Carcinogenesis Advance Access originally published online on April 29, 2004
Carcinogenesis 2004 25(9):1587-1592; doi:10.1093/carcin/bgh171
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.25 no.9 © Oxford University Press 2004; all rights reserved.
ARTICLE |
PC cell-derived growth factor (PCDGF/GP88, progranulin) stimulates migration, invasiveness and VEGF expression in breast cancer cells
1 A&G Pharmaceutical Inc., Columbia, Maryland, 2 Department of Pharmaceutical Sciences, University of Maryland, Baltimore, Maryland and 3 Program in Oncology, Greenebaum Cancer Center of the University of Maryland, Baltimore, Maryland, USA
4 To whom correspondence should be addressed Email: gserrero{at}agrx.net
| Abstract |
|---|
|
|
|---|
Metastasis is a multi-step process involved in the progression of breast cancer to a disease with poor prognosis. Growth factor and/or growth factor receptor over- expression have been reported to play an important role in this process. The 88 kDa glycoprotein PC cell-derived growth factor (PCDGF/GP88), also known as progranulin, has been shown to play a major role in breast tumorigenesis by stimulating proliferation, mediating survival and conferring resistance to tamoxifen. In the present paper, the metastatic potential of PCDGF/GP88 was examined in breast cancer. Using MCF-7 cells, we showed that PCDGF/GP88 over-expression stimulated anchorage-independent cell growth and accelerated cell migration through matrigel. Similar results were obtained with MCF-7 cells treated exogenously with PCDGF/GP88. Furthermore, gelatin zymograph and immunoblot revealed that matrix metalloprotease-9 was up-regulated by PCDGF/GP88. PCDGF/GP88 stimulated VEGF expression in MCF-7 cells. These results suggest that PCDGF/GP88 could act to promote metastasis and angiogenesis in human breast cancer cells in addition to stimulating their proliferation and survival.
Abbreviations: MMP-9, matrix metalloprotease-9; PCDGF, PC cell-derived growth factor
| Introduction |
|---|
|
|
|---|
The 88 kDa glycoprotein PC cell-derived growth factor (PCDGF/GP88) is an autocrine growth factor, first isolated from the highly tumorigenic mouse teratoma PC cells (1). PCDGF/GP88, also known as progranulin, is the largest member of the granulin/epithelin family of cystein-rich polypeptide growth modulators (2,3). It has been reported that PCDGF/GP88 stimulated the proliferation and survival of several cell types of mesenchymal and epithelial origin by stimulating MAP kinase, PI-3 kinase and FAK kinase pathways (2,3). Interestingly, over-expression of PCDGF/GP88 was found in several cancer cell lines and/or tumor tissues including breast cancer (4), ovarian cancer (5), renal cell carcinoma (6), multiple myeloma (7) and glioblastoma (8). In breast cancer cells, PCDGF/GP88 has been shown to play a critical role in tumorigenesis. PCDGF/GP88 over-expression correlated positively with the acquisition of estrogen-independent growth, tamoxifen resistance and tumorigenicity (4,9,10). Inhibition of PCDGF/GP88 expression by antisense cDNA transfection in MDA-MB-468 cells resulted in a complete inhibition of tumor growth in nude mice. In addition, it was demonstrated that PCDGF/GP88 prevented the apoptotic effect of tamoxifen in estrogen receptor positive breast cancer cells (10). Pathological studies with breast carcinoma biopsies revealed that PCDGF/GP88 was expressed in 80% invasive ductal carcinoma in correlation with poor prognosis markers such as tumor grade, p53 expression and Ki67 index whereas benign lesions were mostly negative (11). In addition, pathological studies in ovarian tumors indicated that PCDGF/GP88 was highly expressed in invasive epithelial ovarian tumors when compared with tumors with low malignant potential (5). Taken together, these studies would suggest that PCDGF/GP88 plays a role in invasion in addition to stimulating proliferation of tumor cells. Metastasis is a hallmark of cancer transition from a non-invasive to an invasive phenotype. Both invasion through extracellular matrix and neovascularization are required steps for promoting metastasis. Tumor cells secrete proteases such as matrix metalloproteinases (MMPs) to degrade the basement membrane and stroma, allowing malignant cells to invade other surrounding tissues. The expression of these enzymes by the cancer cells is required for tumor invasion (12). Among the members of the metalloprotease family, MMP-9 has been shown to play a major role in the invasiveness of mammary epithelial cells (1315). MMP-9 is induced in several cell types by a variety of cytokines, growth factors and oncogenes (1618).
Angiogenesis is another major event required for tumor growth and tumor progression. This process is regulated by angiogenic factors, released by the tumor cells or by stroma cells surrounding the tumors (19). Vascular endothelial growth factor (VEGF) is the most potent angiogenic factor for several cancers (20). Strong VEGF staining was frequently found in the invasive ductal carcinoma (21).
In this present study, we investigated the potential role of PCDGF/GP88 in metastasis of human breast cancer cells by investigating its ability to stimulate cell migration, metalloprotease activity and VEGF expression.
| Materials and methods |
|---|
|
|
|---|
Materials
G418, Taq polymerase and Superscript II were obtained from Gibco BRL (Gaithersburg, MD). Growth factor reduced phenol red-free Matrigel was purchased from Becton Dickinson Labware (Bedford, MA). Fetal bovine serum (FBS) was from Sigma (St Louis, MO). Oligonucleotide primers used in the RTPCR were synthesized by the Biopolymer Core Laboratory of the University of Maryland (Baltimore, MD). Enhanced chemiluminescence kit was obtained from Pierce (Rockford, IL).
Cell culture
The ER+ human breast cancer cell line MCF-7 was obtained from ATCC (Manassas, VA). PCDGF/GP88 over-expressing MCF-7 cells (O4 cells) and empty vector control cells (MCF-7 EV) have been described elsewhere (9,10). Cells were maintained in DMEM/F12 supplemented with 5% FBS in the presence of 400 µg/ml G418.
RTPCR
MCF-7 EV cells were cultivated in phenol red-free DMEM/F12 supplemented with 1% charcoal-stripped serum and 1 nM 17-ß estradiol (E2), PCDGF/GP88 (400 ng/ml) or vehicle only. O4 cells were cultivated in phenol red-free DMEM/F12 with 1% charcoal-stripped serum. For the experiments with tamoxifen, 1 mM tamoxifen was added to the culture medium. Medium was changed at day 3. RNA samples were collected at day 5 using Trizol. Five micrograms of total RNA were reverse transcribed into single strand cDNA by Superscript II (Gibco), using 250 ng of random hexamer (Gibco) as primer. The RT reaction was carried out for 1 h at 42°C in 10 mM TrisHCl (pH 8.3), 2.5 mM MgCl2, 50 mM KCl, DTT 0.01 M and dNTP (each 0.5 mM). A total of 3035 PCR cycles depending on the gene amplified was performed, followed by electrophoresis on 1% agarose gel. The specific primer pairs are: for glyceraldehyde 3-phosphate dehydrogenase (GAPDH): forward primer 5' TGAAGGTCGGAGTCAACGGATTTGGT 3', reverse primer 5' CATGTGGGCCATGAGGTCCACCAC 3'; for VEGF: forward primer 5' ATGAACTTTCTGCTGTCTTGGGT 3', reverse primer 5' TCACCGCCTCGGCTTGTCAC 3'.
Matrigel migration assay
PCDGF/GP88 over-expressing cells (O4) and MCF-7 EV were seeded at a density of 1 x 105 cells onto matrigel coated inserts (100 µg/cm2; 8 µm pore size) in 24-well plates (Beckton Dickinson Labware, Bedford, MA). The cells were incubated in phenol red-free DMEM/F12 medium supplemented with 1% charcoal-stripped serum with or without 400 ng/ml of PCDGF/GP88. After a 72-h incubation, the cells on the inserts were fixed with 4% paraformaldehyde in PBS for 10 min, washed with PBS and stained with hematoxylin qs (Vector Laboratories, Burlingame, CA). The cells on the upper side of the inserts were removed with a cotton swab. Fixed cells that migrated to the lower side of the filters were counted with a microscope.
Soft agar assay
Anchorage-independent cell growth was determined by soft agar colony forming assay. 10 000 MCF-7 or O4 cells were inoculated in 1 ml of 0.33% agar in tissue culture medium containing 10% FBS in 35 mm plates over a bottom layer of 1.5 ml of 0.6% agar in DMEM/F12 supplemented with 10% FBS. The cells were allowed to grow for 21 days with re-feeding with 200 µl of DMEM/F12, every 3 days. Colonies were stained with 0.005% crystal violet for an hour. Experiments were carried out in quadruplicate.
Zymograph assay and western blot for MMP-9
Five million cells were plated in DMEM/F12 medium with 5% FBS. After 24 h incubation and subsequent washing, the medium was replaced with serum-free medium supplemented with vehicle only or 400 ng/ml of PCDGF/GP88. Medium was collected 24 h later and concentrated with Centriprep YM-10 (Millipore, Billerica, MA). The amount of concentrated medium used in the assay was normalized to the cell number. Samples were diluted in 50 mM TrisHCl pH 7.4 without reducing agent and separated in a 7.5% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDSPAGE) containing 1 mg/ml gelatin. After electrophoresis, the gels were washed in 2.5% Triton X-100 for 30 min and incubated for 16 h at 37°C in 50 mM TrisHCl pH 7.4, 200 mM NaCl, 10 mM CaCl2. Gels were stained with Coomassie brilliant blue R-250 and destained in 40% methanol, 10% acetic acid until clear bands appeared.
For western blot analysis of MMP-9 expression, conditioned media were collected and concentrated as described above. Samples were mixed with Laemmli buffer in reducing conditions and separated in a 7.5% SDSPAGE. Proteins were transferred to PVDF membrane for western blot analysis of MMP-9 expression with 1 µg/ml anti-human MMP-9 mouse monoclonal antibody from Oncogene Research (Boston, MA), followed by incubation with HRP-conjugated goat anti-mouse-IgG. Immunoreactive proteins were detected by enhanced chemiluminescence kit (Pierce, Rockford, IL).
Statistical analysis
All experiments were conducted in triplicates or quadruplicates and repeated at least three times. Data were analyzed by Student's t test for mean comparison and statistical significance (P < 0.05). The values are reported as mean ± SEM.
| Results |
|---|
|
|
|---|
PCDGF/GP88 expression stimulates anchorage-independent growth in vitro
The ability of PCDGF/GP88 to stimulate anchorage-independent growth of MCF-7 cells was first examined. For this purpose, we compared the ability of MCF-7 cells over-expressing PCDGF/GP88 (O4 cells) and control cells (MCF-7 EV) to form colonies in soft agar. As shown in Figure 1, there was a 4.5-fold increase in the number of colonies formed by O4 cells when compared with MCF-7 EV cells (P < 0.05).
|
Effect of PCDGF/GP88 on cell invasion through matrigel
To assess the effect of PCDGF/GP88 on extracellular matrix invasion, we examined the ability of PCDGF/GP88 to stimulate cell migration through matrigel. As shown in Figure 2, the number of cells migrating through matrigel was significantly higher in MCF-7 EV cells treated with PCDGF/GP88 when compared with untreated cells (2.9-fold increase, P < 0.05). Similarly, increased cell migration was also observed in PCDGF/GP88 over-expressing MCF-7 cells (O4 cells) when compared with control MCF-7 EV cells (3.2-fold increase, P < 0.05). The data suggest that PCDGF/GP88 induces cell migration through extracellular matrix.
|
PCDGF/GP88 promotes MMP-9 secretion by MCF-7 cells
We investigated the effect of PCDGF/GP88 on MMP-9 expression using two assays. A zymograph assay, using gelatin as substrate, was used to determine whether PCDGF/GP88 stimulated the secretion of gelatinase from MCF-7 cells. As shown in Figure 3 (upper panel), untreated MCF-7 EV cells displayed a minimal gelatinase activity. Treatment of the cells with 400 ng/ml of PCDGF/GP88 for 24 h prior to collecting the medium resulted in the presence of a strong gelatinolytic activity migrating at a molecular weight corresponding to MMP-9. Increased gelatinolytic activity was also observed in PCDGF/GP88 expressing MCF-7 cells (O4 cells).
|
The stimulation of MMP-9 secretion by PCDGF/GP88 was examined by immunoblot analysis using anti-MMP-9 specific antibody. As shown in Figure 3 (lower panel), the level of MMP-9 protein secreted in the culture medium was greater in MCF-7 EV treated with PCDGF/GP88 and O4 cells than in control untreated MCF-7 EV cells (11.4- and 9.8-fold, respectively).
PCDGF/GP88 promotes VEGF expression in MCF-7 cells
VEGF is the major angiogenic factor involved in tumor neovascularization. The ability of PCDGF/GP88 to stimulate VEGF expression in MCF-7 cells was investigated. Reverse transcription PCR was used to examine VEGF expression in MCF-7 cells. The primer set selected for VEGF (see Materials and methods section) permitted the detection of the six VEGF transcripts: VEGF121, VEGF145, VEGF165, VEGF183, VEGF189 and VEGF206 (22). Only three transcripts VEGF121, VEGF165 and VEGF189 were detectable in MCF-7 cells. As shown in Figure 4, treatment of MCF-7 cells for 5 days with PCDGF/GP88 induced a 2.4-fold increase in the expression of VEGF transcripts. This stimulation was comparable with the one observed with a 5 day treatment with estradiol (3.2-fold), a known stimulator of VEGF expression in MCF-7 cells (23,24).
|
Interestingly tamoxifen, which inhibited the effect of estradiol on VEGF, was unable to prevent the stimulation of VEGF observed with PCDGF/GP88 in MCF-7 EV cells (Figure 5).
|
Increased VEGF expression was also observed in PCDGF/GP88 over-expressing cells when compared with MCF-7 EV cells. As shown in Figure 6, tamoxifen treatment of the PCDGF/GP88 over-expressing cells (O4 cells) further stimulated VEGF expression in PCDGF/GP88 over-expressing cells (1.9-fold). This result indicated that PCDGF/GP88 over-expression stimulated VEGF expression and tamoxifen treatment further increased VEGF expression in cells over-expressing PCDGF/GP88 or exogenously treated with PCDGF/GP88.
|
| Discussion |
|---|
|
|
|---|
The results provided here demonstrate that PCDGF/GP88 induces anchorage-independent growth, cell migration and invasiveness of MCF-7 breast cancer cells. The stimulation of anchorage-independent growth of MCF-7 cells by PCDGF/GP88 is in agreement with our previous studies indicating that PCDGF/GP88 over-expressing MCF-7 cells displayed an increased tumorigenesis in mouse xenografts (10). Similar results have been reported with adrenal carcinoma SW13 cells, as well as non-transformed renal epithelial MDCK cells, where over-expression of PCDGF/GP88 (progranulin) rendered the cells more clonogenic in soft agar assay (25). In addition, over-expression in SW13 cells increased tumorigenicity in mouse xenografts (25).
The acquisition of phenotypic characteristics such as migration and invasiveness are required for a cancer cell to successfully initiate the metastatic cascade. In this study, we have determined that PCDGF/GP88 over-expressing cells displayed an increased capacity of migrating through extracellular matrix (Figure 2). The fact that PCDGF/GP88 added exogenously also increased migration of MCF-7 cells would indicate that this is a direct effect of PCDGF/GP88. Stimulation of cell migration by PCDGF/GP88 had been reported previously for dermal fibroblasts and endothelial cells (26) indicating that this effect is observed in normal as well as tumor cells. Several growth factors such as FGFs (27,28), and heregulinß1 (29) have been reported as promoters of cell migration through matrigel via regulating matrix metalloprotease secretion. Among the various matrix metalloproteases, MMP-9 expression is elevated in the association with increased metastatic potential in many cancer types including breast cancer (30). It has been shown that MMP-9 activity is correlated with tumor grade and invasion in canine mammary adenocarcinoma (31). MMP-9 promoter activity is induced in invasive mammary carcinogenesis but is inactive in benign papillomas and in dysplastic papillomas (32). Heregulin, EGF and amphiregulin also induced expression and secretion of MMP-9 in MCF-7 via multiple signaling pathways including MAP kinase cascade, PKC and PI3-K in SKBR-3 cells (33,34). Inhibition of ERK1 activation is associated with decreased MMP-9 secretion and reduction of in vivo invasiveness (35). We show here that PCDGF/GP88 treatment or over-expression induces secretion and gelatinolytic activity of MMP-9 in MCF-7 cells. Since PCDGF/GP88 is known to activate MAPK and PI3K pathways in several cell lines including breast cancer cells (2,3,7,9), it is possible that either one or both pathways are required for MMP-9 up-regulation by PCDGF/GP88 observed here. It has been shown previously in SW-13 cells that progranulin stimulates mRNA expression of MMP-13 and MMP-17 (25). MMP-13 is found in rheumatoid lesion, ulcer, malignant breast tumor, squamous cell carcinomas and chondrosarcomas whereas MMP-17 is poorly described. However, whether PCDGF/GP88 activated mRNA expression of MMP-9 in SW13 cells was not determined.
Neovascularization or angiogenesis is a crucial process required for solid tumor progression beyond a certain size. We have shown previously that PCDGF/GP88 over-expression promotes tumor growth in vivo and that PCDGF/GP88 over-expressing tumors had a higher level of VEGF and angiopoietin-1 than MCF-7 tumors (10).We show here that PCDGF/GP88 stimulates VEGF expression in MCF-7 cells in culture. The data would suggest that the increased VEGF expression observed in the tumors was due to a direct stimulation of VEGF expression in the tumor cells by PCDGF/GP88 rather than to an indirect effect on stromal cells found in the tumor environment. Several growth factors including EGF, PDGF, TNF-
, TGF-ß stimulate VEGF expression in several cells (36,37). Interestingly, He et al. showed that PCDGF/GP88 induced human microvascular endothelial cell proliferation and promote tube-like structure, suggesting the role in normal angiogenesis (26). Our results showing that PCDGF/GP88 induced VEGF expression would provide a pathway by which PCDGF/GP88 stimulated vascularization is mediated.
Several reports have demonstrated an association between VEGF and MMP-9 expression in several cancer types. VEGF enhanced expression of MMP-9 through Flt-1 in vascular smooth muscle cells (38) whereas Bergers et al. found that MMP-9 acted as an angiogenic switch by causing greater accessibility of VEGF to its receptors (39). In addition, Kurizaki et al. found that pro-MMP-9 expression correlated with the higher intratumoral microvessel density and thymidine phosphorylase expression (14). Taken together, the fact that PCDGF/GP88 stimulates both MMP-9 secretion and VEGF would suggest that PCDGF/GP88 participates in facilitating this correlation between matrix metalloproteases expression and tumor angiogenesis in human breast cancer cells.
Our previous in vivo study showed that PCDGF/GP88 over-expressing MCF-7 cells are more tumorigenic in nude mice xenograft model than MCF-7 cells. Moreover, treatment of the PCDGF/GP88 over-expressing cells with tamoxifen further stimulated tumor growth instead of inhibiting it as observed for MCF-7 cells (10). It is suggested that the stimulation of VEGF expression by PCDGF/GP88 and its potentiation by tamoxifen would support the increased tumor growth observed in vivo. Over-expression of VEGF in MCF-7 cells has been shown to promote cell proliferation and provide estrogen-independent tumor growth in vitro and in vivo, suggesting an autocrine/paracrine-activation loop by VEGF (40). It is possible that the potentiation of tumor growth in vivo, observed with tamoxifen and PCDGF/GP88, may be mediated by their stimulatory effect on VEGF expression. We show here that the stimulation of VEGF expression by tamoxifen is also observed in vitro in PCDGF/GP88 over-expressing cells as well as in MCF-7 cells treated with estradiol and PCDGF/GP88. The mechanism underlying this effect is at present unknown. We have shown previously that PCDGF/GP88 up-regulated Bcl-2 expression in MCF-7 and prevented its down regulation by tamoxifen (10). A relationship between bcl-2 and VEGF expression has recently been reported in human melanoma via stimulation of VEGF mRNA stability and promoter-activation (41). The existence of a similar positive association between bcl-2 and VEGF in MCF-7 cells could explain the VEGF stimulation observed with the combination of tamoxifen and PCDGF/GP88 treatment in MCF-7 cells treated with estradiol. Interestingly, estrogen and tamoxifen have been also shown to stimulate VEGF expression in a variety of cell systems including cultured vascular muscle cells (42), uterus (43,44) and endometrial cells (45). In MCF-7 cells, tamoxifen has been occasionally reported as stimulating VEGF mRNA expression in vitro (46). In vivo, tamoxifen treatment has been associated with higher plasma VEGF level in pre- and postmenopausal women (47).
We have shown previously that PCDGF/GP88 over- expression in MCF-7 cells mediated tumorigenicity, tamoxifen resistance and estrogen-independent growth. The data presented here would propose a potential role of PCDGF/GP88 in mediating breast tumor metastasis and angiogenesis via promoting MMP-9 and VEGF expression, implying that PCDGF/GP88 plays a significant role in many aspects of breast cancer.
| Acknowledgments |
|---|
The authors wish to thank Huifang Dai for preparing PCDGF/GP88 used in these experiments. This work was supported by grants RO1 CA 85367 from the National Institutes of Health, DAMD 17-01-1-0550 and DAMD 17-01-1-0551 from the Department of Defense Breast Cancer Research program and 9857-AFF and BCTR2000-356 from the Susan G.Komen Breast Cancer Foundation. Wisit Tangkeangsirisin is the recipient of a predoctoral scholarship from the Royal Thai Government.
| References |
|---|
|
|
|---|
- Zhou,J., Gao,G., Crabb,J.W. and Serrero,G. (1993) Purification of an autocrine growth factor homologous with mouse epithelin precursor from a highly tumorigenic cell line. J. Biol. Chem., 268, 1086310869.
[Abstract/Free Full Text] - He,Z. and Bateman,A. (2003) Progranulin (granulin-epithelin precursor, PC-cell-derived growth factor, acrogranin) mediates tissue repair and tumorigenesis. J. Mol. Med., 81, 600612.[CrossRef][Web of Science][Medline]
- Serrero,G. (2003) Autocrine growth factor revisited: PC-cell-derived growth factor (progranulin), a critical player in breast cancer tumorigenesis. Biochem. Biophys. Res. Commun., 308, 409413.[CrossRef][Web of Science][Medline]
- Lu,R. and Serrero,G. (2000) Inhibition of PC cell-derived growth factor (PCDGF, epithelin/granulin precursor) expression by antisense PCDGF cDNA transfection inhibits tumorigenicity of the human breast carcinoma cell line MDA-MB-468. Proc. Natl Acad. Sci. USA, 97, 39933998.
[Abstract/Free Full Text] - Jones,M.B., Michener,C.M., Blanchette,J.O. et al. (2003) The granulin-epithelin precursor/PC-cell-derived growth factor is a growth factor for epithelial ovarian cancer. Clin. Cancer Res., 9, 4451.
[Abstract/Free Full Text] - Donald,C.D., Laddu,A., Chandham,P., Lim,S.D., Cohen,C., Amin,M., Gerton,G.L., Marshall,F.F. and Petros,J.A. (2001) Expression of progranulin and the epithelin/granulin precursor acrogranin correlates with neoplastic state in renal epithelium. Anticancer Res., 21, 37393742.[Web of Science][Medline]
- Wang,W., Hayashi,J., Kim,W.E. and Serrero,G. (2003) PC Cell-derived growth factor (granulin precursor) expression and action in human multiple myeloma. Clin. Cancer Res., 9, 22212228.
[Abstract/Free Full Text] - Liau,L.M., Lallone,R.L., Seitz,R.S., Buznikov,A., Gregg,J.P., Kornblum,H.I., Nelson,S.F. and Bronstein,J.M. (2000) Identification of a human glioma-associated growth factor gene, granulin, using differential immuno-absorption. Cancer Res., 60, 13531360.
[Abstract/Free Full Text] - Lu,R. and Serrero,G. (2001) Mediation of estrogen mitogenic effect in human breast cancer MCF-7 cells by PC-cell-derived growth factor (PCDGF/granulin precursor). Proc. Natl Acad. Sci. USA, 98, 142147.
[Abstract/Free Full Text] - Tangkeangsirisin,W., Hayashi,J. and Serrero,G. (2004) PC cell-derived growth factor mediates tamoxifen resistance and promotes tumor growth of human breast cancer cells. Cancer Res., 64, 17371743.
[Abstract/Free Full Text] - Serrero,G. and Ioffe,O.B. (2003) Expression of PC-cell-derived growth factor in benign and malignant human breast epithelium. Hum. Pathol., 34, 11481154.[CrossRef][Web of Science][Medline]
- Visse,R. and Nagase,H. (2003) Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function and biochemistry. Circ. Res., 92, 827839.
[Abstract/Free Full Text] - Balduyck,M., Zerimech,F., Gouyer,V. et al. (2000) Specific expression of matrix metalloproteinases 1, 3, 9 and 13 associated with invasiveness of breast cancer cells in vitro. Clin. Exp. Metastasis, 18, 171178.[CrossRef][Web of Science][Medline]
- Kurizaki,T., Toi,M. and Tominaga,T. (1998) Relationship between matrix metalloproteinase expression and tumor angiogenesis in human breast carcinoma. Oncol. Rep., 5, 673677.[Web of Science][Medline]
- Bartsch,J.E., Staren,E.D. and Appert,H.E. (2003) Matrix metalloproteinase expression in breast cancer. J. Surg. Res., 110, 383392.[CrossRef][Web of Science][Medline]
- Ruhul Amin,A.R., Senga,T., Oo,M.L., Thant,A.A. and Hamaguchi,M. (2003) Secretion of matrix metalloproteinase-9 by the proinflammatory cytokine, IL-1beta: a role for the dual signalling pathways, Akt and Erk. Genes Cells, 8, 515523.[Abstract]
- Thant,A.A., Nawa,A., Kikkawa,F., Ichigotani,Y., Zhang,Y., Sein,T.T., Amin,A.R. and Hamaguchi,M. (2000) Fibronectin activates matrix metalloproteinase-9 secretion via the MEK1-MAPK and the PI3K-Akt pathways in ovarian cancer cells. Clin. Exp. Metastasis, 18, 423428.[CrossRef][Web of Science][Medline]
- Atlas,E., Cardillo,M., Mehmi,I., Zahedkargaran,H., Tang,C. and Lupu,R. (2003) Heregulin is sufficient for the promotion of tumorigenicity and metastasis of breast cancer cells in vivo. Mol. Cancer Res., 1, 165175.
[Abstract/Free Full Text] - Folkman,J. (2002) Role of angiogenesis in tumor growth and metastasis. Semin. Oncol., 29, 1518.[Web of Science][Medline]
- Ferrara,N. (2002) VEGF and the quest for tumour angiogenesis factors. Nat. Rev. Cancer, 2, 795803.[CrossRef][Web of Science][Medline]
- Lee,A.H., Dublin,E.A., Bobrow,L.G. and Poulsom,R. (1998) Invasive lobular and invasive ductal carcinoma of the breast show distinct patterns of vascular endothelial growth factor expression and angiogenesis. J. Pathol., 185, 394401.[CrossRef][Web of Science][Medline]
- Ferrara,N. (1999) Vascular endothelial growth factor: molecular and biological aspects. Curr. Top. Microbiol. Immunol., 237, 130.[Web of Science][Medline]
- Takei,H., Lee,E.S. and Jordan,V.C. (2002) In vitro regulation of vascular endothelial growth factor by estrogens and antiestrogens in estrogen-receptor positive breast cancer. Breast Cancer, 9, 3942.[Medline]
- Sengupta,K., Banerjee,S., Saxena,N. and Banerjee,S.K. (2003) Estradiol-induced vascular endothelial growth factor-A expression in breast tumor cells is biphasic and regulated by estrogen receptor-alpha dependent pathway. Int. J. Oncol., 22, 609614.[Web of Science][Medline]
- He,Z., Ismail,A., Kriazhev,L., Sadvakassova,G. and Bateman,A. (2002) Progranulin (PC-cell-derived growth factor/acrogranin) regulates invasion and cell survival. Cancer Res., 62, 55905596.
[Abstract/Free Full Text] - He,Z., Ong,C.H., Halper,J. and Bateman,A. (2003) Progranulin is a mediator of the wound response. Nat. Med., 9, 225229.[CrossRef][Web of Science][Medline]
- Ruohola,J.K., Viitanen,T.P., Valve,E.M., Seppanen,J.A., Loponen,N.T., Keskitalo,J.J., Lakkakorpi,P.T. and Harkonen,P.L. (2001) Enhanced invasion and tumor growth of fibroblast growth factor 8b-overexpressing MCF-7 human breast cancer cells. Cancer Res., 61, 42294237.
[Abstract/Free Full Text] - Zhang,L., Kharbanda,S., Chen,D., Bullocks,J., Miller,D.L., Ding,I.Y., Hanfelt,J., McLeskey,S.W. and Kern,F.G. (1997) MCF-7 breast carcinoma cells overexpressing FGF-1 form vascularized, metastatic tumors in ovariectomized or tamoxifen-treated nude mice. Oncogene, 15, 20932108.[CrossRef][Web of Science][Medline]
- Hijazi,M.M., Thompson,E.W., Tang,C., Coopman,P., Torri,J.A., Yang,D., Mueller,S.C. and Lupu,R. (2000) Heregulin regulates the actin cytoskeleton and promotes invasive properties in breast cancer cell lines. Int. J. Oncol., 17, 629641.[Web of Science][Medline]
- Hujanen,E.S., Vaisanen,A., Zheng,A., Tryggvason,K. and Turpeenniemi-Hujanen,T. (1994) Modulation of M (r) 72,000 and M (r) 92,000 type-IV collagenase (gelatinase A and B) gene expression by interferons alpha and gamma in human melanoma. Int. J. Cancer, 58, 582586.[Web of Science][Medline]
- Yokota,H., Kumata,T., Taketaba,S. et al. (2001) High expression of 92 kDa type IV collagenase (matrix metalloproteinase-9) in canine mammary adenocarcinoma. Biochim. Biophys. Acta, 1568, 712.[Medline]
- Kupferman,M.E., Fini,M.E., Muller,W.J., Weber,R., Cheng,Y. and Muschel,R.J. (2000) Matrix metalloproteinase 9 promoter activity is induced coincident with invasion during tumor progression. Am. J. Pathol., 157, 17771783.
[Abstract/Free Full Text] - Yao,J., Xiong,S., Klos,K., Nguyen,N., Grijalva,R., Li,P. and Yu,D. (2001) Multiple signaling pathways involved in activation of matrix metalloproteinase-9 (MMP-9) by heregulin-beta1 in human breast cancer cells. Oncogene, 20, 80668074.[CrossRef][Web of Science][Medline]
- Kondapaka,S.B., Fridman,R. and Reddy,K.B. (1997) Epidermal growth factor and amphiregulin up-regulate matrix metalloproteinase-9 (MMP-9) in human breast cancer cells. Int. J. Cancer, 70, 722726.[CrossRef][Web of Science][Medline]
- Simon,C., Hicks,M.J., Nemechek,A.J., Mehta,R., O'Malley,B.W.,Jr, Goepfert,H., Flaitz,C.M. and Boyd,D. (1999) PD 098059, an inhibitor of ERK1 activation, attenuates the in vivo invasiveness of head and neck squamous cell carcinoma. Br. J. Cancer, 80, 14121419.[CrossRef][Web of Science][Medline]
- Enholm,B., Paavonen,K., Ristimaki,A. et al. (1997) Comparison of VEGF, VEGF-B, VEGF-C and Ang-1 mRNA regulation by serum, growth factors, oncoproteins and hypoxia. Oncogene, 14, 24752483.[CrossRef][Web of Science][Medline]
- Veikkola,T. and Alitalo,K. (1999) VEGFs, receptors and angiogenesis. Semin. Cancer Biol., 9, 211220.[CrossRef][Web of Science][Medline]
- Wang,H. and Keiser,J.A. (1998) Vascular endothelial growth factor upregulates the expression of matrix metalloproteinases in vascular smooth muscle cells: role of flt-1. Circ. Res., 83, 832840.
[Abstract/Free Full Text] - Bergers,G., Brekken,R., McMahon,G. et al. (2000) Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat. Cell Biol., 2, 737744.[CrossRef][Web of Science][Medline]
- Guo,P., Fang,Q., Tao,H.Q., Schafer,C.A., Fenton,B.M., Ding,I., Hu,B. and Cheng,S.Y. (2003) Overexpression of vascular endothelial growth factor by MCF-7 breast cancer cells promotes estrogen-independent tumor growth in vivo. Cancer Res., 63, 46844691.
[Abstract/Free Full Text] - Iervolino,A., Trisciuoglio,D., Ribatti,D., Candiloro,A., Biroccio,A., Zupi,G. and Del Bufalo,D. (2002) Bcl-2 overexpression in human melanoma cells increases angiogenesis through VEGF mRNA stabilization and HIF-1-mediated transcriptional activity. FASEB J., 16, 14531455.
[Abstract/Free Full Text] - Bausero,P., Ben-Mahdi,M., Mazucatelli,J., Bloy,C. and Perrot-Applanat,M. (2000) Vascular endothelial growth factor is modulated in vascular muscle cells by estradiol, tamoxifen and hypoxia. Am. J. Physiol. Heart Circ. Physiol., 279, H2033H2042.
[Abstract/Free Full Text] - Cullinan-Bove,K. and Koos,R.D. (1993) Vascular endothelial growth factor/vascular permeability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permeability and growth. Endocrinology, 133, 829837.
[Abstract/Free Full Text] - Hyder,S.M., Stancel,G.M., Chiappetta,C., Murthy,L., Boettger-Tong,H.L. and Makela,S. (1996) Uterine expression of vascular endothelial growth factor is increased by estradiol and tamoxifen. Cancer Res., 56, 39543960.
[Abstract/Free Full Text] - Mueller,M.D., Pritts,E.A., Zaloudek,C.J., Dreher,E. and Taylor,R.N. (2003) Regulation of vascular endothelial growth factor by tamoxifen in vitro and in vivo. Gynecol. Obstet. Invest., 55, 119124.[CrossRef][Web of Science][Medline]
- Ruohola,J.K., Valve,E.M., Karkkainen,M.J., Joukov,V., Alitalo,K. and Harkonen,P.L. (1999) Vascular endothelial growth factors are differentially regulated by steroid hormones and antiestrogens in breast cancer cells. Mol. Cell. Endocrinol., 149, 2940.[CrossRef][Web of Science][Medline]
- Adams,J., Carder,P.J., Downey,S. et al. (2000) Vascular endothelial growth factor (VEGF) in breast cancer: comparison of plasma, serum and tissue VEGF and microvessel density and effects of tamoxifen. Cancer Res., 60, 28982905.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
G. Gliebus, A. Rosso, and C. F. Lippa Progranulin and {beta}-Amyloid Distribution: A Case Report of the Brain From Preclinical PS-1 Mutation Carrier American Journal of Alzheimer's Disease and Other Dementias, December 1, 2009; 24(6): 456 - 460. [Abstract] [PDF] |
||||
![]() |
F. Lovat, A. Bitto, S.-Q. Xu, M. Fassan, S. Goldoni, D. Metalli, V. Wubah, P. McCue, G. Serrero, L. G. Gomella, et al. Proepithelin is an autocrine growth factor for bladder cancer Carcinogenesis, May 1, 2009; 30(5): 861 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Monami, V. Emiliozzi, A. Bitto, F. Lovat, S.-Q. Xu, S. Goldoni, M. Fassan, G. Serrero, L. G. Gomella, R. Baffa, et al. Proepithelin Regulates Prostate Cancer Cell Biology by Promoting Cell Growth, Migration, and Anchorage-Independent Growth Am. J. Pathol., March 1, 2009; 174(3): 1037 - 1047. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A Desmarais, M. Cao, A. Bateman, and B. D Murphy Spatiotemporal expression pattern of progranulin in embryo implantation and placenta formation suggests a role in cell proliferation, remodeling, and angiogenesis Reproduction, August 1, 2008; 136(2): 247 - 257. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sleegers, N. Brouwers, S. Maurer-Stroh, M. A. van Es, P. V. Damme, P.W.J. van Vught, J. van der Zee, S. Serneels, T. D. Pooter, M. Van den Broeck, et al. Progranulin genetic variability contributes to amyotrophic lateral sclerosis Neurology, July 22, 2008; 71(4): 253 - 259. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Woolley, M. R. Wilson, E. Hung, M.-L. Gorno-Tempini, B. L. Miller, and J. Shim Frontotemporal Dementia and Mania Am J Psychiatry, December 1, 2007; 164(12): 1811 - 1816. [Full Text] [PDF] |
||||
![]() |
D. Irwin, C. F. Lippa, and J.M. Swearer Cognition and Amyotrophic Lateral Sclerosis (ALS) American Journal of Alzheimer's Disease and Other Dementias, September 1, 2007; 22(4): 300 - 312. [Abstract] [PDF] |
||||
![]() |
P.-S. Chen, M.-Y. Wang, S.-N. Wu, J.-L. Su, C.-C. Hong, S.-E. Chuang, M.-W. Chen, K.-T. Hua, Y.-L. Wu, S.-T. Cha, et al. CTGF enhances the motility of breast cancer cells via an integrin-{alpha}vbeta3-ERK1/2-dependent S100A4-upregulated pathway J. Cell Sci., June 15, 2007; 120(12): 2053 - 2065. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Snowden, S. M. Pickering-Brown, I. R. Mackenzie, A. M. T. Richardson, A. Varma, D. Neary, and D. M. A. Mann Progranulin gene mutations associated with frontotemporal dementia and progressive non-fluent aphasia Brain, November 1, 2006; 129(11): 3091 - 3102. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Talbot and O. Ansorge Recent advances in the genetics of amyotrophic lateral sclerosis and frontotemporal dementia: common pathways in neurodegenerative disease Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R182 - R187. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Monami, E. M. Gonzalez, M. Hellman, L. G. Gomella, R. Baffa, R. V. Iozzo, and A. Morrione Proepithelin Promotes Migration and Invasion of 5637 Bladder Cancer Cells through the Activation of ERK1/2 and the Formation of a Paxillin/FAK/ERK Complex. Cancer Res., July 15, 2006; 66(14): 7103 - 7110. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. E. Kim and G. Serrero PC Cell-Derived Growth Factor Stimulates Proliferation and Confers Trastuzumab Resistance to Her-2-Overexpressing Breast Cancer Cells. Clin. Cancer Res., July 15, 2006; 12(14): 4192 - 4199. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
















