK6, resulting in the reduced activity of both kinases and the hypophosphorylation of Rb protein. We furthermore suggest that saucernetin-7 is a potent inducer of the differentiation of HL-60 cells, based on observations such as a reduction of the nitroblue tetrazolium level, an increase in the esterase activities and phagocytic activity, morphology changes, and the expression of CD14 and CD66b surface antigens. In conclusion, the onset of saucernetin-7-induced the G0/G1 arrest of HL-60 cells prior to the differentiation is linked to a sharp up-regulation of the p21CIP1/WAF1 level and a decrease in the CDK2 and CDK6 activities. This is the first report demonstrating that saucernetin-7 potently inhibits the proliferation of human promyelocytic HL-60 cells via the G1 phase cell cycle arrest and differentiation induction.

Abbreviations: BrdU, 5-bromo-2'-deoxyuridine; CDK, cyclin-dependent kinases; CKI, cyclin-dependent kinase inhibitor; ELISA, enzyme-linked immunoassay; FACS, fluorescence-activated cell sorting; NBT, nitrobluetetra-zolium; Rb, retinoblastoma


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Disussion
 References
 
Hematopoietic tumors often arise as a consequence of the uncontrolled proliferation of immature blasts and eventually fail to terminally differentiate into mature blood cells (1). Therefore, the engagement of a maturation program requires the arrest of the proliferating cell cycle (2). The cell cycle in eukaryotes is regulated by cyclin-dependent kinases (CDKs). CDK4 and CDK6 are thought to be involved in early G1, whereas CDK2 is required to complete G1 and initiate S phase (3). By controlling the level of CDK activity, the CDK regulators can also control the cell cycle-commitment (4). These include activators such as the cyclins as well as the inhibitors generally known as CKIs (CDKs inhibitors). To date, there are two known classes of mammalian CKIs. One group is the CIP/KIP family, including p21 (CIP/WAF1), p27 (KIP1) and p57 (KIP2), with a broad specificity (5,6), and the other is the INK 4 family including p15 (INK4B), p16 (INK4A), p18 (INK4C) and p19 (INK4D), which target CDK4 and CDK6 (5).

The primary substrates of CDK4/6 and CDK2 in G1 progression are members of the retinoblastoma protein family, Rb, p107 and p130 (7,8). The hypophosphorylated Rb proteins bind to the E2F family of transcription factors, an important regulator of the cell cycle-progression, and keep them inactive during the M and G0 phase. The activity of the Rb proteins is modulated by the sequential phosphorylation by CDK4/6-cyclin D and CDK2-cyclin E complexes (9). The hyperphosphorylated Rb proteins release the E2F molecules, which next bind to their hypophosphorylated isoforms, allowing them to carry out their specific tasks in the G1/S phase progression (5). Therefore, the growth arrest associated with differentiation could be achieved by several mechanisms including the down-regulation of CDKs, cyclins or the up-regulation of the CKIs or both.

In addition to the cell cycle arrest, an inducer of differentiation commonly deserves the therapeutic importance. Several compounds including dimethyl sulfoxide, retinoic acid, phorbol ester and 1,25-dihydroxy vitamin D3 were known to induce acute promyelocytic leukemia (AML) cells to differentiate toward mature cells (10). The HL-60 cell line, which was derived from an AML patient, provides a useful model system for examining the cellular and molecular events involved in the differentiation process (11). The terminal differentiation of HL-60 cells can be monitored by the changes in the morphological, biochemical and immunological properties. The differentiated HL-60 phenotype is characterized by a growth inhibition, an increased adherence, a loss of the cell surface transferring receptors, an increase in the level of the monocytic surface markers, the induction of {alpha}-naphthyl acetate (non-specific) esterase and certain patterns of protein phosphoryl-ation (12).

Therefore, as a part of our screening program to evaluate the chemopreventive potential effect of natural compounds, we investigated the effect of saucernetin-7 and saucernetin-8 (Figure 1A), which were isolated from Saururus chinensis (Saururaceae) and classified into dineolignans, on HL-60 cell growth. The whole plant of S.chinensis (Lour.) Baill (Saururaceae) has long been used for medicinal purposes as a result of its anti-inflammatory activity (13). In addition, it was demonstrated previously that the methanol extract from S.chinensis inhibited the LPS-induced iNOS and COX-2 expression by blocking NF-{kappa}B activation (14).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1. Effect of saucernetin-7 on the growth inhibition of HL-60 cells in vitro. (A) Chemical structures of saucernetin-8 (1) and saucernetin-7 (2). (B) Exponentially growing cells were treated with the indicated concentration of saucernetin-7 for 72 h (filled circle, control; filled square, 2.5 µM; filled triangle, 5 µM; filled diamond, 10 µM; *, 20 µM). Cell growth inhibition was assessed by a BrdU incorporation assay as described in Materials and methods. The growth of the HL-60 cells was significantly inhibited in a dose-dependent manner. The data represent the mean ± SD of three independent experiments.

 
The anticancer effect and their molecular mechanism of saucernetin-7 and saucernetin-8 have not yet been established although a similar structure of manassantin A was reported to have neuroleptic properties and cause a hypothermic response in mice (15). Based on the cytotoxicity data, saucernetin-7 showed more significant effect than that of saucernetin-8. Here we report the effects of saucernetin-7 on the proliferation, cell cycle-regulation and differentiation of human leukemia HL-60 cells.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Disussion
 References
 
Materials
The saucernetin-7 and saucernetin-8 used in this study was isolated from the underground parts of S.chinensis (2 kg) as described previously (14). The physicochemical data of saucernetin-7 and saucernetin-8 are as follows. Saucernetin-7 (C41H48O11): pale brown solid, (c 0.01, MeOH); IR (KBr) nmax (cm–1): 3500, 1610, 1590; EIMS (rel. int.): m/z 716 (32, [M]+), 698 (7, [M-H2O]+), 538 (41, [M-C10H10O3]+), 520 (13), 370 (69), 339 (50), 192 (100), 165 (94), 151 (85), 121 (68). Saucernetin-8 (C42H52O11): pale brown solid, (c 0.01, MeOH); IR (KBr) nmax (cm–1): 3500, 1610, 1590; EIMS (rel. int.): m/z 732 ([M]+, 43), 538 (96, [M-C11H14O3]+), 520 (45), 370 (10), 357 (8), 192 (94), 180 (38), 165 (100). The structures of these compounds were fully elucidated based on the spectroscopic methods and were confirmed by a comparison of their spectroscopic data with those reported in the literature (16). The saucernetin-7 and saucernetin-8 isolated were checked by HPLC and were found to be >98% pure.

Cell culture and MTT assay
The P388 mouse leukemia, L-1210 mouse leukemia, 3LL Lewis mouse lung carcinoma, U-937 human histocytic lymphoma, HL-60 human promyelocytic leukemia, SNU-C5 human colon cancer and HepG2 human hepatoma cell lines were obtained from the Korean Cell Line Bank (KCLB, Seoul, Korea). The cells were cultured in RPMI 1640 medium (Life Technologies, Grand Island, NY) with 10% fetal bovine serum in a 37°C, CO2 incubator in the presence or absence of the chemicals. The cytotoxicity was measured using a MTT assay. Briefly, the cells (5 x 104) were seeded in each well containing 100 ml of the RPMI medium supplemented with 10% FBS in a 96-well plate. After 24 h, various concentrations of either saucernetin-7 or saucernetin-8 were added. After 48 h, 50 ml of MTT (5 mg/ml stock solution, Sigma, St Louis, MO) was added and the plates were incubated for an additional 4 h. The medium was discarded and the formazan blue, which was formed in the cells, was dissolved with 100 ml DMSO. The optical density was measured at 540 nm.

Growth inhibition assay
The in vitro growth inhibition effect of saucernetin-7 on the HL-60 cells was determined by using a cell proliferation enzyme-linked immunoassay (ELISA) system (version 2, Amersham Bioscience, Uppsala, Sweden) according to the manufacturer's instructions. Briefly, 2 x 105 cells/ml were added to each well of the 96-well plates in the presence of various saucernetin-7 concentrations. After incubating the cells for 24–72 h at 37°C, a 5-bromo-2'-deoxyuridine (BrdU) labeling reagent was added, and the cells were incubated for an additional 2 h. The BrdU incorporated into the cellular DNA was stained with peroxidase-labeled anti-BrdU. After incubating the cells for 90 min, a 3,3',5,5'-tetramethylbenzidine substrate was added and the optical density was measured using an ELISA reader (Model Power Wave 340, Bio-Tek Instruments, Winooski, VT) at 450 nm.

Flow-cytometric cell analysis
The cell cycle-distribution has been described previously (17). Briefly, the cells were collected by centrifugation at 1500 r.p.m. for 4 min. The cell pellets were then resuspended in 1 ml phosphate-buffered saline (PBS), fixed in 70% ice-cold ethanol and kept in a freezer overnight. The fixed cells were centrifuged, washed once in PBS and resuspended in 100 µl of a phosphate–citrate buffer for 30 min at room temperature to wash out any degraded DNA from the apoptotic cells. The cells were then collected by centrifugation at 2000 r.p.m., and the cell pellets were washed twice with PBS and resuspended in PBS containing 50 mg/ml propidium iodide and 100 µg/ml DNase-free RNase A. The cell suspension, which was hidden from light, was incubated for 30 min at 37°C and analyzed using the fluorescence-activated cell sorting (FACS) cater-plus Flow cytometry (Becton Dickinson, Heidelberg, Germany).

Western blot analysis
Samples containing 30 µg of the total proteins were resolved by a 12% SDS–PAGE, gel transferred onto a nitrocellulose membrane by electroblotting, and were then probed with anti-p21, anti-p27, anti-CDK2, anti-CDK4, anti-CDK6, anti-cyclin D1, anti-cyclin D2, anti-cyclin D3, anti-cyclin E, anti-Rb and anti-ß actin antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). The blots were developed using an enhanced chemiluminescence (ECL) kit (Amersham Bioscience, Uppsala, Sweden).

Immunoprecipitation
Samples of the total protein (100 µg) were incubated with the anti-CDK2, anti-CDK4 and anti-CDK6 polyclonal antibodies for 2 h at 4°C, followed by incubation with 20 µl of the protein A/G–Sepharose beads (Sigma, St Louis, MO) for 1 h. The protein complexes were washed four times with an immunoprecipitation buffer [50 mM Tris–HCl, pH 7.4, 0.5% NP-40, 150 mM NaCl, 50 mM NaF, 0.2 mM sodium orthovanadate, 1 mM dithiothreitol (DTT), 20 µg/ml aprotinin, 20 µg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride], and released from the beads by boiling in 2x SDS sample buffer (125 mM Tris–HCl, pH 6.8, 4% SDS, 10% ß-mercaptoethanol, 2% glycerol, 0.02% bromophenolblue) for 5 min; the reaction mixture was then resolved by a 12% SDS–PAGE gel, transferred onto a nitrocellulose membrane by electroblotting and probed with the anti-p21 monoclonal antibodies. The blot was developed using an ECL kit.

Kinase activity assay
The total lysates (500 µg protein) were prepared and immunoprecipitated with 5 µg each of anti-CDK2, anti-CDK4 and anti-CDK6 polyclonal antibodies as described above. Fifty microliters of protein A–Sepharose CL-4B (Amersham Bioscience) prepared at 6 mg/ml in 0.1 M potassium phosphate buffer (pH 8.0), was added to each sample and incubated for 18 h at 4°C. Immunocomplexes were recovered by centrifugation for 30 min at 14 000 g and washed three times in a lysis buffer. The immunocomplexes were then resuspended and washed three times with a kinase buffer (50 mM Tris–HCl, pH 7.4, 1 mM DTT, 10 mM MgCl2, 2.5 mM EDTA, 10 mM ß-glycerophosphate, 1 mM NaF for CDK-4; 50 mM Tris–HCl, pH 7.4, 1 mM DTT, 10 mM MgCl2 for CDK-2). The kinase reactions were carried out in a final volume of 40 µl containing 20 µM ATP, 25 µCi [{gamma}-32P]ATP, 2 µg histone H1 (Calbiochem, San Diego, CA) for CDK2 or 1 µg GST–retinoblastoma (Santa Cruz) for CDK4 and CDK6. The reactions were performed for 20 min at 30°C and quenched by adding an equal volume of a 2x SDS loading buffer. After boiling for 10 min, the reaction products were separated by 12% SDS–PAGE gel and the phosphorylated proteins were detected by autoradiography.

Reverse transcription PCR of p21CIP1/WAF1
The total cellular RNA was isolated using Easy Blue® kits according to the manufacturer's instructions (iNtRON Biotechnology, Seoul, Korea). From each sample, 1 µg of RNA was reverse-transcribed using a MuLV reverse-transcriptase (Takara Biomedicals, Shiga, Japan), 1 mM deoxyribonucleoside triphosphates (dNTP), and 0.5 µg/µl of oligo (dT12-18) (Bioneer, Seoul, Korea). The PCR analyses were then performed on the aliquots of the cDNA preparations to detect the p21 and ß-actin gene expression using a thermal cycler (Perkin Elmer Cetus, Foster City, CA). The reactions were carried out in a volume of 25 µl containing (final concentration) 2 U of Taq DNA polymerase, 0.2 mM dNTP, x10 reaction buffer and 100 pmol of 5' and 3' primers. For p21 amplification (18), the PCR primers were 5' to 3' AGGAGGCCCGTGAG-CGATGGAAC and ACAAGTGGGGAGGAGGAAGTAGC (Bioneer). The PCR cycles were as follows: 1 min at 94°C for denaturation, 1 min at 59°C for annealing, 1 min at 72°C for polymerization, 26 cycles. For ß-actin amplification, the PCR primers were 5' to 3' GATATCGCCGCGCTCGTCGTCGAG and CAGGAAGGAAGGCTGGAAGAGTGC (Bioneer). PCR cycles were as follows: 1 min at 94°C for denaturation, 1 min at 61°C for annealing, 1 min at 72°C for polymerization, 20 cycles. The PCR products were analyzed by 2.5% agarose gel electrophoresis and visualized by ethidium bromide staining and UV irradiation.

Differentiation assay
(i) Nitrobluetetra-zolium (NBT) reduction test: the percentage of HL-60 cells capable of reducing NBT was measured by counting the number of cells containing the precipitated formazan particles after the cells had been incubated with the NBT (1.0 mg/ml) at 37°C for 30 min. 12-O-Tetradecanoylphorbol-13-acetate was used to stimulate the formation of formazan. (ii) Phagocytosis test: the HL-60 cells (1 x 106 cells/ml) were suspended in serum-free RPMI 1640 medium containing 0.2% of the latex particles (average diameter, 0.81 µM) and incubated at 37°C for 4 h. After incubation, the cells were washed once with PBS. The cells containing >10 latex particles were scored as being phagocytic cells (19). (iii) Esterase activity test: a smear preparation was chemically stained for {alpha}-naphthyl acetate esterase and naphthol AS-D chloroacetate esterase using the standard techniques (19). (iv) Flow cytometry: the HL-60 cells (2 x 105 cells/ml) exposed to saucernetin-7 were collected and washed twice with ice-cold PBS. The cells were then incubated with the direct FITC-labeled anti-CD 14 or anti-CD 66b antibodies (Pharmingen, San Diego, CA) on ice for 30 min, washed twice with PBS, and the level of antibody binding to the cells was quantified using FACS flow cytometry (Becton Dickinson).

Data analysis
The data are reported as a mean ± SD of the values from three independent determinations. All the experiments were done at least three times, each time with three or more independent observations. Statistical analysis was performed using a Student's t test.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Disussion
 References
 
Effects of saucernetin-7 and saucernetin-8 on growth inhibition of HL-60 cells
This study was initiated by examining the cytotoxicities of the saucernetin-7 and saucernetin-8 using a MTT assay on the various cancer cells (Table I). The saucernetin-7 showed different degrees of cytotoxicity on these cells as judged by the IC50, and its values ranged from 3.7 to 29.4 µM, whereas saucernetin-8 showed a lower potency of inhibition (IC50, 15.4–45.2 µM). Among the tested cancer cell lines, the HL-60 cells were the most vulnerable to saucernetin-7. The effect of saucernetin-7 on the proliferation of HL-60 cells was also examined using a cell proliferation ELISA system. The cell growth was inhibited in a concentration- and time-dependent manner (Figure 1B), showing the antiproliferative activity of saucernetin-7. The inhibitory effect became apparent at a concentration of 5 µM saucernetin-7, and no cytocidal effects were observed under this condition. Therefore, this concentration was used throughout the study.


View this table:
[in this window]
[in a new window]
 
Table I. Cytotoxic activity of saucernetin-7 and saucernetin-8 on cancer cell growth in vitro

 
Cell cycle-analysis and expression of cell cycle-regulatory proteins in HL-60 cells
The effect of saucernetin-7 on the cell cycle in HL-60 cells was determined by FACS. As shown in Figure 2A, DNA flow-cytometric analysis indicated that a saucernetin-7 treatment for 24 h led to a significant increase in the G1 phase of the cell cycle, whereas a decrease in the G2/M and S phase was detected. In addition, saucernetin-7 induced the cell cycle arrest in HL-60 cells in a time-dependent manner (Figure 2B). The CDK4/6-cyclin D and CDK2-cyclin E protein levels were next examined under the same conditions because CDK4 and CDK6 are believed to be involved in the early G1, whereas CDK2 is necessary to complete the G1 phase and initiate the S phase. Saucernetin-7 down-regulated the CDK6 and cyclin D1 protein levels, whereas CDK2, CDK4, cyclin D2, D3 and cyclin E were unaffected (Figure 2C). Therefore, these results indicate that the inhibitory effect of saucernetin-7 on cell proliferation is a result of the induction of the G1 phase arrest of the HL-60 cell cycle through changes in the G1 phase-regulatory proteins.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Effect of saucernetin-7 on the DNA content and the expression of the cell cycle-related proteins from the HL-60 cells. (A) The cells were exposed to 5 µM saucernetin-7 for 24 h, washed and then harvested. The cells were then fixed and stained with propidium iodide and the DNA content was analyzed by flow cytometry (FACS). (B) The cell number percentage in each phase (sub G1, G1, S and G2/M) of the cell cycle was calculated. (Filled diamond, sub-G1 phase; filled square, G1 phase; filled triangle, S phase; x, G2/M phase.) (C) The protein extracts were harvested from HL-60 cells exposed to 5 µM saucernetin-7 for the indicated time period and were subjected to western blot analysis using the specific antibodies for the cell cycle-related proteins. The experiments were repeated three times with similar results.

 
Effect of saucernetin-7 on p21CIP/WAF1 and p27KIP1 expression in HL-60 cells
Because saucernetin-7 induced a G1 arrest in HL-60 cells, we next examined the change in the p21CIP1/WAF1 and p27KIP1 proteins, which are the CKIs related with the G1 phase arrest. The p21CIP1/WAF1 protein level increased in a time-dependent manner, whereas no detectable change was observed in the p27KIP1 level (Figure 3A). In accordance with the protein level, the p21CIP1/WAF1 mRNA level also increased in a time-dependent manner as evaluated by the semi-quantitative RT–PCR (Figure 3B). In order to determine if the increase in the p21CIP1/WAF1 mRNA level is due to either the up-regulation of p21CIP1/WAF1 gene expression or an increase in the p21CIP1/WAF1 mRNA stability, the HL-60 cells were incubated for the indicated time period in the presence or absence of 4 µg/ml actinomycin D (transcription inhibitor) following a 48 h treatment with 5 µM saucernetin-7. The saucernetin-7-induced p21CIP1/WAF1 mRNA became barely detectable after 4 h incubation with actinomycin D, indicating that an increase in the p21CIP1/WAF1 mRNA level was due to the transcriptional up-regulation of p21CIP1/WAF1 gene expression.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. The effect of saucernetin-7 on p21CIP1/WAF1 and p27KIP1 expression in the HL-60 cells. The cells were harvested at the indicated times after incubation with 5 µM of saucernetin-7. (A) Protein levels of p21CIP1/WAF1 and p27KIP1. Aliquots of 30 µg of the protein extracts were analyzed by 12% SDS–PAGE, transferred to a nitrocellulose membrane, and then immunoblotted with the indicated antibodies, p21CIP1/WAF1 and p27KIP1. (B) The effect of saucernetin-7 on p21CIP1/WAF1 mRNA expression. The total RNA was extracted and reverse transcription PCR of p21CIP1/WAF1 or ß-actin was performed as described in Materials and methods. (C) Effect of actinomycin D on p21CIP1/WAF1 mRNA expression. The cells were treated with 5 µM saucernetin-7 for 48 h, then harvested at the indicated time after incubation with 4 µg/ml actinomycin D. RT–PCR was performed to examine the mRNA level of p21CIP1/WAF1. The results shown are representative of three independent experiments.

 
Effect of saucernetin-7 on the p21CIP/WAF1 level of the CDK immune complex and on the CDK-associated kinase activity
Next, we questioned whether or not saucernetin-7-induced p21CIP1/WAF1 would be detected in the complexes with the CDKs during the cell cycle. The CDK2, CDK4 and CDK6 complexes were immunoprecipitated from the HL-60 cells, which were either treated or not treated with saucernetin-7, and the co-immunoprecipitated p21CIP1/WAF1 level in each immune complex was determined by western blot analysis using anti-p21 antibodies. As shown in Figure 4A, the p21CIP1/WAF1 levels in the CDK2 and CDK6 immune complex of the saucernetin-7-treated cells were distinctively higher than in those of the untreated cells. However, there was essentially no difference in the p21CIP1/WAF1 level of the CDK4 immune complex regardless of the saucernetin-7 treatment. Such changes in the p21CIP1/WAF1 level in each CDK complex was inversely correlated with the in vitro CDK kinase activity, which was directly measured by an immune complex using the histone H1 (for CDK2) or GST-Rb fusion protein (for CDK 4 and CDK6) as substrates; the CDK2- and CDK6-associated kinase activity dramatically decreased in the HL-60 cells, which were treated with saucernetin-7 (Figure 4B). The CDK4 activity was not altered in response to saucernetin-7. In addition, the decrease in the CDK2 and CDK6-associated kinase activity was associated with the underphosphorylation of the Rb protein (Figure 4C). Collectively, these results suggest that the p21CIP1/WAF1 protein might play a key role in the G1 phase arrest although it increased binding to CDK2 and CDK6 in the saucernetin-7-treated HL-60 cells, which leads to the down-regulation of CDK2 and CDK6 kinase activity and hence to the cell cycle arrest.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. (A) Association of p21CIP1/WAF1 with CDKs in HL-60 cells. The cells were treated with (+) or without (–) saucernetin-7 at a dose of 5 µM for 72 h. The total lysates were immunoprecipitated using anti-CDK2, -CDK4 and -CDK6 antibodies. The level of bound p21CIP1/WAF1 in each immune complex was determined by western blot analysis. (B) CDK-associated kinase activities. The cells were treated without (–) or with (+) saucernetin-7 at a dose of 5 µM for 72 h. Each kinase activity was measured by the immune complex using histone H1 (for CDK2) or GST-Rb (for CDK4 and 6) as a substrate. (C) Phosphorylation of Rb protein. The total protein lysates were resolved by 7.5% SDS–PAGE, transferred to a nitrocellulose membrane and immunoblotted with the anti-Rb polyclonal antibodies. The hypophosphorylated Rb showed a higher electrophoretic mobility than the hyperphosphorylated Rb. The data shown are representative of at least three independent experiments.

 
Effect of saucernetin-7 on differentiation of HL-60 cells
In order to determine whether the growth inhibition of HL-60 cells by saucernetin-7 is associated with terminal differentiation, the HL-60 cells were incubated with saucernetin-7 at a concentration of 2.5 and 5 µM for 72 h. As shown in Table II, ~50% of the cells treated with 5 µM saucernetin-7 became stained with NBT. In contrast, only 4.5% of the cells were stained in the untreated cells. The potent inducer of HL-60 cell differentiation, 1{alpha},25(OH)2D3 (20 nM), produced an NBT-reproducible cell rate of 36.5%. Treatment of the HL-60 cells with 5 µM saucernetin-7 for 72 h resulted in a 38.1% increase of naphthyl AS-D chloroacetate esterase, but the effect on the {alpha}-naphthyl acetate esterase activity was relatively mild. Moreover, the cells treated with these compounds showed an apparent phagocytic activity. In addition, as shown in Figure 5A, 5 µM saucernetin-7 significantly increased the expression of both membrane antigens, CD14 and CD66b. When the morphological changes were observed by Wright-Giemsa staining, the saucernetin-7-treated cells became larger and exhibited granulation appearance, which are a characteristic of differentiated cells, such as the monocyte/marcrophage and granulocytes (Figure 5C). Therefore, we concluded that saucernetin-7 induced differentiation of human promyelocytic leukemia cells to myelocyte/marcrophage and granulocytes.


View this table:
[in this window]
[in a new window]
 
Table II. Induction of the differentiation markers in HL-60 cells after the saucernetin-7 treatment for 3 days

 


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5. The differentiation-inducing effect of saucernetin-7. The HL-60 cells were treated with or without 5 µM saucernetin-7 for 72 h. (A) FACS analysis of the expression of the CD14 and CD66b antigen in HL-60 cells treated with 5 µM saucernetin-7 for 72 h. (B) Morphology of the HL-60 cells. After the treatment with saucernetin-7 for 72 h, the cells were fixed and stained with May-Grunwald Giemsa, x800. (a) Untreated control; (b) treated with 5 mM saucernetin-7; (c) treated with 0.02 mM 1{alpha},25(OH)2D3.

 

    Disussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Disussion
 References
 
This study demonstrates that saucernetin-7 potently causes the cell cycle arrest in the HL-60 cells, leading to the inhibition of the cell proliferation and the induction of differentiation. When the structural characteristic of saucernetin-7 was compared with that of saucernetin-8, saucernetin-7 has methylenedioxy and 3,4-dimethoxy substituents in the side chains resulting in the dissymmetric structure, while saucernetin-8 has a C-2 symmetric structure by the same 3,4-dimethoxy substituents in the side chains. Based on these points, it is speculated that the cytotoxicity of saucernetin-7 may be due to the methylenedioxy substituent or the dissymmetric structure. We first observed that saucernetin-7 inhibited the HL-60 cell proliferation in a dose- and time-dependent manner, which was assessed by the cell proliferation ELISA system (Figure 1B). This observation prompted us to investigate the effect of saucernetin-7 on the cell cycle-regulation and the characteristics of HL-60 differentiation.

The cell cycle-analysis revealed that saucernetin-7 could markedly induce a G1 phase arrest in HL-60 cells, but there was reduction effect on the G2/M and S phase. Therefore, we next investigated the G1 phase-related cell cycle-regulators, CKIs, CDKs and cyclins. First, the G1 phase arrest in the HL-60 cells was associated with a marked up-regulation of the p21CIP1/WAF1 protein and mRNA. Since the p21CIP1/WAF1 mRNA level depends not only on the gene transcriptional activity but also on mRNA stability, we further examined whether or not saucernetin-7 increased the stability of p21 mRNA through a treatment of 4 µg/ml actinomycin D, a transcription inhibitor. Actinomycin D markedly inhibited the saucernetin-7-induced p21 mRNA expression level. This result indicated that p21CIP1/WAF1 mRNA was transcriptionally up-regulated by saucernetin-7, and saucernetin-7 does not stabilize the p21CIP1/WAF1 message.

The increased p21CIP1/WAF1 level in the quiescent and terminally differentiation cells suggests that this protein plays a crucial role in preventing the cells from re-entering the cell cycle, which is an absolute requirement for terminal differentiation (20,21). The induction of p21CIP1/WAF1 by DNA damage requires p53 (22). However, the p21CIP1/WAF1 gene can also be up-regulated via the p53-independent pathways by serum stimulation (21) as well as during cellular senescence (23) and differentiation (21). Saucernetin-7 rapidly enhanced the p21CIP1/WAF1 gene expression level in HL-60 cells after 24 h, where the p53 gene was deleted, and the gene expression was absent (24). Therefore, a p53-independent pathway exists in the induction of p21CIP1/WAF1 by saucernetin-7. Recent studies have demonstrated that the induction of p21CIP1/WAF1 depends on Raf/Erk signaling (24,25) and protein kinase C (PKC) signaling (26). In addition, AP-1 is known to bind directly to the promoter region of the p21CIP1/WAF1 gene, and thus regulates the expression level of this gene (27). Indeed, we examined the effect of extracellular signal-regulated protein kinase (ERK) MAP kinase, p38 MAP kinase, PKC and phosphatidylinositol-3-OH kinase (PI3K) on saucernetin-7-induced p21CIP1/WAF1 protein level. However, the p21CIP1/WAF1 protein level was unaffected by a pre-treatment with 20 µM U0126 (a specific inhibitor of the mitogen-activated protein kinase 1 and 2), 10 µM SB203580 (a specific inhibitor of p38 MAP kinase), 20 µM LY294002 (a specific PI3K inhibitor) and 1 µM GF109203 (a specific PKC inhibitor) (data not shown). Therefore, saucernetin-7 is likely to up-regulate p21CIP1/WAF1 transcription through a pathway that is independent of these kinase signal pathways in HL-60 cells.

Among the CDKs that regulate the cell cycle, CDK2, CDK4 and CDK6 are activated in association with the D-type cyclins or cyclin E during the G1 progression and the G1–S transition. This study revealed that the CDK6 and cyclin D1 expression levels were decreased in the saucernetin-7-treated HL-60 cells, but those of CDK2, CDK4, cyclin D2, cyclin D3 and cyclin E were not. In addition, the accumulation of the p21CIP1/WAF1 protein in association with the G1 arrest was detected largely in the complexes with CDK2 and CDK6. The decreased CDK6 and cyclin D1 level and the increased forms of the p21CIP1/WAF1-CDK2 and p21CIP1/WAF1-CDK6 complexes support the notion that saucernetin-7 markedly decreased the CDK2- and CDK6-associated kinase activity in the HL-60 cells. Furthermore, the reduced kinase activities of CDK2 and CDK6 were accompanied by the under-phosphorylation of the Rb protein, which is known to sequester the transcription factor, E2F, thereby preventing the cells from further entering the cell cycle-progression. Overall, the blocking G1 in the HL-60 cells from entry into the S-phase appears to be mediated by the down-regulation of the CDK2- and CDK6-associated kinase activity in association with the induction of CKI, p21CIP1/WAF1.

These anti-proliferative effects were also related to the terminal differentiation. Terminal differentiation in the diverse cell types occurring either spontaneously or as a consequence of a treatment with the specific inducing agents correlates with an irreversible loss of the proliferative potential (17). In this regard, the differentiation effect of saucernetin-7 was examined in the present study. Saucernetin-7 significantly induced differentiation in the HL-60 promyelocytic leukemia cells, which are widely used as a model system for the differentiation study. This effect of saucernetin-7 was confirmed with a NBT reduction test, esterase activity assay, phagocytosis and expression of cell surface antigens. These results indicate that saucernetin-7 is a new potent inducer of differentiation on the HL-60 human leukemia cells to monocyte/marcrophage and granulocyte. To our knowledge, this is a first demonstration that saucernetin-7 exerts an anti-proliferative effect via cell cycle arrest, which precedes a differentiation-inducing effect on the HL-60 cells.

In summary, saucernetin-7 inhibits the cell proliferation of HL-60 cells by not only arresting the G1 phase cell cycle through the down-regulation of the CDK2- and CDK6- associated kinase activity in association with the induction of CKI, p21CIP1/WAF1 but also inducing differentiation. Finally, these results suggest that saucernetin-7 may be useful as one of the investigational drugs for treating leukemia patients.


    Acknowledgments
 
This work was supported by a grant no. R13-2002-020-01002-0 from the Korea Science & Engineering Foundation.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Disussion
 References
 

  1. Sawyers,C.L., Denny,C.T. and Witte,O.N. (1991) Leukemia and the disruption of normal hematopoiesis. Cell, 64, 337–350.[CrossRef][Web of Science][Medline]
  2. Steinman,R.A. (2002) Cell cycle regulators and hematopoiesis. Oncogene, 21, 3403–3413.[CrossRef][Web of Science][Medline]
  3. Furstenthal,L., Swanson,C., Kaiser,B.K., Eldridge,A.G. and Jackson,P.K. (2001) Triggering ubiquitination of a CDK inhibitor at origins of DNA replication. Nat. Cell Biol., 3, 715–722.[CrossRef][Medline]
  4. Sherr,C.J. (1996) Cancer cell cycles. Science, 274, 1672–1677.[Abstract/Free Full Text]
  5. Sherr,C.J. and Roberts,J.M. (1999) CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev., 13, 1501–1512.[Free Full Text]
  6. Morgan,D.D. (1997) Cyclin dependent kinases: engines, clocks, and microprocessors. Annu. Rev. Cell Dev. Biol., 13, 261–291.[CrossRef][Web of Science][Medline]
  7. Yu,J.T., Foster,R.G. and Dean,D.C. (2001) Transcriptional repression by RB-E2F and regulation of anchorage-independent survival. Mol. Cell. Biol., 21, 3325–3335.[Abstract/Free Full Text]
  8. Adams,P.D. (2001) Regulation of the retinoblastoma tumor suppressor protein by cyclin/CDKs. Biochim. Biophys. Acta, 1471, 123–133.[CrossRef]
  9. Lundberg,A.S. and Weinberg,R.A. (1998) Functional inactivation of the retinoblastoma protein requires sequential modification by at least two distinct cyclin-cdk complexes. Mol. Cell. Biol., 18, 753–761.[Abstract/Free Full Text]
  10. Brackman,D., Lund-Johansen,F. and Aarskog,D. (1995) Expression of cell surface antigens during the differentiation of HL-60 cells induced by 1,25-dihydroxyvitamin D3, retinoic acid and DMSO. Leuk. Res., 19, 57–64.[CrossRef][Medline]
  11. Drexler,H.G., Quentmeier,H., MacLeod,R.A., Uphoff,C.C. and Hu,Z.B. (1995) Leukemia cell lines: in vitro models for the study of acute promyelocytic leukemia. Leuk. Res., 19, 681–691.[CrossRef][Web of Science][Medline]
  12. Yam,L.T., Li,C.Y. and Crosby,W.H. (1971) Cytochemical identification of monocytes and granulocytes. Am. J. Clin. Pathol., 55, 283–290.[Web of Science][Medline]
  13. Chung,B.S. and Shin,M.G. (1990) Dictionary of Korean Folk Medicine. Young Lim Sa, Seoul.
  14. Kim,R.G., Shin,K.M., Kim,Y.K., Jeong,H.J., Ha,J., Choi,J.W., Park,H.J. and Lee,K.T. (2003) Inhibition of methanol extract from the aerial parts of Saururus chinensis on lipopolysaccharide-induced nitric oxide and prostagladin E2 production from murine macrophage RAW 264.7 cells. Biol. Pharm. Bull., 26, 481–486.[Medline]
  15. Rao,K.V. and Puri,V.N. (1988) Hypothermic response produced by saururuslignan A, a novel neuroleptic agent. Life Sci., 42, 2717–2720.[Medline]
  16. Min,M., Jinlan,R. and Rao,K.V. (2001) Studies on chemical constituents of Saururus chinensis (I). Zhongcaoyao, 32, 9–11.
  17. Miura,D., Manabe,K., Ozono,K., Saito,M., Gao,Q., Norman, A.W. and Ishizuka,S. (1999) Antagonistic action of novel 1{alpha},25-dihydroxyvitamin D3-26,23-lactone analogs on differentiation of human leukemia cells (HL-60) induced by 1{alpha},25-dihydroxyvitamin D3. J. Biol. Chem., 274, 16392–16399.[Abstract/Free Full Text]
  18. Hoffman,B. and Liebermann,D.A. (1994) Molecular controls of apoptosis: differentiation/growth arrest primary response genes, proto-oncogenes, and tumor suppressor genes as positive and negative modulators. Oncogene, 9, 1807–1812.[Web of Science][Medline]
  19. Jeong,S.H., Koo,S.J., Choi,J.H., Park,J.H., Ha,J., Park,H.J. and Lee,K.T. (2002) Intermedeol isolated from the leaves of Ligularia fischeri var. spiciformis induces the differentiation of human acute promyeocytic leukemia HL-60 Cells. Planta Med., 68, 881–885.[CrossRef][Medline]
  20. Steinman,R.A., Hoffman,B., Iro,A., Guillouf,C., Liebermann,D.A. and el-Houseini,M.E. (1994) Induction of p21 (WAF-1/CIP1) during differentiation. Oncogene, 9, 3389–3396.[Web of Science][Medline]
  21. Macleod,K.F., Sherry,N., Hannon,G., Beach,D., Tokino,T., Kinzler,K., Vogelstein,B. and Jacks,T. (1995) p53-dependent and independent expression of p21 during cell growth, differentiation, and DNA damage. Genes Dev., 9, 935–944.[Abstract/Free Full Text]
  22. Dulic,V., Kaufmann,W.K., Wilson,S.J., Tlsty,T.D., Lees,E., Harper,J.W., Elledge,S.J. and Reed,S.I. (1994) p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Cell, 76, 1013–1023.[CrossRef][Web of Science][Medline]
  23. Noda,A., Ning,Y., Venable,S.F., Pereira-Smith,O.M. and Smith,J.R. (1994) Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp. Cell Res., 211, 90–98.[CrossRef][Web of Science][Medline]
  24. Jiang,H., Lin,J., Su,Z.Z., Collart,F.R., Huberman,E. and Fisher,P.B. (1994) Induction of differentiation in human promyelocytic HL-60 leukemia cells activates p21, CIP/WAF1/CIP1, expression in the absence of p53. Oncogene, 9, 3397–3406.[Web of Science][Medline]
  25. Liu,Y., Martindale,J.L., Gorospe,M. and Holbrook,N.J. (1996) Regulation of p21WAF1/CIP1 expression through mitogen-activated protein kinase signaling pathway. Cancer Res., 56, 31–35.[Abstract/Free Full Text]
  26. Das,D., Pintucci,G. and Stern,A. (2000) MAPK-dependent expression of p21WAF and p27KIP1 in PMA-induced differentiation of HL60 cells. FEBS Lett., 472, 50–52.[CrossRef][Web of Science][Medline]
  27. Barboule,N., Lafon,C., Chadebech,P., Vidal,S. and Valette,A. (1999) Involvement of p21 in the PKC-induced regulation of the G2/M cell cycle transition. FEBS Lett., 444, 32–37.[CrossRef][Web of Science][Medline]
Received October 26, 2003; revised February 6, 2004; accepted March 7, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
K.-W. Lee, H. J. Kim, Y. S. Lee, H.-J. Park, J.-W. Choi, J. Ha, and K.-T. Lee
Acteoside inhibits human promyelocytic HL-60 leukemia cell proliferation via inducing cell cycle arrest at G0/G1 phase and differentiation into monocyte
Carcinogenesis, September 1, 2007; 28(9): 1928 - 1936.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/8/1387    most recent
bgh143v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Seo, B.-R.
Right arrow Articles by Lee, K.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seo, B.-R.
Right arrow Articles by Lee, K.-T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?