Skip Navigation


Carcinogenesis Advance Access originally published online on May 27, 2004
Carcinogenesis 2004 25(9):1735-1746; doi:10.1093/carcin/bgh181
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/9/1735    most recent
bgh181v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yamazaki, M.
Right arrow Articles by Thorgeirsson, U. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamazaki, M.
Right arrow Articles by Thorgeirsson, U. P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis vol.25 no.9 © Oxford University Press 2004; all rights reserved.

ARTICLE

Long-term exposure to elevated levels of circulating TIMP-1 but not mammary TIMP-1 suppresses growth of mammary carcinomas in transgenic mice

Masaharu Yamazaki1, Takemi Akahane, Todd Buck, Hitoshi Yoshiji1, Daniel E. Gomez2, Daniel J. Schoeffner, Eijiro Okajima3, Steven R. Harris4, Opal R. Bunce5, Snorri S. Thorgeirsson6 and Unnur P. Thorgeirsson7

Laboratory of Cellular Carcinogenesis and Tumor Promotion, Center for Cancer Research, National Cancer Institute, National Institute of Health, Bethesda, MD 20892, USA
Present addresses: 1 Nara Medical University, The Third Department of Internal Medicine, 840 Shiji-cho, Kashihara, Nara, Japan, 2 Department of Science and Technology, Quilmes National University, Buenos Aires, Argentina, 3 National Cancer Center Hospital, 1-1 Tsukiji, 5-Chrome, Chuo-ku, Tokyo 104-0045, Japan, 4 Pikeville School of Osteopathic Medicine, Pikeville, KY 41501, USA, 5 Department of Pharmaceutical and Biomedical Sciences, College of Pharmacy, University of Georgia, Athens, GA 41501, USA and 6 Laboratory of Experimental Carcinogenesis, Center for Cancer Research, National Cancer Institute, National Institute of Health, Bethesda, MD 20892, USA

7 To whom correspondence should be addressed Email: thorgeiu{at}mail.nih.gov


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Tissue inhibitor of metalloproteinases-1 (TIMP-1) regulates matrix metalloproteinase activity, acts as a growth stimulator and inhibits apoptosis. We developed transgenic mice to evaluate the relevance of circulating versus mammary TIMP-1 in mammary carcinogenesis. The transgene was placed under the control of the albumin (Alb) promoter for the production of large amounts of TIMP-1 in the liver and release into the systemic circulation to achieve chronically elevated blood levels. The initial 7,12-dimethylbenz[a]anthracene (DMBA) mammary carcinogenesis study showed greatly decreased tumor incidence in heterozygous Alb-TIMP-1 mice (25%), compared with their wild-type (wt) littermates (83.3%). Metastatic mammary carcinomas were induced in the Alb-TIMP-1 mice through breeding with mice expressing the polyomavirus Middle T antigen (MT) under the control of the mouse mammary tumor virus-long terminal repeat (MMTV-LTR). Both the mammary tumor burden and the incidence of lung metastases were lower in the Alb-TIMP-1/MMTV-MT mice than their MMTV-MT littermates. Analysis of the Alb-TIMP-1/MMTV-MT tumors showed evidence of decreased proliferative activity and inhibition of apoptosis, whereas microvascular density was not affected. Transgenic expression of TIMP-1 in mammary epithelial cells was accomplished by using MMTV-LTR. In contrast to the Alb-TIMP-1 mice, there was insignificant difference in the growth of both DMBA- and MT-induced mammary tumors between heterozygous MMTV-TIMP-1 mice and their wt littermates. The MT-induced mammary tumors of the MMTV-TIMP-1 mice were separated into ‘low’ and ‘high’ TIMP-1 expressing groups. The ‘high’ TIMP-1 expressing tumors exhibited significantly higher proliferative activity than the tumors of the MMTV-MT only mice, whereas the number of apoptotic cells and microvascular density were not different. The findings of this study show that circulating TIMP-1, but not mammary-derived TIMP-1, has growth suppressive effects on DMBA and MT-induced mammary carcinomas.

Abbreviations: bfgf, basic fibroblast growth factor; DMBA, dimethylbenz[a]anthracene; ECM, extracellular matrix; MMPs, matrix metalloproteinases; MMTV-LTR, mouse mammary tumor virus-long terminal repeat; MT, Middle T antigen; TIMP-1, tissue inhibitor of metalloproteinases-1; VEGF, vascular endothelial growth factor; wt, wild-type


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Under physiological conditions, extracellular matrix (ECM) turnover is tightly regulated by coordinated expression of proteolytic enzymes, including matrix metalloproteinases (MMPs) and their endogenous inhibitors, TIMPs (1,2). The MMP/TIMP-1 balance is often lost in malignant tumors, resulting in increased degradation of ECM, including basement membrane (3,4). Tissue inhibitor of metalloproteinases-1 (TIMP-1) is a secreted glycoprotein, which is present in body fluids and the ECM (5). When the TIMP-1 sequence was first determined in 1986 (6), it was found to be identical to that of erythroid potentiating activity, a growth factor for erythroid precursor cells (7). TIMP-1 is also a mitogen for various other cell types (811). Additionally, TIMP-1 has been established as an inhibitor of angiogenesis (1214) and a survival factor (1521). Translocation of TIMP-1 to the nucleus may reflect events involved in its growth promoting or anti-apoptotic functions (22). TIMP-1 has paradoxical effects on tumor progression in experimental models. Recombinant TIMP-1 (rTIMP-1) inhibits experimental metastasis of murine melanoma cells (23) and ras-transfected embryonic stem cells (24). Over-expression of TIMP-1 is associated with decreased tumorigenicity and metastatic capability of different tumor cell types (2527) and down-regulation of TIMP-1 confers oncogenicity and increased invasiveness on Swiss/3T3 cells and embryonic stem cells (28,29). Conversely, over-expression of TIMP-1 in rat mammary carcinoma cells results in up-regulation of vascular endothelial growth factor (VEGF) and increased growth in nude mice (30). Also, TIMP-1 expression in tumorigenic cells can either increase or suppress lung metastases (31) and TIMP-1 expression is increased in various types of human malignancies, including breast cancer (3235). High TIMP-1 levels are associated with poor prognosis in lymphoma (36) and carcinomas of breast (3741), lung (42), stomach (43), colon (44), bladder (45) and prostate (46). In invasive breast cancer, the TIMP-1 signal is present in both tumor and stromal cells with the most intense signals at the tumor–stromal interface (35).

A number of synthetic MMP inhibitors have been developed, which showed antitumor activity in murine models (4749). Regrettably, these inhibitors failed to show therapeutic benefits in clinical cancer trials (50). We have established transgenic mice to further evaluate the effects of chronically elevated TIMP-1 levels, either in the circulation or the mammary gland, on mammary tumor growth and metastasis.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation of transgenic mice
Full-length human TIMP-1 cDNA (624 bp, +63 to +687) was isolated from the HT-1080 fibrosarcoma cell line and cloned into the EcoRI and NotI sites of the cytomegalovirus (CMV) promoter driven pCI-neo vector (Promega, Madison, WI) as described previously (30).

The CMV promoter was then deleted from the vector by digestion with BglII and I-PopI and replaced with the mouse albumin (Alb) promoter containing the enhancer and proximal promoter regions (51) to produce the Alb-TIMP-1 vector. The mouse mammary tumor virus (MMTV)-TIMP-1 vector was made by deleting the CMV promoter from the pCI-neo vector with EcoRI and SmaI. It was replaced with MMTV-long terminal repeat (LTR) obtained from the pMAMneo vector (Clontech, Palo Alto, CA). Verification of the transgene constructs was done by restriction mapping and nucleotide sequencing. Linearized Alb-TIMP-1 (3.7 kb Hga fragment) or MMTV-TIMP-1 (3.7 kb BspHI, DRAIII fragment) were injected into fertilized eggs from C57BL/6 J-CBA (B6CBA) hybrid mice. Founders were identified by Southern blot analysis of digested genomic tail DNA. The DNA was separated in 0.8% agarose gel, transferred to nylon membranes, and hybridized with 32P-labeled TIMP-1 cDNA probe, consisting of a 930 bp fragment digested with EcoRI and PvuI. Heterozygous Alb-TIMP-1 and MMTV-TIMP-1 lines were developed from the founders with the highest TIMP-1 mRNA expression in liver and mammary glands, determined by northern blot analysis.

Transgenic offspring were identified using PCR analysis of genomic tail DNA. The PCR conditions were: 30 cycles at 94°C for 1 min, 50°C for 2 min and 72°C for 3 min. The primers for both Alb-TIMP-1 and MMTV-TIMP-1 were: GAGTACTTAATACGACTCACTATAGG (sense) and GCGGCCGCGATTCAGGCTATCTGGGA (antisense). The mice were maintained and then killed according to NIH guidelines for animal care. Tissues were either snap-frozen or fixed in 10% buffered formalin and embedded in paraffin. The blood was collected in plasma-separation tubes (PST, Becton-Dickerson, Franklin, NJ), held on ice for 30 min, and then centrifuged at 3000 g for 25 min. The plasma samples were collected and stored at –20°C until used.

Mammary carcinogenesis studies
Dimethylbenz[a]anthracene (DMBA) was used for chemical induction of mammary carcinomas in 16 heterozygous Alb-TIMP-1 mice and 12 wild-type (wt) littermates. First, the mice received subcutaneous interscapular implants of two 25 mg, 90-day release pellets of medroxyprogesterone (MPA) (Innovative Research of America, Sarasota, FL). Administration of DMBA (50 mg/kg, dissolved in corn oil) by gavage was started at 9 weeks of age and continued weekly for 5 consecutive weeks. The mice were monitored by biweekly examination for mammary tumor detection for 30 weeks. At the end of the study, the mice were killed and necropsied. The major organs were subjected to macro- and microscopic examination. A second DMBA study was undertaken in 16 heterozygous MMTV-TIMP-1 and 14 wt littermates. These mice received a single dose of MPA (100 mg) in a slow release pellet at 6 weeks of age. The same DMBA dosing regimen was used as in the Alb-TIMP-1 mice. The mice were killed 10 weeks after the last DMBA dose. All of the mammary tumors were excised and weighed.

For induction of metastatic mammary carcinomas, heterozygous Alb-TIMP-1 and MMTV-TIMP-1 females were crossed with MMTV-Middle T antigen (MT) males (52), which were kindly provided by Dr William J.Muller (McMaster University). Genotyping for MT was performed by PCR of genomic tail DNA. The PCR primers and conditions for the MT construct have been described elsewhere (52,53). All animals were killed at 18 weeks of age and necropsied. All mammary tumors were excised and weighed. Mann–Whitney U-test was used to calculate the median values of tumor weights of the DMBA- and the MT-induced mammary carcinomas in the Alb-TIMP-1 and MMTV-TIMP-1 mice.

The two largest tumors from each mouse were cut into pieces and either snap frozen and stored at –80°C, or fixed in 10% buffered formalin for H&E or special staining. The lungs were inflated with 10% buffered formalin. Four H&E stained cross sections of the lungs, cut 50 µm apart, were used to enumerate micro- and macrometastases. The average surface area of individual metastases was also determined, using images taken at 7.5x magnification, and stored by Nikon ACT-1 software. The metastases were captured with Adobe Photoshop software, counted, and measured, using NIH Image 1.62f software.

Northern blot, RT–PCR and angiogenesis cDNA array analysis
Total RNA was isolated from different organs and 20 µg were resolved in 0.8% agarose–6% formaldehyde gel, followed by blotting onto a nylon membrane. The blots were hybridized with random primed human TIMP-1 cDNA probe for 1 h at 68°C, washed 10 times with 2x SSC/0.05% SDS at room temperature and three times with 0.1x SSC/0.1% SDS for 15 min each time at 50°C. CD31 mRNA expression was used, in parallel with CD-31 immunostaining of tumor blood vessels, to evaluate microvascular density in the mammary tumors. Total RNA was extracted from the tumors and RT–PCR was carried out with 30 cycles at 94°C for 1 min, 58°C for 2 min and 72°C for 3 min, using the following CD-31 primers: GGAATTCCCCATTGAGGCGC (sense) and CCATGATGCTACTGGCTTTGG (antisense). Densitometric analysis was performed with a Lumi-Imager and ß-actin served as an internal control. Angiogenesis-specific gene expression was analyzed in pooled RNA samples (5 µg) from four ‘High’ TIMP-1 expressing MMTV-TIMP-1/MMTV-MT tumors and four MMTV-MT only tumors. GEAarrayTMQ series mouse angiogenesis array (SuperArray, Bethesda, MD) was used and the samples analyzed according to the manufacturer's instructions.

ELISA, zymography and western blot analysis
Frozen tissues and tumors were homogenized in a glass homogenizer with extraction buffer (50 mM Tris–HCl pH 7.5, 1.0 mM EDTA, 1.0 mM PMSF, 10 µg/ml aprotinin and 10 µg/ml leupeptin), followed by centrifugation (10 000 g) at 4°C for 20 min twice. Protein concentration was determined, using MicroBCA protein assay reagents (Pierce, Rockford, IL). Transgenic TIMP-1 protein levels in the tissue and plasma samples were measured by human TIMP-1 ELISA (Amersham Pharmacia Biotech, NJ) according to the manufacturer's protocol. Gelatin zymography was performed to assess MMP-2 and MMP-9 activities in the mammary carcinomas. Tumor homogenates, containing 40 µg protein, were applied without heating or reduction to 10% zymogram (0.1% gelatin) or 4–16% zymogram (0.1% casein) gel electrophoresis (Invitrogen, Carlsbad, CA) for assessment of MMP-2, MMP-9 and MMP-3 activities. After electrophoresis, the gels were washed for 30 min with 2.7% Triton X-100, then incubated in 50 mM Tris–HCl containing 5 mM CaCl2, 200 mM NaCl and 0.2% Brij-35 for 30 min at room temperature and 16 h at 37°C. After incubation, the gels were stained with Colloidal Blue Staining Kit (NOVEX, San Diego, CA) and destained with water. Gelatinolytic and caseinolytic bands were visible as clear zones against a blue background. The active MMP-2 and MMP-9 levels in the mammary tumors were quantified by MMP-2 and MMP-9 activity assay kits according to the manufacture's instructions (Amersham Pharmacia Biotech, NJ) (n = 4). The amount of active MMP-2 and MMP-9 was displayed as nanograms per gram of tumor protein.

Reverse zymography was performed to assess TIMP-1 activity in plasma samples and extracts of normal mammary glands, as well as tumor and plasma samples from mice with similar size tumors. In brief, 12% (w/v) SDS–polyacrylamide gels were prepared with 1 mg/ml gelatin and 160 ng/ml pro-MMP-9 (Oncogene, Boston, MA). Each sample was applied in non-reducing loading buffer. The gels were run at 120 V for 90 min, then washed twice with 2.5%(v/v) Triton X-100 in 50 mM Tris–HCl (pH 7.5) and 5 mM CaCl2, 30 min each. The gels were then incubated in 50 mM Tris–HCl pH 7.5 and 5 mM CaCl2 for 14–16 h at 37°C. After staining the gels in Colloidal Blue (Invitrogen, Carlsbad, CA) for 3 h, they were destained in deionized water. The MMP inhibitory TIMP-1 activity, which did not distinguish between human and endogenous mouse TIMP-1, was visualized as a dark blue band against the MMP-9 digested background. Western blot analysis of the angiogenic factors, VEGF, basic fibroblast growth factor (bFGF), and transforming growth factor beta (TGFß) was performed on tumor lysates (40 µg) of three individual tumors from each of the following three groups: Alb-TIMP-1/MMTV-MT, MMTV-TIMP-1/MMTV-MT and MMTV-MT only. Following gel electrophoresis and transfer to a PVDF membrane (Invitrogen, Carlsbad, CA), hybridization was carried out, using 1:500 dilution of VEGF, bFGF, and TGFß antibodies (all from Santa Cruz Biotechnology, Santa Cruz, CA). The proteins were visualized by using DAKO's HRP-conjugated secondary antibodies and Amersham's enhanced chemiluminescence detection system.

Histology and immunohistochemistry
H&E stained sections of all major organs from the Alb-TIMP-1, MMTV-TIMP-1 and wt mice were examined microscopically. Mammary gland whole mounts were prepared as described previously (54). Cell proliferation was examined by PCNA staining of representative histological sections. In vivo cell proliferation was assessed in 13-week-old tumor bearing MMTV-TIMP-1 mice and their wt littermates. Two hours prior to death, the mice received BrdU intraperitoneally (75 µg/g body wt). Histological sections of formalin fixed tumors were stained, using a BrdU staining kit (Oncogene, Boston, MA) according to the company's instructions. Apoptotic cells in tumor sections were detected by using TumorTACS (Trevigen, Gaithersburg, MD). Microvascular density was quantified in frozen sections by immunostaining of CD-31, using anti-mouse CD31 monoclonal antibody (BD PharMingen, San Diego, CA) and the ABC method (Vector Laboratories, Burlingame, CA). Proliferative and apoptotic indices were determined by counting positive cells in 15 random microscopic fields at 400x magnification. The microvascular density was assessed by counting CD-31 positive microvessels in 15 fields at 200x magnification, choosing the areas with the highest vascular density. Student's t-test was used for statistical analyses of cell proliferation, apoptosis and microvascular density.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mouse models and biological activity of transgenic TIMP-1
The Alb enhancer/promoter was used to target the liver for production of large amounts of transgenic TIMP-1 and chronic release into the systemic circulation (Figure 1A). Of the five Alb-TIMP-1 founders produced, the founder with the highest hepatic hTIMP-1 expression was chosen for the development of a transgenic line. Northern blot analysis revealed that transgenic TIMP-1 expression was restricted to the liver (Figure 1B). The highest human TIMP-1 plasma levels, ~800 ng/ml, were observed at 2 weeks of age. The levels then dropped sharply to ~500 ng/ml at 4 weeks of age (Figure 1C), which reflects a decrease in the activity of the Alb promoter during the first 6 weeks after birth (51). The TIMP-1 plasma levels were then maintained at 400–500 ng/ml for the remainder of the 30-week experimental period.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. (A) Schematic representation of the 3.7 kb Alb-TIMP-1 transgene construct, consisting of the albumin enhancer/promoter (Alb), which was used to drive expression of human TIMP-1 (hTIMP-1) in hepatocytes. (B) Northern blot analysis shows that TIMP-1 expression is restricted to the liver. (C) Plasma levels of hTIMP-1 in 2–30-week-old heterozygous Alb-TIMP-1 mice (n = 5; bars ± SD). (D) Reverse zymography showing MMP-9 inhibitory TIMP-1 activity in representative plasma samples (80 µg protein) from 2 and 6-week-old Alb-TIMP-1 and wt mice. (E) Results from ELISA show positive correlation between liver and plasma hTIMP-1 protein levels in 6-week-old Alb-TIMP-1 mice (n = 9).

 
Reverse zymography was used to assess total TIMP-1 MMP inhibitory activity in plasma samples. Consistent with the presence of transgenic TIMP-1, in addition to mouse TIMP-1, in the plasma, the Alb-TIMP-1 mice possessed 2–3-fold higher circulating TIMP-1 activity than the wt littermates at 6 weeks of age (Figure 1D), suggesting that transgenic TIMP-1 contributed to the MMP-9 inhibitory activity. Suggestive of continuous release of transgenic TIMP-1 from the liver into the circulation, a positive relationship was found between the liver and plasma levels of TIMP-1 in a group of nine 6-week-old Alb-TIMP-1 mice (Figure 1E). No macro- or microscopic abnormalities were detected in major organs of the Alb-TIMP-1 mice (examined up to 6 months of age) (not shown). Furthermore, results of liver function tests in all age groups of the heterogenous Alb-TIMP-1 mice were within normal limits (data not shown).

For targeting of the mammary gland, human TIMP-1 cDNA was placed under the control of the MMTV-LTR (Figure 2A). Consistent with the reported lack of organ specificity of the MMTV promoter in transgenic models (54), TIMP-1 expression was observed in salivary glands, lungs and spleen, besides mammary glands in the MMTV-TIMP-1 mice (Figure 2B). An age-dependent increase in TIMP-1 levels was observed in mammary glands of heterozygous MMTV-TIMP-1 mice (Figure 2C). This is consistent with tissue re-organization, associated with ductal branching during mammary gland development. Similarly, a strong MMP-9 inhibitory zone at a molecular weight of ~29 kDa, corresponding to TIMP-1, was observed in mammary glands of 6-week-old MMTV-TIMP-1 mice, whereas TIMP-1 activity was not detected in mammary glands of the wt littermates (Figure 2D). Microscopic examination of whole mount preparations of mammary glands from 6 to 20-week-old virgin MMTV-TIMP-1 female mice and the wt littermates showed no abnormalities in ductal branching or terminal end bud development (not shown). Similarly, no histological abnormalities were observed in H&E stained sections of mammary glands from pregnant and lactating MMTV-TIMP-1 mice (not shown). Normal size and excellent general health of the pups of heterozygous Alb-TIMP-1 and MMTV-TIMP-1 mice further established that mammary gland development and lactation was not affected by the transgenic TIMP-1.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. (A) Schematic representation of the 3.7 kb MMTV-TIMP-1 transgenic construct, consisting of the Rous sarcoma virus (RSV) enhancer/MMTV promoter, which was used to drive expression of hTIMP-1 in mammary epithelial cells. (B) Northern blot analysis shows strong TIMP-1 signal in mammary and salivary glands in 10-week-old heterozygous female mice. (C) Results from ELISA show age-dependent increase in hTIMP-1 protein levels in mammary gland extracts of 2–25-week-old heterozygous MMTV-TIMP-1 female mice. (D) Reverse zymography of MMP-9 inhibitory TIMP-1 activity in mammary gland extracts (20 µg protein) of representative heterozygous MMTV-TIMP-1 virgin mice and wt littermates at 6 weeks of age. Recombinant hTIMP-1 (7.5 ng) served as a positive control.

 
Circulating but not mammary transgenic TIMP-1 suppresses tumor growth
In order to determine the effect of circulating TIMP-1 on mammary carcinogenesis, the Alb-TIMP-1 and MMTV-TIMP-1 mice were either given DMBA orally or crossed with MMTV-MT-transgenic mice. In the initial DMBA mammary carcinogenesis study, the appearance of macroscopic tumors was recorded biweekly for a 30-week experimental period in heterozygous Alb-TIMP-1 mice and their wt littermates. During the 30-week study, macroscopic mammary carcinomas were detected in four of 16 (25%) of the Alb-TIMP-1 mice and 10 of 12 (83.3%) of the wt littermates (P = 0.0032) (Figure 3A). Also, the total number of tumors was lower in the Alb-TIMP-1 mice (four tumors) than the wt mice (21 tumors). However, the time until macroscopic tumors were first detected (10 weeks after the last DMBA dose) was not different in the two groups. A separate 12-week study was undertaken to determine if TIMP-1 suppressed the early stages of DMBA-induced mammary carcinogenesis in the Alb-TIMP-1 mice. Microscopic examination of H&E stained sections of mammary gland whole mounts, prepared at 4, 8 and 12 weeks post-DMBA, showed no difference in the number, size or microscopic appearance of hyperplastic lesions and early carcinomas between the Alb-TIMP-1 and wt groups (not shown). The data suggest that TIMP-1 did not interfere with the initial stages of DMBA-induced mammary carcinogenesis. They also ruled out that impairment of metabolic activation of DMBA was responsible for the decreased tumor incidence.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Chronically elevated levels of circulating TIMP-1, but not mammary TIMP-1, inhibit growth of DMBA- and MT-induced mammary carcinomas. (A) Incidence of palpable DMBA-induced mammary carcinomas in heterozygous Alb-TIMP-1 mice (n = 16) and wt littermates (n = 12). (B) The combined tumor weight/mouse in 18-week-old Alb-TIMP-1/MMTV-MT mice (n = 23) and MMTV-MT only littermates (n = 23). (C) Combined DMBA-induced tumor weight/mouse in heterozygous MMTV-TIMP-1 (n = 16) and wt littermates (n = 15) (P < 0.921). (D) Combined tumor weight/mouse in 18-week-old MMTV-TIMP-1/MMTV-MT (n = 12) and MMTV-MT only (n = 12) mice. Open circles represent the combined tumor weight (g)/mouse and the horizontal lines mark the median combined tumor weight/mouse. Mann–Whitney U-test was used to calculate the median values of tumor weights.

 
Alb-TIMP-1 mice were crossed with MMTV-MT transgenic mice to generate metastatic mammary carcinomas. At the end of the 18-week experimental period, tumor incidence was 100% in both Alb-TIMP-1/MMTV-MT mice and the MMTV-MT only littermates. Similarly, there was insignificant difference in the average tumor multiplicity (eight and nine per mouse) between the two groups. However, the median value of the combined tumor weight per mouse was significantly lower in the Alb-TIMP-1/MMTV-MT mice (5.68 ± 0.79 g) than the MMTV-MT only mice (9.72 ± 1.09 g; P < 0.01) (Figure 3B). Also, the median weight per tumor was significantly lower in the Alb-TIMP-1/MMTV-MT (0.71 ± 0.12 g) than the MMTV-MT only mice (1.06 ± 0.12 g; P < 0.01). Micro- and macroscopic lung metastases were detected in 17 of the 23 Alb-TIMP-1/MMTV-MT mice (73.9%) and 22 of the 23 MMTV-MT only mice (95.7%; P = 0.042) (Table I). However, the mean number and the average area of lung metastases per mouse and the mean area of individual metastasis were not statistically different in the two groups (Table I).


View this table:
[in this window]
[in a new window]
 
Table I.
 
DMBA and MT-induced mammary carcinogenesis studies were also carried out in the MMTV-TIMP-1 mice. The DMBA study, which was terminated 10 weeks after the last DMBA dose, showed insignificant difference in the combined tumor weight (P = 0.92) between the MMTV-TIMP-1 mice and wt littermates (Figure 3C). Also, an 18-week MT-induced mammary carcinogenesis study showed no difference in the combined tumor weight between the MMTV-TIMP-1/MMTV-MT and the MMTV-MT only littermates (Figure 3D). Furthermore, the incidence of lung metastases, the average number and the average area of metastases were not significantly different in the two groups (Table I).

The histopathology of the mammary carcinomas induced by DMBA and MT was that of adenocarcinoma with papillary and tubular growth patterns except for a few DMBA-induced carcinomas in the Alb-TIMP-1 mice, which displayed squamous differentiation (not shown). TIMP-1 had no impact on the growth patterns of the carcinomas, the amount of tumor stroma, or the extent of type IV collagen and laminin immunopositivity in the tumor stroma (not shown).

Transgenic TIMP-1 levels were compared in size-matched tumors of the Alb-TIMP-1/MMTV-MT and MMTV-TIMP-1/MT only mice. The levels were variable within each group and a big difference was observed between the groups (Figure 4A and B). The highest TIMP-1 level in the Alb-TIMP-1/MMTV-MT group was ~6.4 ng/mg (Figure 4A). In the MMTV-TIMP-1/MMTV-MT group, the mammary tumors were divided into ‘high’ and ‘low’ subgroups (Figure 4B). The highest TIMP-1 level in the ‘low’ subgroup of 13 tumors was ~35 ng/mg and the highest level in the ‘high’ subgroup of six tumors was close to 10 000 ng/mg. At the end of the experimental period, the average transgenic TIMP-1 plasma level in the tumor bearing MMTV-TIMP-1/MMTV-MT group was considerably higher than the average TIMP-1 level in the ALB-TIMP-1/MMTV-MT group (Figure 4C). Interestingly, tumor growth was not suppressed by the high tumor and plasma TIMP-1 levels in the MMTV-TIMP-1/MMTV-MT group. The increase in TIMP-1 activity in the tumors and plasma of the MMTV-TIMP-1/MMTV-MT mice is demonstrated by reverse zymography of representative samples of size matched tumors in Figure 4D. A faint MMP-9 inhibitory TIMP-1 activity was observed in the MMTV-MT only tumors (lanes 1 and 2), compared with the MMTV-TIMP-1/MMTV-MT tumors (lanes 3 and 4). Similarly, TIMP-1 activity was barely detected in the plasma from the tumor bearing MMTV-MT only mice (lanes 5 and 6), compared with strong TIMP-1 activity in the plasma from the MMTV-TIMP-1/MMTV-MT mice (lanes 7 and 8).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4. Increased hTIMP-1 and decreased active MMP-2/MMP-9 in Alb-TIMP-1/MMTV-MT tumors. (A) hTIMP-1 levels were measured by ELISA in (A) individual mammary tumors of Alb-TIMP-1/MMTV-MT (n = 8) and MMTV-MT only mice (n = 8), (B) mammary tumors of MMTV-TIMP-1/MMTV-MT and MMTV-MT only littermates. Based on the hTIMP-1 concentration, the MMTV-TIMP-1/MMTV-MT tumors were divided into two groups, designated as ‘Low’ (n = 13) and ‘High’ (n = 6) expressing tumors. (C) Plasma hTIMP-1 levels in tumor bearing Alb-TIMP-1/MMTV-MT (n = 22) and MMTV-TIMP-1/MT mice (n = 7) mice. (D) Reverse zymography shows MMP-9 inhibitory TIMP-1 activity in representative tumor and plasma samples from: (1,2) MMTV-MT only tumors; (3,4) MMTV-TIMP-1/MMTV-MT tumors; (5,6) plasma from tumor bearing MMTV-MT only mice; (7,8) plasma from tumor bearing MMTV-TIMP-1/MMTV-MT mice. (E and F) Active MMP-2 and MMP-9 levels in size-matched transgenic Alb-TIMP-1/MMTV-MT, MMTV-TIMP-1/MMTV-MT and MMTV-MT only tumors. The data show the average levels (ng/g protein) of active MMP-2 and MMP-9 in four tumors from each group.

 
The possibility was examined that over-expression of TIMP-1 could affect MMP expression and activities in the MT-induced mammary carcinomas. RT–PCR analysis showed no difference in MMP-2 and MMP-9 mRNA levels in tumors from the transgenic and MMTV-MT only littermates (not shown). Zymographic studies of lysates from individual tumors showed variable gelatinolytic MMP-2 and MMP-9 activities and no clear difference between the TIMP-1 transgenic and MMTV-MT only groups (not shown). However, quantitative analysis of active MMP-2 and MMP-9 in individual size-matched tumors showed that the Alb-TIMP-1/MMTV-MT group displayed lower levels of active MMP-2 (P < 0.05) and MMP-9 (P = 0.18) than the MMTV-MT only group (Figure 4E and F). However, there were insignificant differences in the levels of active MMP-2 and MMP-9 between the MMTV-TIMP-1/MMTV-MT and MMTV-MT only groups (Figure 4E and F). Zymographic analysis of caseinolytic MMP-3 in MT-induced tumors of the Alb-TIMP-1 and MMTV-TIMP-1 mice showed variable activities and minor differences from the MMTV-MT littermate groups (not shown).

The Alb-TIMP/MMTV-MT and the MMTV-TIMP/MMTV-MT tumors displayed different distribution of TIMP-1 (Figure 5). In the Alb-TIMP/MT tumors, TIMP-1 positivity was mostly deposited in the tumor stroma (Figure 5A). In contrast, TIMP-1 was more diffusely distributed in the MMTV-TIMP-1/MT tumors, which is consistent with the release of transgenic TIMP-1 by individual carcinoma cells into the surrounding environment (Figure 5B). TIMP-1 immunopositivity was not detected in MMTV-MT only tumors (Figure 5C and D).



View larger version (157K):
[in this window]
[in a new window]
 
Fig. 5. Immunohistochemical staining of TIMP-1 in tumors of (A) Alb-TIMP-1/MMTV-MT mice, (B) MMTV-TIMP-1/MMTV-MT mice, (C) MMTV-MT only littermates of A, (D) MMTV-MT only littermates of B. Original magnification, x400.

 
Circulating and mammary TIMP-1 have opposite effects on tumor cell proliferation
Immunohistochemical analysis of size-matched Alb-TIMP-1/MMTV-MT and MMTV-MT only tumors was carried out to measure proliferative and apoptotic activities, as well as microvascular density. The average number of proliferating tumor cells, judged by PCNA positivity, was significantly lower in the Alb-TIMP-1/MMTV-MT mice than in the MMTV-MT only mice (P < 0.01) (Figure 6A). There was also a significant decrease in the average number of apoptotic tumor cells in the Alb-TIMP-1/MMTV-MT mice (P < 0.001) (Figure 6B). Surprisingly, insignificant difference in microvascular density was observed between the Alb-TIMP-1/MMTV-MT and MMTV-MT only tumors (Figure 6C) and semi-quantitative RT–PCR analysis of CD31 mRNA levels showed no difference between the two groups (not shown). More data on angiogenesis associated factors are described in the next paragraph on MMTV-TIMP-1 tumors.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6. Proliferative activity and number of apopotic cells are significantly decreased in Alb-TIMP-1/MMTV-MT tumors. (A) The average number of PCNA positive cells in Alb-TIMP-1/MT (n = 18) and MMTV-MT only tumors (n = 18). (B) The average number of apoptotic cells in Alb-TIMP-1/MMTV-MT (n = 24) and MMTV-MT only (n = 22) tumors. (C) Microvascular density, evaluated by CD31 immunostaining in frozen sections, in Alb-TIMP-1/MMTV-MT (n = 9) and MMTV-MT only (n = 8) tumors. The bars represent the average number of PCNA positive/40x field, apoptotic cells/40x field, and microvessels/20x field. Student's t-test was used to calculate significance of the results (±SD).

 
The ‘high’ TIMP-1 expressing MMTV-MT-/MMTV-MT tumor group, but not the ‘low’ expressing group, showed a significant increase in the number of PCNA positive cells, compared with the MMTV-MT only group (P < 0.05) (Figure 7A). An association between the transgenic TIMP-1 levels and the proliferative activity was further established when the TIMP-1 levels were plotted against the number of PCNA positive cells in the tumors (Figure 7B). In contrast to the Alb-TIMP-1/MMTV-MT tumors, the ‘high’ TIMP-1 expressing tumors did not differ significantly from the MMTV-MT only tumors in the number of apoptotic cells (P = 0.340) (Figure 7C). To further establish that over-expression of TIMP-1 in the mammary carcinomas was associated with increased proliferative activity, an in vivo BrdU study was carried out in four 13-week-old MMTV-TIMP-1/MMTV-MT and MMTV-MT only mice. The outcome of this study supported the immunohistochemical data, i.e. there were fewer BrdU positive tumor cells in the MMTV-MT only tumors (Figure 8A) than the MMTV-TIMP-1/MMTV-MT tumors (Figure 8B) with a 2-fold difference (P < 0.05) between the tumor groups (Figure 8C).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7. Positive correlation between hTIMP-1 levels and proliferative activity in ‘high’ TIMP-1 expressing MMTV-TIMP-1/MMTV-MT tumors. (A) The average number of PCNA positive cells in ‘high’ (n = 5) and ‘low’ (n = 8) expressing MMTV-TIMP-1/MMTV-MT tumors, compared with MMTV-MT only (n = 7) tumors. (B) Correlation between the number of PCNA positive cells in histological sections of the MMTV-TIMP-1/MMTV-MT tumors and hTIMP-1 levels in lysates from the same tumors. (C and D) The average number of apoptotic cells and the microvascular density was determined in ‘high’ (n = 5) and ‘low’ (n = 8) expressing MMTV-TIMP-1/MMTV-MT tumors, compared with MMTV-MT only (n = 7) tumors. The bars represent the average number of PCNA positive cells/40x field, apoptotic cells/40x field, and the number of microvessels/20x field. Student's t-test was used to calculate significance of the results (±SD).

 


View larger version (97K):
[in this window]
[in a new window]
 
Fig. 8. In vivo evidence of increased proliferative activity in MMTV-TIMP-1/MMTV-MT tumors. Representative sections of BrdU positive tumor cells in mammary carcinomas from (A) 13-week-old MMTV-MT only and (B) MMTV-TIMP-1/MMTV-MT mice. (C) Bars represent the average number of BrdU positive cells in 13 tumors from four MMTV-TIMP-1/MMTV-MT mice and four MMTV-MT only mice ± SD. Original magnification, x200.

 
Like the Alb-TIMP-1/MMTV-MT tumors, the ‘high’ and ‘low’ MMTV-TIMP-1/MMTV-MT tumors showed insignificant difference in microvascular density (P = 0.579) from the MMTV-MT only group (Figure 7D). Similarly, CD-31 mRNA levels were not different (not shown). Western blot analysis of the angiogenic factors VEGF, bFGF and TGFß revealed no difference in the expression level between the MMTV-MT only and the Alb-TIMP-1/MMTV-MT or the ‘high’ or ‘low’ MMTV-TIMP-1/MMTV-MT tumors (not shown). Furthermore, an angiogenesis cDNA array on pooled RNA samples from four ‘high’ TIMP-1 expressing tumors and four size matched MMTV-MT only tumors did not reveal a significant difference in expression levels of 96 angiogenesis-associated genes (not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
TIMP-mediated suppression of tumor invasion and metastases in experimental models has been attributed to their capacity to inhibit MMPs, which can collectively degrade all structural components of the ECM and are up-regulated in malignant tumors (5557). Conversely, TIMP-1 is over-expressed in various types of human malignancies (3246) and over-expression of TIMP-1 in breast carcinoma cells results in increased tumorigenesis (30). Discoveries of TIMP-1 as a growth factor (811), an inhibitor of angiogenesis (13) and a survival factor (18) have further complicated attempts to elucidate its role in carcinogenesis.

TIMP-1 is widely distributed in the body and is present in the circulation, body fluids and interstitial tissues (4,58). The reported median value of TIMP-1 plasma levels in healthy volunteers ranged widely from ~70 to 610 ng/ml (5961). Because ELISA for mouse TIMP-1 was not available, we were unable to measure the endogenous TIMP-1 plasma levels in the transgenic mice. Instead, semi-quantitative reverse zymography was used to assess total TIMP-1 activity, which was estimated to be 2–3-fold higher in the plasma of the Alb-TIMP-1 mice than wt littermates at 6 weeks of age. In view of the data showing that transgenic TIMP-1 plasma levels of 400–500 ng/ml can be maintained for at least 30 weeks without adverse effects on the animals, this transgenic model is well suited for long-term studies to assess the systemic effects of biologically active TIMP-1 on various disease processes that involve excessive MMP-mediated tissue degradation, including cancer.

Chronic exposure to elevated levels of circulating transgenic TIMP-1 resulted in decreased tumor weights and lower incidence of lung metastases in the Alb-TIMP-1 mice. MMP inhibition is the TIMP-1 function that is generally implemented in tumor growth suppression (62). This is supported by our data showing significantly decreased levels of active MMP-2 and MMP-9 in the tumors of the Alb-TIMP-1/MMTV-MT mice. MMPs promote the early stages of tumor development through proteolytic degradation of the ECM, which can alter the mechanism controlling cell proliferation and promote neoplastic transformation (63,64). Elevated MMP-2 transcripts have been reported in stromal cells surrounding ductal and lobular carcinomas in situ and additionally, elevated MMP-1 transcripts were observed in invasive breast carcinomas (65).

Stromal reaction is allegedly critical for the progression of hyperplastic foci to carcinomas in DMBA-induced mammary carcinomas in rats (66). Although TIMP-1 did not affect the number of early lesions in the DMBA treated Alb-TIMP-1 mice, the data on decreased tumor incidence suggest that TIMP-1 prevented hyperplastic lesions from progressing to carcinomas and/or halted the growth of microscopic carcinomas. TIMP-1 may also decrease the bioavailability of growth factors, which are released from the ECM through MMP-mediated degradation (67). Extrapolating from our transgenic data to human breast cancer, it is conceivable that chronic delivery of TIMP-1 through the circulation can halt the progression of in situ and the early stages of breast cancer.

The MT antigen is a powerful oncogene, which alone can transform cells. When placed under the control of the MMTV-LTR, it induces spontaneous mammary carcinomas, which are of ductal origin (68). The main advantage of using the MMTV-MT model is that the mammary carcinomas arise synchronously and are metastatic (68). In considering the power of the MT oncogene to drive tumorigenesis, it was remarkable that a moderate increase in circulating TIMP-1 levels could significantly suppress tumor growth and the incidence of metastases in the Alb-TIMP-1/MMTV-MT mice. We attribute this to the availability of the blood-derived transgenic TIMP-1 in the tumor environment from the onset of mammary carcinogenesis. It was surprising however, that vascular density was not decreased in the MT-induced tumors of either the Alb-TIMP-1 or the MMTV-TIMP-1 mice. It is well established that TIMP-1 acts as an inhibitor in angiogenesis, both in angiogenesis assays (1214) and in experimental tumor models (69).

Decreased neovascularization was also demonstrated in tumor allografts in the Alb-TIMP-1 model (27,70). We do not have an explanation for the inability of TIMP-1 to suppress neovascularization in the present study. Decreased expression of common angiogenic factors l like VEGF, bFGF and TGFß was ruled out in both the Alb-TIMP-1 and MMTV-TIMP-1 models. Moreover, cDNA array analysis of 96 angiogenesis-associated genes revealed an insignificant difference in gene expression between pooled RNA samples from the ‘high’ TIMP-1 expressing and the MMTV-MT only tumors. One may speculate that TIMP-1 was incapable of counteracting the powerful angiogenic forces of the MT mammary carcinogenesis model.

TIMP-1 acts as an anti-apoptotic factor in human breast epithelial cells (20,21). We found evidence to that effect in the tumor cells of the Alb-TIMP-1/MMTV-MT mammary carcinomas. A decrease in both proliferative and apoptotic activities in those tumors recapitulates the paradoxical functions of TIMP-1 (58,71). Nevertheless, the reduced tumor weights suggested that the capability of TIMP-1 to inhibit tumor cell proliferation was stronger than its anti-apoptotic/survival effects.

The growth suppressive effects of TIMP-1 in the Alb-TIMP-1 mice were not recapitulated in the MMTV-TIMP-1 mice. This was surprising when considering the large amount of transgenic TIMP-1 released from the tumors of the ‘high’ expressing carcinomas into the circulation. The ineffectiveness of the circulating TIMP-1 in suppressing tumor growth in the MMTV-TIMP-1/MMTV-MT mice may be due to the fact that high circulating TIMP-1 levels were not present at the onset of tumorigenesis. Also, the association between high TIMP-1 levels and increased proliferative activity in these tumors suggests that high intracellular TIMP-1 has growth promoting effects. This is in keeping with the reported growth promoting function of TIMP-1, which involves activation of Ras and the mitogen-activated protein kinase (MAPK) pathway (8,72). TIMP-1 is also implemented in growth promotion of human urothelial cancer where the Ki-67 labeling index was found to correlate with the TIMP-mRNA levels (73).

The lack of tumor weight gain of the ‘High’ TIMP-1 expressing tumors with increased proliferative activity has not been resolved so far and requires further studies. The outcome of the mammary carcinogenesis studies in transgenic Alb-TIMP-1 and MMP-TIMP-1 models stresses the complex biological effects of TIMP-1 on the tumor environment. It may also reflect paradoxical functions of intra- and extracellular TIMP-1. This is in accord with findings by Goss et al. in Min mice, which develop spontaneous intestinal tumors (74). Systemic treatment of the Min mice with synthetic MMP inhibitors suppressed intestinal tumor growth, whereas over-expression of TIMP-1 in the gastrointestinal tract had either no effect or increased Min tumor multiplicity.

An imbalance in favor of MMPs is thought to be critical in promoting tumor dissemination. Although not highly significant, there was decreased incidence of lung metasases in the Alb-TIMP-1/MMTV-MT mice. This finding concurs with inhibition of intravenous metastases, following intraperitoneal administration of recombinant TIMP-1 (24). It is intriguing that the incidence of lung metastases was not decreased in the MMTV-TIMP-1/MMTV-MT mice, which displayed higher terminal TIMP-1 plasma levels than the Alb-TIMP-1/MMTV-MT mice.

In summary, the data from our transgenic models indicate that the presence of elevated TIMP-1 plasma levels from the onset of tumorigenesis is effective in suppressing mammary tumor growth and metastases. This suggests that chronic systemic TIMP-1 treatment will be beneficial in the treatment of various human diseases that involve tissue destruction from excessive MMP activities. Although synthetic MMP inhibitors have been efficient in halting tumor growth and dissemination in rodent models, they have yielded negative or borderline results in clinical trials of late stage malignancies (71,75). Further studies are required to get deeper insight into the biology of the MMPs that are crucial for the advancement of the early stages of human breast cancer. Data from such studies will be useful for the design of specific synthetic MMP inhibitors that have fewer side effects and are more effective than the broad-spectrum MMP inhibitors used in clinical trials previously. It will be very interesting to see whether such molecules will be of therapeutic benefit in adjuvant treatment of cancer and/or as chemopreventive agents.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Matrisian,L.M. (1990) Metalloproteinases and their inhibitors in matrix remodeling. Trends Genet., 6, 121–125.[CrossRef][ISI][Medline]
  2. Massova,I., Kotra,L.P., Fridman,R. and Mobashery,S. (1998) Matrix metalloproteinases: structures, evolution, and diversification. FASEB J., 12, 1075–1095.[Abstract/Free Full Text]
  3. Crawford,H.C. and Matrisian,L.M. (1994) Tumor and stromal expression of matrix metalloproteinases and their role in tumor progression. Invas. Metast., 14, 234–245.
  4. Gomez,D.E., Alonso,D.F., Yoshiji,H. and Thorgeirsson,U.P. (1997) Tissue inhibitors of metalloproteinases; structure, regulation and biological function (Review). Eur. J. Cell. Biol., 74, 111–122.[ISI][Medline]
  5. Woessner,J.F.,Jr (1991) Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J., 5, 2145–2155.[Abstract]
  6. Carmichael,D.F., Sommer,A., Thompson,R.C., Anderson,D.C., Smith,C.G., Welgus,H.G. and Stricklin,G.P. (1986) Primary structure and cDNA cloning of human fibroblast collagenase inhibitor. Proc. Natl Acad. Sci. USA, 83, 2407–2411.[Abstract/Free Full Text]
  7. Gasson,J.C., Golde,D.W., Kaufman,S.B. et al. (1985) Molecular characterization and expression of the gene encoding human erythroid-potentiating activity. Nature, 315, 768–771.[CrossRef][Medline]
  8. Hayakawa,T., Yamashita,K., Tanzawa,K., Uchijima,E. and Iwata,K. (1992) Growth promoting activity of tissue inhibitor of metalloproteinase-1 (TIMP-1) for a wide range of cells. FEBS Lett., 298, 29–32.[CrossRef][ISI][Medline]
  9. Luparello,C., Avanzato,G., Carella,C. and Pucci-Minafra,I. (1999) Tissue inhibitor of metalloprotease (TIMP)-1 and proliferative behaviour of clonal breast cancer cells. Breast Cancer Res. Treat., 54, 235–244.[CrossRef][ISI][Medline]
  10. Bertaux,B., Hornebeck,W., Eisen,A.Z. and Dubertret,L. (1991) Growth stimulation of human keratinocytes by tissue inhibitor of metalloproteinases. J. Invest. Dermatol., 97, 679–685.[CrossRef][ISI][Medline]
  11. Hoashi,T., Kadono,T., Kikuchi,K., Etoh,T. and Tamaki,K. (2001) Differential growth regulation in human melanoma cell lines by TIMP-1 and TIMP-2. Biochem. Biophys. Res. Commun., 288, 371–379.[CrossRef][ISI][Medline]
  12. Takigawa,M., Nishida,Y., Suzuki,F., Kishi,J., Yamashita,K. and Hayakawa,T. (1990) Induction of angiogenesis in chick yolk-sac membrane by polyamines and its inhibition by tissue inhibitors of metalloproteinases (TIMP-1 and TIMP-2). Biochem. Biophys. Res. Commun., 171, 1264–1271.[CrossRef][ISI][Medline]
  13. Johnson,M.D., Kim,H.R.C., Chesler,L., Tsao-Wu,G., Bouck,N. and Polverini,P.J. (1994) Inhibition of angiogenesis by tissue inhibitor of metalloproteinase. J. Cell. Physiol., 160, 194–202.[CrossRef][ISI][Medline]
  14. Gomez,D.E., Lindsay,C.K., Cottam,D.W., Nason,A.M. and Thorgeirsson,U.P. (1994) Expression and characterization of human tissue inhibitor of metalloproteinases-1 in a baculovirus-insect cell system. Biochem. Biophys. Res. Commun., 203, 237–243.[CrossRef][ISI][Medline]
  15. Alexander,C.M., Howard,E.W., Bissell,M.J. and Werb,Z. (1996) Rescue of mammary epithelial cell apoptosis and entactin degradation by a tissue inhibitor of metalloproteinases-1 transgene. J. Cell. Biol., 135, 1669–1677.[Abstract/Free Full Text]
  16. Yoshiji,H., Kuriyama,S., Yoshii,J. et al. (2002) Tissue inhibitor of metalloproteinases-1 attenuates spontaneous liver fibrosis resolution in the transgenic mouse. Hepatology, 36, 850–860.[ISI][Medline]
  17. Murphy,F.R., Issa,R., Zhou,X., Ratnarajah,S., Nagase,H., Arthur,M.J., Benyon,C. and Iredale,J.P. (2002) Inhibition of apoptosis of activated hepatic stellate cells by tissue inhibitor of metalloproteinase-1 is mediated via effects on matrix metalloproteinase inhibition: implications for reversibility of liver fibrosis. J. Biol. Chem., 277, 11069–11076.[Abstract/Free Full Text]
  18. Guedez,L., Courtemanch,L. and Stetler-Stevenson,M. (1998) Tissue inhibitor of metalloproteinase (TIMP)-1 induces differentiation and an antiapoptotic phenotype in germinal center B cells. Blood, 92, 1342–1349.[Abstract/Free Full Text]
  19. Oelmann,E., Herbst,H., Zuhlsdorf,M., Albrecht,O., Nolte,A., Schmitmann,C., Manzke,O., Diehl,V., Stein,H. and Berdel,W.E. (2002) Tissue inhibitor of metalloproteinases 1 is an autocrine and paracrine survival factor, with additional immune-regulatory functions, expressed by Hodgkin/Reed-Sternberg cells. Blood, 99, 258–267.[Abstract/Free Full Text]
  20. Li,G., Fridman,R. and Kim,H.R. (1999) Tissue inhibitor of metalloproteinase-1 inhibits apoptosis of human breast epithelial cells. Cancer Res., 59, 6267–6275.[Abstract/Free Full Text]
  21. Liu,X.W., Bernardo,M.M., Fridman,R. and Kim,H.R. (2003) Tissue inhibitor of metalloproteinase-1 protects human breast epithelial cells against intrinsic apoptotic cell death via the focal adhesion kinase/phosphatidylinositol 3-kinase and MAPK signaling pathway. J. Biol. Chem., 278, 40364–40372.[Abstract/Free Full Text]
  22. Ritter,L.M., Garfield,S.H. and Thorgeirsson,U.P. (1999) Tissue inhibitor of metalloproteinases-1 (TIMP-1) binds to the cell surface and translocates to the nucleus of human MCF-7 breast carcinoma cells. Biochem. Biophys. Res. Commun., 257, 494–499.[CrossRef][ISI][Medline]
  23. Schultz,R.M., Silberman,S., Persky,B., Bajkowski,A.S. and Carmichael,D.F. (1988) Inhibition by human recombinant tissue inhibitor of metalloproteinases of human amnion invasion and lung colonization by murine B16-F10 melanoma cells. Cancer Res., 48, 5539–5545.[Abstract/Free Full Text]
  24. Alvarez,O.A., Carmichael,D.F. and DeClerck,Y.A. (1990) Inhibition of collagenolytic activity and metastasis of tumor cells by a recombinant human tissue inhibitor of metalloproteinases. J. Natl Cancer Inst., 82, 589–595.[Abstract/Free Full Text]
  25. Tsuchiya,Y., Sato,H., Endo,Y., Okada,Y., Mai,M., Sasaki,T. and Seiki,M. (1993) Tissue inhibitor of metalloproteinase 1 is a negative regulator of the metastatic ability of a human gastric cancer cell line, KKLS, in the chick embryo. Cancer Res., 53, 1397–1402.[Abstract/Free Full Text]
  26. Khokha,R. (1994) Suppression of the tumorigenic and metastatic abilities of murine B16-F10 melanoma cells in vivo by the overexpression of the tissue inhibitor of the metalloproteinases-1. J. Natl Cancer Inst., 86, 299–304.[Abstract/Free Full Text]
  27. Ikenaka,Y., Yoshiji,H., Kuriyama,S. et al. (2003) Tissue inhibitor of metalloproteinases-1 (TIMP-1) inhibits tumor growth and angiogenesis in the TIMP-1 transgenic mouse model. Int. J. Cancer, 105, 340–346.[CrossRef][ISI][Medline]
  28. Khokha,R., Waterhouse,P., Yagel,S., Lala,P.K., Overall,C.M., Norton,G. and Denhardt,D.T. (1989) Antisense RNA-induced reduction in murine TIMP levels confers oncogenicity on Swiss 3T3 cells. Science, 243, 947–950.[Abstract/Free Full Text]
  29. Alexander,C.M. and Werb,Z. (1992) Targeted disruption of the tissue inhibitor of metalloproteinases gene increases the invasive behaviour of primitive mesenchymal cells derived from embryonic stem cells in vitro. J. Cell Biol., 118, 727–739.[Abstract/Free Full Text]
  30. Yoshiji,H., Harris,S.R., Raso,E., Gomez,D.E., Lindsay,C.K., Shibuya,M., Sinha,C.C. and Thorgeirsson,U.P. (1998) Mammary carcinoma cells over-expressing tissue inhibitor of metalloproteinases-1 show enhanced vascular endothelial growth factor expression. Int. J. Cancer, 75, 81–87.[CrossRef][ISI][Medline]
  31. Soloway,P.D., Alexander,C.M., Werb,Z. and Jaenisch,R. (1996) Targeted mutagenesis of Timp-1 reveals that lung tumor invasion is influenced by Timp-1 genotype of the tumor but not by that of the host. Oncogene, 13, 2307–2314.[ISI][Medline]
  32. Polette,M., Clavel,C., Cockett,M., de Bentzmann,S.G., Murphy,G. and Birembaut,P. (1993) Detection and localization of mRNAs encoding matrix metalloproteinases and their tissue inhibitor in human breast pathology. Invas. Metast., 13, 31–37.
  33. Lindsay,C.K. and Thorgeirsson,U.P. (1995) Localization of messenger RNA for tissue inhibitor of metalloproteinases-1 and type IV collagenases/gelatinases in monkey hepatocellular carcinomas. Clin. Exp. Metast., 13, 381–388.[ISI][Medline]
  34. Kossakowska,A.E., Huchcroft,S.A., Urbanski,S.J. and Edwards,D.R. (1996) Comparative analysis of the expression patterns of metalloproteinases and their inhibitors in breast neoplasia, sporadic colorectal neoplasia, pulmonary carcinomas and malignant non-Hodgkin's lymphomas in humans. Br. J. Cancer, 73, 1401–1408.[ISI][Medline]
  35. Lindsay,C.K., Thorgeirsson,U.P., Tsuda,H. and Hirohashi,S. (1997) Expression of tissue inhibitor of metalloproteinase-1 and type IV collagenase/gelatinase messenger RNAs in human breast cancer. Hum. Pathol., 28, 359–366.[CrossRef][ISI][Medline]
  36. Kossakowska,A.E., Urbanski,S.J. and Edwards,D.R. (1991) Tissue inhibitor of metalloproteinases-1 (TIMP-1) RNA is expressed at elevated levels in malignant non-Hodgkin's lymphomas. Blood, 77, 2475–2481.[Abstract/Free Full Text]
  37. Visscher,D.W., Hoyhtya,M., Ottosen,S.K., Liang,C.-M., Sarkar,F., Crissman,J.D. and Fridman,R. (1994) Enhanced expression of tissue inhibitor of metalloproteinase-2 (TIMP-2) in the stroma of breast carcinomas correlates with tumor recurrence. Int. J. Cancer, 59, 339–344.[ISI][Medline]
  38. Ree,A.H., Florenes,V.A., Berg,J.P., Maelandsmo,G.M., Nesland,J.M. and Fodstad,O. (1997) High levels of messenger RNAs for tissue inhibitors of metalloproteinases (TIMP-1 and TIMP-2) in primary breast carcinomas are associated with development of distant metastases. Clin. Cancer Res., 3, 1623–1628.[Abstract]
  39. McCarthy,K., Maguire,T., McGreal,G., McDermott,E., O'Higgins,N. and Duffy,M.J. (1999) High levels of TIMP-1 predict poor outcome in patients with breast cancer. Int. J. Cancer, 19, 44–48.
  40. Ree,A.H., Florenes,V.A., Berg,J.P., Maelandsmo,G.M., Nesland,J.M. and Fodstad,O. (1997) High levels of messenger RNAs for tissue inhibitors of metalloproteinases (TIMP-1 and TIMP-2) in primary breast carcinomas are associated with development of distant metastases. Clin. Cancer Res., 3, 1623–1628.[Abstract]
  41. Nakopoulou,L., Giannopoulou,I., Stefanaki,K., Panayotopoulou,E., Tsirmpa,I., Alexandrou,P., Mavrommatis,J., Katsarou,S. and Davaris,P. (2002) Enhanced mRNA expression of tissue inhibitor of metalloproteinase-1 (TIMP-1) in breast carcinomas is correlated with adverse prognosis. J. Pathol., 197, 307–313.[CrossRef][ISI][Medline]
  42. Fong,K.M., Kida,Y., Zimmerman,P.V. and Smith,P.J. (1996) TIMP1 and adverse prognosis in non-small cell lung cancer. Clin. Cancer Res., 2, 1369–1372.[Abstract]
  43. Joo,Y.E., Seo,K.S., Kim,H.S., Rew,J.S., Park,C.S. and Kim,S.J. (2000) Expression of tissue inhibitors of metalloproteinases (TIMPs) in gastric cancer. Dig. Dis. Sci., 45, 114–121.[CrossRef][ISI][Medline]
  44. Zeng,Z.-S., Cohen,A.M., Zhang,Z.-F., Stetler-Stevenson,W. and Guillem,J.G. (1995) Elevated tissue inhibitor of metalloproteinase 1 RNA in colorectal cancer stroma correlates with lymph node and distant metastases. Clin. Cancer Res., 1, 899–906.[Abstract]
  45. Naruo,S., Kanayama,H.-O., Takigawa,H., Kagawa,S., Yamashita,K. and Hayakawa,T. (1994) Serum levels of a tissue inhibitor of metalloproteinases-1 (TIMP-1) in bladder cancer patients. Int. J. Urol., 1, 228–231.[Medline]
  46. Jung,K., Nowak,L., Lein,M., Priem,F., Schnorr,D. and Loening,S.A. (1997) Matrix metalloproteinases 1 and 3, tissue inhibitor of metalloproteinase-1 and the complex of metalloproteinase-1/tissue inhibitor in plasma of patients with prostate cancer. Int. J. Cancer, 74, 220–223.[CrossRef][ISI][Medline]
  47. Lein,M., Jung,K., Le,D.K., Hasan,T., Ortel,B., Borchert,D., Winkelmann,B., Schnorr,D. and Loenings,S.A. (2000) Synthetic inhibitor of matrix metalloproteinases (batimastat) reduces prostate cancer growth in an orthotopic rat model. Prostate, 43, 77–82.[CrossRef][ISI][Medline]
  48. Wylie,S., MacDonald,I.C., Varghese,H.J., Schmidt,E.E., Morris,V.L., Groom,A.C. and Chambers,A.F. (1999) The matrix metalloproteinase inhibitor batimastat inhibits angiogenesis in liver metastases of B16F1 melanoma cells. Clin. Exp. Metast., 17, 111–117.[CrossRef][ISI][Medline]
  49. Prontera,C., Mariani,B., Rossi,C., Poggi,A. and Rotilio,D. (1999) Inhibition of gelatinase A (MMP-2) by batimastat and captopril reduces tumor growth and lung metastases in mice bearing Lewis lung carcinoma. Int. J. Cancer, 81, 761–766.[CrossRef][ISI][Medline]
  50. Coussens,L.M., Fingleton,B. and Matrisian,L.M. (2002) Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Science, 295, 2387–2392.[Abstract/Free Full Text]
  51. Sanderson,N., Factor,V., Nagy,P., Kopp,J., Kondaiah,P., Wakefield,L., Roberts,A.B., Sporn,M. and Thorgeirsson,S.S. (1995) Hepatic expression of mature transforming growth factor ß1 in transgenic mice results in multiple tissue lesions. Proc. Natl Acad. Sci. USA, 92, 2572–2576.[Abstract/Free Full Text]
  52. Guy,C.T., Cardiff,R.D. and Muller,W.J. (1992) Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol. Cell. Biol., 12, 954–961.[Abstract/Free Full Text]
  53. Webster,M.A., Cardiff,R.D. and Muller,W.J. (1995) Induction of mammary epithelial hyperplasias and mammary tumors in transgenic mice expressing a murine mammary tumor virus/activated c-src fusion gene. Proc. Natl Acad. Sci. USA, 92, 7849–7853.[Abstract/Free Full Text]
  54. Wagner,K.U., Young III,W.S., Liu,X., Ginns,E.I., Li,M., Furth,P.A. and Hennighausen,L. (1997) Oxytocin and milk removal are required for post-partum mammary-gland development. Genes Funct., 1, 233–244.[Medline]
  55. Albini,A., Melchiori,A., Santi,L., Liotta,L.A., Brown,P.D. and Stetler-Stevenson,W.G. (1991) Tumor cell invasion inhibited by TIMP-2. J. Natl Cancer Inst., 83, 775–779.[Abstract/Free Full Text]
  56. Baker,T., Tickle,S., Wasan,H., Docherty,A., Isenberg,D. and Waxman,J. (1994) Serum metalloproteinases and their inhibitors: markers for malignant potential. Br. J. Cancer, 70, 506–512.[ISI][Medline]
  57. Jiang,Y., Goldberg,I.D. and Shi,Y.E. (2002) Complex roles of tissue inhibitors of metalloproteinases in cancer. Oncogene, 21, 2245–2252.[CrossRef][ISI][Medline]
  58. Brew,K., Dinakarpandian,D. and Nagase,H. (2000) Tissue inhibitors of metalloproteinases: evolution, structure and function. Biochim. Biophys. Acta, 1477, 267–283.[CrossRef][Medline]
  59. Holten-Andersen,M.N., Murphy,G., Nielsen,H.J., Pedersen,A.N., Christensen,I.J., Hoyer-Hansen,G., Brunner,N. and Stephens,R.W. (1999) Quantitation of TIMP-1 in plasma of healthy blood donors and patients with advanced cancer. Br. J. Cancer, 80, 495–503.[CrossRef][ISI][Medline]
  60. Holten-Andersen,M.N., Christensen,I.J., Nielsen,H.J. et al. (2002) Total levels of tissue inhibitor of metalloproteinases 1 in plasma yield high diagnostic sensitivity and specificity in patients with colon cancer. Clin. Cancer Res., 8, 156–164.[Abstract/Free Full Text]
  61. Manenti,L., Paganoni,P., Floriani,I., Landoni,F., Torri,V., Buda,A., Taraboletti,G., Labianca,R., Belotti,D. and Giavazzi,R. (2003) Expression levels of vascular endothelial growth factor, matrix metalloproteinases 2 and 9 and tissue inhibitor of metalloproteinases 1 and 2 in the plasma of patients with ovarian carcinoma. Eur. J. Cancer, 39, 1948–1956.[CrossRef][ISI][Medline]
  62. Freije,J.M., Balbin,M., Pendas,A.M., Sanchez,L.M., Puente,X.S. and Lopez-Otin,C. (2003) Matrix metalloproteinases and tumor progression. Adv. Exp. Med. Biol., 532, 91–107.[ISI][Medline]
  63. Lochter,A., Sternlicht,M.D., Werb,Z. and Bissell,M.J. (1998) The significance of matrix metalloproteinases during early stages of tumor progression. Ann. N. Y. Acad. Sci., 857, 180–193.[Abstract/Free Full Text]
  64. Bergers,G., Brekken,R., McMahon,G. et al. (2000) Matrix metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. Nature Cell Biol., 2, 737–744.[CrossRef][ISI][Medline]
  65. Brummer,O., Athmar,S., Riethdorf,L., Loning,T. and Herbst,H. (1999) Matrix metalloproteinases 1, 2, and 3 and their tissue inhibitors 1 and 2 in benign and malignant breast lesions: an in situ hybridization study. Virch. Arch., 435, 566–573.