Skip Navigation


Carcinogenesis Advance Access originally published online on April 29, 2004
Carcinogenesis 2004 25(9):1587-1592; doi:10.1093/carcin/bgh171
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/9/1587    most recent
bgh171v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tangkeangsirisin, W.
Right arrow Articles by Serrero, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tangkeangsirisin, W.
Right arrow Articles by Serrero, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis vol.25 no.9 © Oxford University Press 2004; all rights reserved.

ARTICLE

PC cell-derived growth factor (PCDGF/GP88, progranulin) stimulates migration, invasiveness and VEGF expression in breast cancer cells

Wisit Tangkeangsirisin1,2 and Ginette Serrero1,–4

1 A&G Pharmaceutical Inc., Columbia, Maryland, 2 Department of Pharmaceutical Sciences, University of Maryland, Baltimore, Maryland and 3 Program in Oncology, Greenebaum Cancer Center of the University of Maryland, Baltimore, Maryland, USA

4 To whom correspondence should be addressed Email: gserrero{at}agrx.net


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Metastasis is a multi-step process involved in the progression of breast cancer to a disease with poor prognosis. Growth factor and/or growth factor receptor over- expression have been reported to play an important role in this process. The 88 kDa glycoprotein PC cell-derived growth factor (PCDGF/GP88), also known as progranulin, has been shown to play a major role in breast tumorigenesis by stimulating proliferation, mediating survival and conferring resistance to tamoxifen. In the present paper, the metastatic potential of PCDGF/GP88 was examined in breast cancer. Using MCF-7 cells, we showed that PCDGF/GP88 over-expression stimulated anchorage-independent cell growth and accelerated cell migration through matrigel. Similar results were obtained with MCF-7 cells treated exogenously with PCDGF/GP88. Furthermore, gelatin zymograph and immunoblot revealed that matrix metalloprotease-9 was up-regulated by PCDGF/GP88. PCDGF/GP88 stimulated VEGF expression in MCF-7 cells. These results suggest that PCDGF/GP88 could act to promote metastasis and angiogenesis in human breast cancer cells in addition to stimulating their proliferation and survival.

Abbreviations: MMP-9, matrix metalloprotease-9; PCDGF, PC cell-derived growth factor


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The 88 kDa glycoprotein PC cell-derived growth factor (PCDGF/GP88) is an autocrine growth factor, first isolated from the highly tumorigenic mouse teratoma PC cells (1). PCDGF/GP88, also known as progranulin, is the largest member of the granulin/epithelin family of cystein-rich polypeptide growth modulators (2,3). It has been reported that PCDGF/GP88 stimulated the proliferation and survival of several cell types of mesenchymal and epithelial origin by stimulating MAP kinase, PI-3 kinase and FAK kinase pathways (2,3). Interestingly, over-expression of PCDGF/GP88 was found in several cancer cell lines and/or tumor tissues including breast cancer (4), ovarian cancer (5), renal cell carcinoma (6), multiple myeloma (7) and glioblastoma (8). In breast cancer cells, PCDGF/GP88 has been shown to play a critical role in tumorigenesis. PCDGF/GP88 over-expression correlated positively with the acquisition of estrogen-independent growth, tamoxifen resistance and tumorigenicity (4,9,10). Inhibition of PCDGF/GP88 expression by antisense cDNA transfection in MDA-MB-468 cells resulted in a complete inhibition of tumor growth in nude mice. In addition, it was demonstrated that PCDGF/GP88 prevented the apoptotic effect of tamoxifen in estrogen receptor positive breast cancer cells (10). Pathological studies with breast carcinoma biopsies revealed that PCDGF/GP88 was expressed in 80% invasive ductal carcinoma in correlation with poor prognosis markers such as tumor grade, p53 expression and Ki67 index whereas benign lesions were mostly negative (11). In addition, pathological studies in ovarian tumors indicated that PCDGF/GP88 was highly expressed in invasive epithelial ovarian tumors when compared with tumors with low malignant potential (5). Taken together, these studies would suggest that PCDGF/GP88 plays a role in invasion in addition to stimulating proliferation of tumor cells. Metastasis is a hallmark of cancer transition from a non-invasive to an invasive phenotype. Both invasion through extracellular matrix and neovascularization are required steps for promoting metastasis. Tumor cells secrete proteases such as matrix metalloproteinases (MMPs) to degrade the basement membrane and stroma, allowing malignant cells to invade other surrounding tissues. The expression of these enzymes by the cancer cells is required for tumor invasion (12). Among the members of the metalloprotease family, MMP-9 has been shown to play a major role in the invasiveness of mammary epithelial cells (1315). MMP-9 is induced in several cell types by a variety of cytokines, growth factors and oncogenes (1618).

Angiogenesis is another major event required for tumor growth and tumor progression. This process is regulated by angiogenic factors, released by the tumor cells or by stroma cells surrounding the tumors (19). Vascular endothelial growth factor (VEGF) is the most potent angiogenic factor for several cancers (20). Strong VEGF staining was frequently found in the invasive ductal carcinoma (21).

In this present study, we investigated the potential role of PCDGF/GP88 in metastasis of human breast cancer cells by investigating its ability to stimulate cell migration, metalloprotease activity and VEGF expression.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Materials
G418, Taq polymerase and Superscript II were obtained from Gibco BRL (Gaithersburg, MD). Growth factor reduced phenol red-free Matrigel was purchased from Becton Dickinson Labware (Bedford, MA). Fetal bovine serum (FBS) was from Sigma (St Louis, MO). Oligonucleotide primers used in the RT–PCR were synthesized by the Biopolymer Core Laboratory of the University of Maryland (Baltimore, MD). Enhanced chemiluminescence kit was obtained from Pierce (Rockford, IL).

Cell culture
The ER+ human breast cancer cell line MCF-7 was obtained from ATCC (Manassas, VA). PCDGF/GP88 over-expressing MCF-7 cells (O4 cells) and empty vector control cells (MCF-7 EV) have been described elsewhere (9,10). Cells were maintained in DMEM/F12 supplemented with 5% FBS in the presence of 400 µg/ml G418.

RT–PCR
MCF-7 EV cells were cultivated in phenol red-free DMEM/F12 supplemented with 1% charcoal-stripped serum and 1 nM 17-ß estradiol (E2), PCDGF/GP88 (400 ng/ml) or vehicle only. O4 cells were cultivated in phenol red-free DMEM/F12 with 1% charcoal-stripped serum. For the experiments with tamoxifen, 1 mM tamoxifen was added to the culture medium. Medium was changed at day 3. RNA samples were collected at day 5 using Trizol. Five micrograms of total RNA were reverse transcribed into single strand cDNA by Superscript II (Gibco), using 250 ng of random hexamer (Gibco) as primer. The RT reaction was carried out for 1 h at 42°C in 10 mM Tris–HCl (pH 8.3), 2.5 mM MgCl2, 50 mM KCl, DTT 0.01 M and dNTP (each 0.5 mM). A total of 30–35 PCR cycles depending on the gene amplified was performed, followed by electrophoresis on 1% agarose gel. The specific primer pairs are: for glyceraldehyde 3-phosphate dehydrogenase (GAPDH): forward primer 5' TGAAGGTCGGAGTCAACGGATTTGGT 3', reverse primer 5' CATGTGGGCCATGAGGTCCACCAC 3'; for VEGF: forward primer 5' ATGAACTTTCTGCTGTCTTGGGT 3', reverse primer 5' TCACCGCCTCGGCTTGTCAC 3'.

Matrigel migration assay
PCDGF/GP88 over-expressing cells (O4) and MCF-7 EV were seeded at a density of 1 x 105 cells onto matrigel coated inserts (100 µg/cm2; 8 µm pore size) in 24-well plates (Beckton Dickinson Labware, Bedford, MA). The cells were incubated in phenol red-free DMEM/F12 medium supplemented with 1% charcoal-stripped serum with or without 400 ng/ml of PCDGF/GP88. After a 72-h incubation, the cells on the inserts were fixed with 4% paraformaldehyde in PBS for 10 min, washed with PBS and stained with hematoxylin qs (Vector Laboratories, Burlingame, CA). The cells on the upper side of the inserts were removed with a cotton swab. Fixed cells that migrated to the lower side of the filters were counted with a microscope.

Soft agar assay
Anchorage-independent cell growth was determined by soft agar colony forming assay. 10 000 MCF-7 or O4 cells were inoculated in 1 ml of 0.33% agar in tissue culture medium containing 10% FBS in 35 mm plates over a bottom layer of 1.5 ml of 0.6% agar in DMEM/F12 supplemented with 10% FBS. The cells were allowed to grow for 21 days with re-feeding with 200 µl of DMEM/F12, every 3 days. Colonies were stained with 0.005% crystal violet for an hour. Experiments were carried out in quadruplicate.

Zymograph assay and western blot for MMP-9
Five million cells were plated in DMEM/F12 medium with 5% FBS. After 24 h incubation and subsequent washing, the medium was replaced with serum-free medium supplemented with vehicle only or 400 ng/ml of PCDGF/GP88. Medium was collected 24 h later and concentrated with Centriprep YM-10 (Millipore, Billerica, MA). The amount of concentrated medium used in the assay was normalized to the cell number. Samples were diluted in 50 mM Tris–HCl pH 7.4 without reducing agent and separated in a 7.5% sodium dodecylsulfate– polyacrylamide gel electrophoresis (SDS–PAGE) containing 1 mg/ml gelatin. After electrophoresis, the gels were washed in 2.5% Triton X-100 for 30 min and incubated for 16 h at 37°C in 50 mM Tris–HCl pH 7.4, 200 mM NaCl, 10 mM CaCl2. Gels were stained with Coomassie brilliant blue R-250 and destained in 40% methanol, 10% acetic acid until clear bands appeared.

For western blot analysis of MMP-9 expression, conditioned media were collected and concentrated as described above. Samples were mixed with Laemmli buffer in reducing conditions and separated in a 7.5% SDS–PAGE. Proteins were transferred to PVDF membrane for western blot analysis of MMP-9 expression with 1 µg/ml anti-human MMP-9 mouse monoclonal antibody from Oncogene Research (Boston, MA), followed by incubation with HRP-conjugated goat anti-mouse-IgG. Immunoreactive proteins were detected by enhanced chemiluminescence kit (Pierce, Rockford, IL).

Statistical analysis
All experiments were conducted in triplicates or quadruplicates and repeated at least three times. Data were analyzed by Student's t test for mean comparison and statistical significance (P < 0.05). The values are reported as mean ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
PCDGF/GP88 expression stimulates anchorage-independent growth in vitro
The ability of PCDGF/GP88 to stimulate anchorage-independent growth of MCF-7 cells was first examined. For this purpose, we compared the ability of MCF-7 cells over-expressing PCDGF/GP88 (O4 cells) and control cells (MCF-7 EV) to form colonies in soft agar. As shown in Figure 1, there was a 4.5-fold increase in the number of colonies formed by O4 cells when compared with MCF-7 EV cells (P < 0.05).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Effect of PCDGF/GP88 on anchorage-independent growth. MCF-7 EV and O4 cells were cultivated in 35 mm plates in 0.33% agar over a bottom layer of 0.6% agar in DMEM/F12 supplemented with 10% FBS. After 21 days, colonies were stained with 0.005% crystal violet and counted as described in the Materials and methods section.

 
Effect of PCDGF/GP88 on cell invasion through matrigel
To assess the effect of PCDGF/GP88 on extracellular matrix invasion, we examined the ability of PCDGF/GP88 to stimulate cell migration through matrigel. As shown in Figure 2, the number of cells migrating through matrigel was significantly higher in MCF-7 EV cells treated with PCDGF/GP88 when compared with untreated cells (2.9-fold increase, P < 0.05). Similarly, increased cell migration was also observed in PCDGF/GP88 over-expressing MCF-7 cells (O4 cells) when compared with control MCF-7 EV cells (3.2-fold increase, P < 0.05). The data suggest that PCDGF/GP88 induces cell migration through extracellular matrix.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. PCDGF/GP88 stimulates Matrigel invasion. MCF-7 EV and O4 cells were inoculated on Falcon cell culture inserts (8 µm pore size) coated with growth factor reduced phenol red-free Matrigel (100 µg/cm2). Cells were cultured with phenol red-free DMEM/F12 supplemented with 1% charcoal-stripped serum. MCF-7 cells were cultivated in the same medium with or without supplement of 400 ng/ml of PCDGF/GP88. After a 72-h incubation, the inserts were fixed in 4% paraformaldehyde and stained with hematoxylin. The cells on the lower side of the inserts were counted under the microscope. Data shown here represents the results from three independent experiments.

 
PCDGF/GP88 promotes MMP-9 secretion by MCF-7 cells
We investigated the effect of PCDGF/GP88 on MMP-9 expression using two assays. A zymograph assay, using gelatin as substrate, was used to determine whether PCDGF/GP88 stimulated the secretion of gelatinase from MCF-7 cells. As shown in Figure 3 (upper panel), untreated MCF-7 EV cells displayed a minimal gelatinase activity. Treatment of the cells with 400 ng/ml of PCDGF/GP88 for 24 h prior to collecting the medium resulted in the presence of a strong gelatinolytic activity migrating at a molecular weight corresponding to MMP-9. Increased gelatinolytic activity was also observed in PCDGF/GP88 expressing MCF-7 cells (O4 cells).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3. Stimulation of MMP-9 expression by PCDGF/GP88. Gelatinolytic activity of MCF-7 EV, MCF-7 EV + PCDGF/GP88 (P) and O4 cells was determined as described in the Materials and methods section (upper panel). MMP-9 expression in the cells was determined by western blot using anti-MMP9 antibody (lower panel).

 
The stimulation of MMP-9 secretion by PCDGF/GP88 was examined by immunoblot analysis using anti-MMP-9 specific antibody. As shown in Figure 3 (lower panel), the level of MMP-9 protein secreted in the culture medium was greater in MCF-7 EV treated with PCDGF/GP88 and O4 cells than in control untreated MCF-7 EV cells (11.4- and 9.8-fold, respectively).

PCDGF/GP88 promotes VEGF expression in MCF-7 cells
VEGF is the major angiogenic factor involved in tumor neovascularization. The ability of PCDGF/GP88 to stimulate VEGF expression in MCF-7 cells was investigated. Reverse transcription PCR was used to examine VEGF expression in MCF-7 cells. The primer set selected for VEGF (see Materials and methods section) permitted the detection of the six VEGF transcripts: VEGF121, VEGF145, VEGF165, VEGF183, VEGF189 and VEGF206 (22). Only three transcripts VEGF121, VEGF165 and VEGF189 were detectable in MCF-7 cells. As shown in Figure 4, treatment of MCF-7 cells for 5 days with PCDGF/GP88 induced a 2.4-fold increase in the expression of VEGF transcripts. This stimulation was comparable with the one observed with a 5 day treatment with estradiol (3.2-fold), a known stimulator of VEGF expression in MCF-7 cells (23,24).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4. Effect of PCDGF/GP88 and estradiol on VEGF expression in MCF-7 cells. MCF-7 EV cells were cultivated in phenol red-free medium supplemented with 1% charcoal-stripped serum supplemented with vehicle only, 400 ng/ml PCDGF/GP88 or 1 nM estradiol (E2). VEGF expression was determined by RT–PCR as described in the Materials and methods section. GAPH expression was measured as internal standard. Upper panel: ethidium bromide staining of amplified products after agarose gel electrophoresis. Lower panel: determination of relative intensity of VEGF transcripts normalized to GAPDH expression. The data were expressed as fold stimulation above control corresponding to the level of expression of transcripts in MCF-7 EV cells treated with vehicle only.

 
Interestingly tamoxifen, which inhibited the effect of estradiol on VEGF, was unable to prevent the stimulation of VEGF observed with PCDGF/GP88 in MCF-7 EV cells (Figure 5).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 5. Effect of PCDGF/GP88 treatment in VEGF expression. MCF-7 EV cells were cultivated as described in the Materials and methods section. 400 ng/ml PCDGF/GP88 (P) 1 µm Tamoxifen (T) or vehicle only was added into the culture and incubated for 5 days. Estradiol (E2) was used as a positive control. RNA samples were isolated and subjected to RT–PCR for VEGF expression determination. Upper panel shows PCR product of VEGF. Lower panel shows the relative density of VEGF mRNA expression. Band intensity was normalized to GAPDH and compared with the level of expression in MCF-7 EV cells treated with vehicle only (control).

 
Increased VEGF expression was also observed in PCDGF/GP88 over-expressing cells when compared with MCF-7 EV cells. As shown in Figure 6, tamoxifen treatment of the PCDGF/GP88 over-expressing cells (O4 cells) further stimulated VEGF expression in PCDGF/GP88 over-expressing cells (1.9-fold). This result indicated that PCDGF/GP88 over-expression stimulated VEGF expression and tamoxifen treatment further increased VEGF expression in cells over-expressing PCDGF/GP88 or exogenously treated with PCDGF/GP88.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 6. Effect of tamoxifen on the expression of VEGF in MCF-7 and O4 cells. VEGF expression was determined by RT–PCR. Ethidium bromide staining of amplified VEGF transcripts in MCF-7 EV and O4 cells (upper panel). The intensity of the amplified transcripts was determined by densitometric analysis and normalized to GAPDH expression used as internal control. Relative intensity of VEGF expression was compared with the one observed in MCF-7 EV cells treated with vehicle only (lower panel).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The results provided here demonstrate that PCDGF/GP88 induces anchorage-independent growth, cell migration and invasiveness of MCF-7 breast cancer cells. The stimulation of anchorage-independent growth of MCF-7 cells by PCDGF/GP88 is in agreement with our previous studies indicating that PCDGF/GP88 over-expressing MCF-7 cells displayed an increased tumorigenesis in mouse xenografts (10). Similar results have been reported with adrenal carcinoma SW13 cells, as well as non-transformed renal epithelial MDCK cells, where over-expression of PCDGF/GP88 (progranulin) rendered the cells more clonogenic in soft agar assay (25). In addition, over-expression in SW13 cells increased tumorigenicity in mouse xenografts (25).

The acquisition of phenotypic characteristics such as migration and invasiveness are required for a cancer cell to successfully initiate the metastatic cascade. In this study, we have determined that PCDGF/GP88 over-expressing cells displayed an increased capacity of migrating through extracellular matrix (Figure 2). The fact that PCDGF/GP88 added exogenously also increased migration of MCF-7 cells would indicate that this is a direct effect of PCDGF/GP88. Stimulation of cell migration by PCDGF/GP88 had been reported previously for dermal fibroblasts and endothelial cells (26) indicating that this effect is observed in normal as well as tumor cells. Several growth factors such as FGFs (27,28), and heregulinß1 (29) have been reported as promoters of cell migration through matrigel via regulating matrix metalloprotease secretion. Among the various matrix metalloproteases, MMP-9 expression is elevated in the association with increased metastatic potential in many cancer types including breast cancer (30). It has been shown that MMP-9 activity is correlated with tumor grade and invasion in canine mammary adenocarcinoma (31). MMP-9 promoter activity is induced in invasive mammary carcinogenesis but is inactive in benign papillomas and in dysplastic papillomas (32). Heregulin, EGF and amphiregulin also induced expression and secretion of MMP-9 in MCF-7 via multiple signaling pathways including MAP kinase cascade, PKC and PI3-K in SKBR-3 cells (33,34). Inhibition of ERK1 activation is associated with decreased MMP-9 secretion and reduction of in vivo invasiveness (35). We show here that PCDGF/GP88 treatment or over-expression induces secretion and gelatinolytic activity of MMP-9 in MCF-7 cells. Since PCDGF/GP88 is known to activate MAPK and PI3K pathways in several cell lines including breast cancer cells (2,3,7,9), it is possible that either one or both pathways are required for MMP-9 up-regulation by PCDGF/GP88 observed here. It has been shown previously in SW-13 cells that progranulin stimulates mRNA expression of MMP-13 and MMP-17 (25). MMP-13 is found in rheumatoid lesion, ulcer, malignant breast tumor, squamous cell carcinomas and chondrosarcomas whereas MMP-17 is poorly described. However, whether PCDGF/GP88 activated mRNA expression of MMP-9 in SW13 cells was not determined.

Neovascularization or angiogenesis is a crucial process required for solid tumor progression beyond a certain size. We have shown previously that PCDGF/GP88 over-expression promotes tumor growth in vivo and that PCDGF/GP88 over-expressing tumors had a higher level of VEGF and angiopoietin-1 than MCF-7 tumors (10).We show here that PCDGF/GP88 stimulates VEGF expression in MCF-7 cells in culture. The data would suggest that the increased VEGF expression observed in the tumors was due to a direct stimulation of VEGF expression in the tumor cells by PCDGF/GP88 rather than to an indirect effect on stromal cells found in the tumor environment. Several growth factors including EGF, PDGF, TNF-{alpha}, TGF-ß stimulate VEGF expression in several cells (36,37). Interestingly, He et al. showed that PCDGF/GP88 induced human microvascular endothelial cell proliferation and promote tube-like structure, suggesting the role in normal angiogenesis (26). Our results showing that PCDGF/GP88 induced VEGF expression would provide a pathway by which PCDGF/GP88 stimulated vascularization is mediated.

Several reports have demonstrated an association between VEGF and MMP-9 expression in several cancer types. VEGF enhanced expression of MMP-9 through Flt-1 in vascular smooth muscle cells (38) whereas Bergers et al. found that MMP-9 acted as an angiogenic switch by causing greater accessibility of VEGF to its receptors (39). In addition, Kurizaki et al. found that pro-MMP-9 expression correlated with the higher intratumoral microvessel density and thymidine phosphorylase expression (14). Taken together, the fact that PCDGF/GP88 stimulates both MMP-9 secretion and VEGF would suggest that PCDGF/GP88 participates in facilitating this correlation between matrix metalloproteases expression and tumor angiogenesis in human breast cancer cells.

Our previous in vivo study showed that PCDGF/GP88 over-expressing MCF-7 cells are more tumorigenic in nude mice xenograft model than MCF-7 cells. Moreover, treatment of the PCDGF/GP88 over-expressing cells with tamoxifen further stimulated tumor growth instead of inhibiting it as observed for MCF-7 cells (10). It is suggested that the stimulation of VEGF expression by PCDGF/GP88 and its potentiation by tamoxifen would support the increased tumor growth observed in vivo. Over-expression of VEGF in MCF-7 cells has been shown to promote cell proliferation and provide estrogen-independent tumor growth in vitro and in vivo, suggesting an autocrine/paracrine-activation loop by VEGF (40). It is possible that the potentiation of tumor growth in vivo, observed with tamoxifen and PCDGF/GP88, may be mediated by their stimulatory effect on VEGF expression. We show here that the stimulation of VEGF expression by tamoxifen is also observed in vitro in PCDGF/GP88 over-expressing cells as well as in MCF-7 cells treated with estradiol and PCDGF/GP88. The mechanism underlying this effect is at present unknown. We have shown previously that PCDGF/GP88 up-regulated Bcl-2 expression in MCF-7 and prevented its down regulation by tamoxifen (10). A relationship between bcl-2 and VEGF expression has recently been reported in human melanoma via stimulation of VEGF mRNA stability and promoter-activation (41). The existence of a similar positive association between bcl-2 and VEGF in MCF-7 cells could explain the VEGF stimulation observed with the combination of tamoxifen and PCDGF/GP88 treatment in MCF-7 cells treated with estradiol. Interestingly, estrogen and tamoxifen have been also shown to stimulate VEGF expression in a variety of cell systems including cultured vascular muscle cells (42), uterus (43,44) and endometrial cells (45). In MCF-7 cells, tamoxifen has been occasionally reported as stimulating VEGF mRNA expression in vitro (46). In vivo, tamoxifen treatment has been associated with higher plasma VEGF level in pre- and postmenopausal women (47).

We have shown previously that PCDGF/GP88 over- expression in MCF-7 cells mediated tumorigenicity, tamoxifen resistance and estrogen-independent growth. The data presented here would propose a potential role of PCDGF/GP88 in mediating breast tumor metastasis and angiogenesis via promoting MMP-9 and VEGF expression, implying that PCDGF/GP88 plays a significant role in many aspects of breast cancer.


    Acknowledgments
 
The authors wish to thank Huifang Dai for preparing PCDGF/GP88 used in these experiments. This work was supported by grants RO1 CA 85367 from the National Institutes of Health, DAMD 17-01-1-0550 and DAMD 17-01-1-0551 from the Department of Defense Breast Cancer Research program and 9857-AFF and BCTR2000-356 from the Susan G.Komen Breast Cancer Foundation. Wisit Tangkeangsirisin is the recipient of a predoctoral scholarship from the Royal Thai Government.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Zhou,J., Gao,G., Crabb,J.W. and Serrero,G. (1993) Purification of an autocrine growth factor homologous with mouse epithelin precursor from a highly tumorigenic cell line. J. Biol. Chem., 268, 10863–10869.[Abstract/Free Full Text]
  2. He,Z. and Bateman,A. (2003) Progranulin (granulin-epithelin precursor, PC-cell-derived growth factor, acrogranin) mediates tissue repair and tumorigenesis. J. Mol. Med., 81, 600–612.[CrossRef][Web of Science][Medline]
  3. Serrero,G. (2003) Autocrine growth factor revisited: PC-cell-derived growth factor (progranulin), a critical player in breast cancer tumorigenesis. Biochem. Biophys. Res. Commun., 308, 409–413.[CrossRef][Web of Science][Medline]
  4. Lu,R. and Serrero,G. (2000) Inhibition of PC cell-derived growth factor (PCDGF, epithelin/granulin precursor) expression by antisense PCDGF cDNA transfection inhibits tumorigenicity of the human breast carcinoma cell line MDA-MB-468. Proc. Natl Acad. Sci. USA, 97, 3993–3998.[Abstract/Free Full Text]
  5. Jones,M.B., Michener,C.M., Blanchette,J.O. et al. (2003) The granulin-epithelin precursor/PC-cell-derived growth factor is a growth factor for epithelial ovarian cancer. Clin. Cancer Res., 9, 44–51.[Abstract/Free Full Text]
  6. Donald,C.D., Laddu,A., Chandham,P., Lim,S.D., Cohen,C., Amin,M., Gerton,G.L., Marshall,F.F. and Petros,J.A. (2001) Expression of progranulin and the epithelin/granulin precursor acrogranin correlates with neoplastic state in renal epithelium. Anticancer Res., 21, 3739–3742.[Web of Science][Medline]
  7. Wang,W., Hayashi,J., Kim,W.E. and Serrero,G. (2003) PC Cell-derived growth factor (granulin precursor) expression and action in human multiple myeloma. Clin. Cancer Res., 9, 2221–2228.[Abstract/Free Full Text]
  8. Liau,L.M., Lallone,R.L., Seitz,R.S., Buznikov,A., Gregg,J.P., Kornblum,H.I., Nelson,S.F. and Bronstein,J.M. (2000) Identification of a human glioma-associated growth factor gene, granulin, using differential immuno-absorption. Cancer Res., 60, 1353–1360.[Abstract/Free Full Text]
  9. Lu,R. and Serrero,G. (2001) Mediation of estrogen mitogenic effect in human breast cancer MCF-7 cells by PC-cell-derived growth factor (PCDGF/granulin precursor). Proc. Natl Acad. Sci. USA, 98, 142–147.[Abstract/Free Full Text]
  10. Tangkeangsirisin,W., Hayashi,J. and Serrero,G. (2004) PC cell-derived growth factor mediates tamoxifen resistance and promotes tumor growth of human breast cancer cells. Cancer Res., 64, 1737–1743.[Abstract/Free Full Text]
  11. Serrero,G. and Ioffe,O.B. (2003) Expression of PC-cell-derived growth factor in benign and malignant human breast epithelium. Hum. Pathol., 34, 1148–1154.[CrossRef][Web of Science][Medline]
  12. Visse,R. and Nagase,H. (2003) Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function and biochemistry. Circ. Res., 92, 827–839.[Abstract/Free Full Text]
  13. Balduyck,M., Zerimech,F., Gouyer,V. et al. (2000) Specific expression of matrix metalloproteinases 1, 3, 9 and 13 associated with invasiveness of breast cancer cells in vitro. Clin. Exp. Metastasis, 18, 171–178.[CrossRef][Web of Science][Medline]
  14. Kurizaki,T., Toi,M. and Tominaga,T. (1998) Relationship between matrix metalloproteinase expression and tumor angiogenesis in human breast carcinoma. Oncol. Rep., 5, 673–677.[Web of Science][Medline]
  15. Bartsch,J.E., Staren,E.D. and Appert,H.E. (2003) Matrix metalloproteinase expression in breast cancer. J. Surg. Res., 110, 383–392.[CrossRef][Web of Science][Medline]
  16. Ruhul Amin,A.R., Senga,T., Oo,M.L., Thant,A.A. and Hamaguchi,M. (2003) Secretion of matrix metalloproteinase-9 by the proinflammatory cytokine, IL-1beta: a role for the dual signalling pathways, Akt and Erk. Genes Cells, 8, 515–523.[Abstract]
  17. Thant,A.A., Nawa,A., Kikkawa,F., Ichigotani,Y., Zhang,Y., Sein,T.T., Amin,A.R. and Hamaguchi,M. (2000) Fibronectin activates matrix metalloproteinase-9 secretion via the MEK1-MAPK and the PI3K-Akt pathways in ovarian cancer cells. Clin. Exp. Metastasis, 18, 423–428.[CrossRef][Web of Science][Medline]
  18. Atlas,E., Cardillo,M., Mehmi,I., Zahedkargaran,H., Tang,C. and Lupu,R. (2003) Heregulin is sufficient for the promotion of tumorigenicity and metastasis of breast cancer cells in vivo. Mol. Cancer Res., 1, 165–175.[Abstract/Free Full Text]
  19. Folkman,J. (2002) Role of angiogenesis in tumor growth and metastasis. Semin. Oncol., 29, 15–18.[Web of Science][Medline]
  20. Ferrara,N. (2002) VEGF and the quest for tumour angiogenesis factors. Nat. Rev. Cancer, 2, 795–803.[CrossRef][Web of Science][Medline]
  21. Lee,A.H., Dublin,E.A., Bobrow,L.G. and Poulsom,R. (1998) Invasive lobular and invasive ductal carcinoma of the breast show distinct patterns of vascular endothelial growth factor expression and angiogenesis. J. Pathol., 185, 394–401.[CrossRef][Web of Science][Medline]
  22. Ferrara,N. (1999) Vascular endothelial growth factor: molecular and biological aspects. Curr. Top. Microbiol. Immunol., 237, 1–30.[Web of Science][Medline]
  23. Takei,H., Lee,E.S. and Jordan,V.C. (2002) In vitro regulation of vascular endothelial growth factor by estrogens and antiestrogens in estrogen-receptor positive breast cancer. Breast Cancer, 9, 39–42.[Medline]
  24. Sengupta,K., Banerjee,S., Saxena,N. and Banerjee,S.K. (2003) Estradiol-induced vascular endothelial growth factor-A expression in breast tumor cells is biphasic and regulated by estrogen receptor-alpha dependent pathway. Int. J. Oncol., 22, 609–614.[Web of Science][Medline]
  25. He,Z., Ismail,A., Kriazhev,L., Sadvakassova,G. and Bateman,A. (2002) Progranulin (PC-cell-derived growth factor/acrogranin) regulates invasion and cell survival. Cancer Res., 62, 5590–5596.[Abstract/Free Full Text]
  26. He,Z., Ong,C.H., Halper,J. and Bateman,A. (2003) Progranulin is a mediator of the wound response. Nat. Med., 9, 225–229.[CrossRef][Web of Science][Medline]
  27. Ruohola,J.K., Viitanen,T.P., Valve,E.M., Seppanen,J.A., Loponen,N.T., Keskitalo,J.J., Lakkakorpi,P.T. and Harkonen,P.L. (2001) Enhanced invasion and tumor growth of fibroblast growth factor 8b-overexpressing MCF-7 human breast cancer cells. Cancer Res., 61, 4229–4237.[Abstract/Free Full Text]
  28. Zhang,L., Kharbanda,S., Chen,D., Bullocks,J., Miller,D.L., Ding,I.Y., Hanfelt,J., McLeskey,S.W. and Kern,F.G. (1997) MCF-7 breast carcinoma cells overexpressing FGF-1 form vascularized, metastatic tumors in ovariectomized or tamoxifen-treated nude mice. Oncogene, 15, 2093–2108.[CrossRef][Web of Science][Medline]
  29. Hijazi,M.M., Thompson,E.W., Tang,C., Coopman,P., Torri,J.A., Yang,D., Mueller,S.C. and Lupu,R. (2000) Heregulin regulates the actin cytoskeleton and promotes invasive properties in breast cancer cell lines. Int. J. Oncol., 17, 629–641.[Web of Science][Medline]
  30. Hujanen,E.S., Vaisanen,A., Zheng,A., Tryggvason,K. and Turpeenniemi-Hujanen,T. (1994) Modulation of M (r) 72,000 and M (r) 92,000 type-IV collagenase (gelatinase A and B) gene expression by interferons alpha and gamma in human melanoma. Int. J. Cancer, 58, 582–586.[Web of Science][Medline]
  31. Yokota,H., Kumata,T., Taketaba,S. et al. (2001) High expression of 92 kDa type IV collagenase (matrix metalloproteinase-9) in canine mammary adenocarcinoma. Biochim. Biophys. Acta, 1568, 7–12.[Medline]
  32. Kupferman,M.E., Fini,M.E., Muller,W.J., Weber,R., Cheng,Y. and Muschel,R.J. (2000) Matrix metalloproteinase 9 promoter activity is induced coincident with invasion during tumor progression. Am. J. Pathol., 157, 1777–1783.[Abstract/Free Full Text]
  33. Yao,J., Xiong,S., Klos,K., Nguyen,N., Grijalva,R., Li,P. and Yu,D. (2001) Multiple signaling pathways involved in activation of matrix metalloproteinase-9 (MMP-9) by heregulin-beta1 in human breast cancer cells. Oncogene, 20, 8066–8074.[CrossRef][Web of Science][Medline]
  34. Kondapaka,S.B., Fridman,R. and Reddy,K.B. (1997) Epidermal growth factor and amphiregulin up-regulate matrix metalloproteinase-9 (MMP-9) in human breast cancer cells. Int. J. Cancer, 70, 722–726.[CrossRef][Web of Science][Medline]
  35. Simon,C., Hicks,M.J., Nemechek,A.J., Mehta,R., O'Malley,B.W.,Jr, Goepfert,H., Flaitz,C.M. and Boyd,D. (1999) PD 098059, an inhibitor of ERK1 activation, attenuates the in vivo invasiveness of head and neck squamous cell carcinoma. Br. J. Cancer, 80, 1412–1419.[CrossRef][Web of Science][Medline]
  36. Enholm,B., Paavonen,K., Ristimaki,A. et al. (1997) Comparison of VEGF, VEGF-B, VEGF-C and Ang-1 mRNA regulation by serum, growth factors, oncoproteins and hypoxia. Oncogene, 14, 2475–2483.[CrossRef][Web of Science][Medline]
  37. Veikkola,T. and Alitalo,K. (1999) VEGFs, receptors and angiogenesis. Semin. Cancer Biol., 9, 211–220.[CrossRef][Web of Science][Medline]
  38. Wang,H. and Keiser,J.A. (1998) Vascular endothelial growth factor upregulates the expression of matrix metalloproteinases in vascular smooth muscle cells: role of flt-1. Circ. Res., 83, 832–840.[Abstract/Free Full Text]
  39. Bergers,G., Brekken,R., McMahon,G. et al. (2000) Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nat. Cell Biol., 2, 737–744.[CrossRef][Web of Science][Medline]
  40. Guo,P., Fang,Q., Tao,H.Q., Schafer,C.A., Fenton,B.M., Ding,I., Hu,B. and Cheng,S.Y. (2003) Overexpression of vascular endothelial growth factor by MCF-7 breast cancer cells promotes estrogen-independent tumor growth in vivo. Cancer Res., 63, 4684–4691.[Abstract/Free Full Text]
  41. Iervolino,A., Trisciuoglio,D., Ribatti,D., Candiloro,A., Biroccio,A., Zupi,G. and Del Bufalo,D. (2002) Bcl-2 overexpression in human melanoma cells increases angiogenesis through VEGF mRNA stabilization and HIF-1-mediated transcriptional activity. FASEB J., 16, 1453–1455.[Abstract/Free Full Text]
  42. Bausero,P., Ben-Mahdi,M., Mazucatelli,J., Bloy,C. and Perrot-Applanat,M. (2000) Vascular endothelial growth factor is modulated in vascular muscle cells by estradiol, tamoxifen and hypoxia. Am. J. Physiol. Heart Circ. Physiol., 279, H2033–H2042.[Abstract/Free Full Text]
  43. Cullinan-Bove,K. and Koos,R.D. (1993) Vascular endothelial growth factor/vascular permeability factor expression in the rat uterus: rapid stimulation by estrogen correlates with estrogen-induced increases in uterine capillary permeability and growth. Endocrinology, 133, 829–837.[Abstract/Free Full Text]
  44. Hyder,S.M., Stancel,G.M., Chiappetta,C., Murthy,L., Boettger-Tong,H.L. and Makela,S. (1996) Uterine expression of vascular endothelial growth factor is increased by estradiol and tamoxifen. Cancer Res., 56, 3954–3960.[Abstract/Free Full Text]
  45. Mueller,M.D., Pritts,E.A., Zaloudek,C.J., Dreher,E. and Taylor,R.N. (2003) Regulation of vascular endothelial growth factor by tamoxifen in vitro and in vivo. Gynecol. Obstet. Invest., 55, 119–124.[CrossRef][Web of Science][Medline]
  46. Ruohola,J.K., Valve,E.M., Karkkainen,M.J., Joukov,V., Alitalo,K. and Harkonen,P.L. (1999) Vascular endothelial growth factors are differentially regulated by steroid hormones and antiestrogens in breast cancer cells. Mol. Cell. Endocrinol., 149, 29–40.[CrossRef][Web of Science][Medline]
  47. Adams,J., Carder,P.J., Downey,S. et al. (2000) Vascular endothelial growth factor (VEGF) in breast cancer: comparison of plasma, serum and tissue VEGF and microvessel density and effects of tamoxifen. Cancer Res., 60, 2898–2905.[Abstract/Free Full Text]
Received January 23, 2004; revised April 8, 2004; accepted April 9, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
AM J ALZHEIMERS DIS OTHER DEMENHome page
G. Gliebus, A. Rosso, and C. F. Lippa
Progranulin and {beta}-Amyloid Distribution: A Case Report of the Brain From Preclinical PS-1 Mutation Carrier
American Journal of Alzheimer's Disease and Other Dementias, December 1, 2009; 24(6): 456 - 460.
[Abstract] [PDF]


Home page
CarcinogenesisHome page
F. Lovat, A. Bitto, S.-Q. Xu, M. Fassan, S. Goldoni, D. Metalli, V. Wubah, P. McCue, G. Serrero, L. G. Gomella, et al.
Proepithelin is an autocrine growth factor for bladder cancer
Carcinogenesis, May 1, 2009; 30(5): 861 - 868.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. Monami, V. Emiliozzi, A. Bitto, F. Lovat, S.-Q. Xu, S. Goldoni, M. Fassan, G. Serrero, L. G. Gomella, R. Baffa, et al.
Proepithelin Regulates Prostate Cancer Cell Biology by Promoting Cell Growth, Migration, and Anchorage-Independent Growth
Am. J. Pathol., March 1, 2009; 174(3): 1037 - 1047.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
J. A Desmarais, M. Cao, A. Bateman, and B. D Murphy
Spatiotemporal expression pattern of progranulin in embryo implantation and placenta formation suggests a role in cell proliferation, remodeling, and angiogenesis
Reproduction, August 1, 2008; 136(2): 247 - 257.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
K. Sleegers, N. Brouwers, S. Maurer-Stroh, M. A. van Es, P. V. Damme, P.W.J. van Vught, J. van der Zee, S. Serneels, T. D. Pooter, M. Van den Broeck, et al.
Progranulin genetic variability contributes to amyotrophic lateral sclerosis
Neurology, July 22, 2008; 71(4): 253 - 259.
[Abstract] [Full Text] [PDF]


Home page
Am. J. PsychiatryHome page
J. D. Woolley, M. R. Wilson, E. Hung, M.-L. Gorno-Tempini, B. L. Miller, and J. Shim
Frontotemporal Dementia and Mania
Am J Psychiatry, December 1, 2007; 164(12): 1811 - 1816.
[Full Text] [PDF]


Home page
AM J ALZHEIMERS DIS OTHER DEMENHome page
D. Irwin, C. F. Lippa, and J.M. Swearer
Cognition and Amyotrophic Lateral Sclerosis (ALS)
American Journal of Alzheimer's Disease and Other Dementias, September 1, 2007; 22(4): 300 - 312.
[Abstract] [PDF]


Home page
J. Cell Sci.Home page
P.-S. Chen, M.-Y. Wang, S.-N. Wu, J.-L. Su, C.-C. Hong, S.-E. Chuang, M.-W. Chen, K.-T. Hua, Y.-L. Wu, S.-T. Cha, et al.
CTGF enhances the motility of breast cancer cells via an integrin-{alpha}vbeta3-ERK1/2-dependent S100A4-upregulated pathway
J. Cell Sci., June 15, 2007; 120(12): 2053 - 2065.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
J. S. Snowden, S. M. Pickering-Brown, I. R. Mackenzie, A. M. T. Richardson, A. Varma, D. Neary, and D. M. A. Mann
Progranulin gene mutations associated with frontotemporal dementia and progressive non-fluent aphasia
Brain, November 1, 2006; 129(11): 3091 - 3102.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Talbot and O. Ansorge
Recent advances in the genetics of amyotrophic lateral sclerosis and frontotemporal dementia: common pathways in neurodegenerative disease
Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R182 - R187.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Monami, E. M. Gonzalez, M. Hellman, L. G. Gomella, R. Baffa, R. V. Iozzo, and A. Morrione
Proepithelin Promotes Migration and Invasion of 5637 Bladder Cancer Cells through the Activation of ERK1/2 and the Formation of a Paxillin/FAK/ERK Complex.
Cancer Res., July 15, 2006; 66(14): 7103 - 7110.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. E. Kim and G. Serrero
PC Cell-Derived Growth Factor Stimulates Proliferation and Confers Trastuzumab Resistance to Her-2-Overexpressing Breast Cancer Cells.
Clin. Cancer Res., July 15, 2006; 12(14): 4192 - 4199.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/9/1587    most recent
bgh171v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tangkeangsirisin, W.
Right arrow Articles by Serrero, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tangkeangsirisin, W.
Right arrow Articles by Serrero, G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?