Skip Navigation


Carcinogenesis Advance Access originally published online on April 8, 2004
Carcinogenesis 2004 25(9):1747-1755; doi:10.1093/carcin/bgh160
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/9/1747    most recent
bgh160v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Nicol, C. J.
Right arrow Articles by Gonzalez, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nicol, C. J.
Right arrow Articles by Gonzalez, F. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis vol.25 no.9 © Oxford University Press 2004; all rights reserved.

ARTICLE

PPAR{gamma} influences susceptibility to DMBA-induced mammary, ovarian and skin carcinogenesis

Christopher J. Nicol1, Michung Yoon1,4, Jerrold M. Ward2, Masamichi Yamashita1, Katsumi Fukamachi1, Jeffrey M. Peters3 and Frank J. Gonzalez1,5

1 Laboratory of Metabolism, Center for Cancer Research, National Cancer Institute, Bethesda, MD 20892, 2 Veterinary and Tumor Pathology Section, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702 and 3 Department of Veterinary Science and Center for Molecular Toxicology, The Pennsylvania State University, University Park, PA 16802, USA
4 Present address: Department of Life Sciences, Mokwon University, Taejon 302-729, Korea

5 To whom correspondence should be addressed Email: fjgonz{at}helix.nih.gov


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), a member of the nuclear receptor superfamily, plays a role in adipocyte differentiation, type II diabetes, macrophage response to inflammation and is suggested to influence carcinogen-induced colon cancer. Studies done in vitro and in vivo also revealed that PPAR{gamma} ligands might promote differentiation and/or regression of mammary tumors. To directly evaluate the role of PPAR{gamma} in mammary carcinogenesis, PPAR{gamma} wild-type (+/+) or heterozygous (+/–) mice were administered 1 mg 7,12-dimethylbenz[a]anthracene (DMBA) by gavage once a week for 6 weeks and followed for a total of 25 weeks. Compared with congenic PPAR{gamma}(+/+) littermate controls, PPAR{gamma}(+/–) mice had early evidence for increased susceptibility to DMBA-mediated carcinogenesis based on a 1.6-fold increase in the percentage of mice with skin papillomas, as well as a 1.7-fold increase in the numbers of skin papillomas per mouse (P < 0.05). Similarly, PPAR{gamma}(+/–) mice also had a 1.5-fold decreased survival rate (P = 0.059), and a 1.7-fold increased incidence of total tumors per mouse (P < 0.01). Moreover, PPAR{gamma}(+/–) mice had an almost 3-fold increase in mammary adenocarcinomas (P < 0.05), an over 3-fold increase in ovarian granulosa cell carcinomas (P < 0.05), an over 3-fold increase in malignant tumors (P < 0.02) and a 4.6-fold increase in metastatic incidence. These results are the first to demonstrate an increased susceptibility in vivo of PPAR{gamma} haploinsufficiency to DMBA-mediated carcinogenesis and suggest that PPAR{gamma} may act as a tumor modifier of skin, ovarian and breast cancers. The data also support evidence suggesting a beneficial role for PPAR{gamma}-specific ligands in the chemoprevention of mammary, ovarian and skin carcinogenesis.

Abbreviations: MMTV-LTR, mouse mammary tumor virus long terminal repeat; PPAR{gamma}, peroxisome proliferator activated receptor {gamma}.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
According to the American Cancer Society's 2003 statistics, breast cancer is the second leading cause of cancer death in women, where in the US alone, one in eight women are at risk. Current adjuvant treatments include chemotherapy and hormone therapy, such as with the anti-estrogen tamoxifen. While tamoxifen has proven efficacious in treating tumors, especially among those women at elevated risk, the benefits of this treatment are counter-balanced by problems with its side-effects, as well as a limited long-term efficacy after 5 years of therapy, and perhaps most importantly, the failure of a majority of women to respond to tamoxifen therapy (1,2). Hence, a better understanding of the mechanisms involved in breast cancer is needed to assist with the development of new chemopreventive therapies.

The peroxisome proliferator-activated receptors (PPARs), of which there are three family members ({alpha}, ß and {gamma}) first discovered in the early 1990 s, are members of the orphan nuclear receptor superfamily (35). PPAR{gamma} is expressed in a number of cell types, including adipocytes and macrophages (69). Ligands for PPAR{gamma} include not only natural compounds, such as 15-deoxy-{Delta}12,14-prostaglandin J2, 9- and 13-hydroxyoctadecanoic acid, 15-hydroxyeicosatetraenoic acid and linoleic acid (4,1012) as well as the newly discovered putative endogenous PPAR{gamma} agonist, lysophosphatidic acid (13), but also synthetic insulin-sensitizing thiazolidinedione compounds, such as troglitazone, BRL-49653 (aka rosiglitazone) and pioglitazone (14).

It was suggested that PPAR{gamma} ligands may help to promote differentiation and reduce the growth rate of breast adenocarcinoma cell lines in vitro and promote regression or stasis of 7,12-dimethylbenz[a]anthracene (DMBA)-mediated rat mammary tumors in vivo (11,1518). The results from another study to selectively delete PPAR{gamma} from mouse mammary tissue, by using the Cre-LoxP system and crossing mice with flanking lox P sites in the PPAR{gamma} gene to transgenic mice expressing either the whey acidic protein (WAP) or mouse mammary tumor virus long terminal repeat (MMTV-LTR) promoter driven Cre transgenes (19), suggests that the loss of PPAR{gamma} neither affects mammary development, nor leads to increased spontaneous tumor formation among mice where both alleles of PPAR{gamma} were disrupted (20).

Because classical PPAR{gamma} null mice die in utero around gestational day 10 (21), the objective of the current study was to directly evaluate the role of PPAR{gamma} in mammary carcinogenesis using a whole mouse model of PPAR{gamma} haploinsufficiency. These results show that PPAR{gamma}(+/–) mice have increased susceptibility toward DMBA-mediated carcinogenesis, and suggest a tumor modifier role for PPAR{gamma} in skin, ovarian and mammary tumors.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Chemicals and reagents
9,10-Dimethyl-1,2-benzanthracene, otherwise known as 7,12-dimethylbenz[a] anthracene (DMBA) was purchased from Sigma (St Louis, MO). Ten percent phosphate-buffered formalin was purchased from Fisher Scientific (Fair Lawn, NJ).

Animals
All mice were treated in accordance with protocols approved by the NCI Animal Care and Use Committee, and housed in microisolator cages on a 12 h light/dark cycle, with food and water provided ad libitum. PPAR{gamma} wild-type (+/+) and heterozygous (+/–) female mice were generated from crosses of PPAR{gamma}-floxed mice with the EIIa-Cre transgenic mouse as described previously (22). The mice used in this study are of mixed C57Bl6/NCr;Sv129;FVB/NCr background and were bred using sibling mating for at least 16 generations prior to the start of the study.

PPAR{gamma} PCR analysis
PCR analysis to detect PPAR{gamma} wild-type and null bands was performed using primers designed to amplify around exon 2 (Figure 1). Briefly, tail DNA (~0.5 µg) was incubated with one forward primer 2F: CTC CAA TGT TCT CAA ACT TAC, and two reverse primers 1R: GAT GAG TCA TGT AAG TTG ACC and H5: GTA TTC TAT GGC TTC CAG TGC ([Final] = 0.25 µM), 10x PCR buffer (Perkin Elmer, Foster City, CA) ([Final] = 1x), dNTPs ([Final] = 0.2 µM), MgCl2 (Perkin Elmer) ([Final] = 2 mM), Taq polymerase (Perkin Elmer) ([Final] = 2.5 U) and autoclaved Millipore-filtered water up to a 25 µl final volume. PCR reactions were run on a thermal cycler at 94°C, 2 min, 33 cycles at (94°C, 1 min, 60°C, 1 min, 72°C, 1:15 min), 72°C, 5 min and 4°C. A 2% agarose–TBE gel electrophoresis followed by ethidium bromide staining was used to detect bands. Expected sizes of PPAR{gamma} bands are wild-type allele ~250 bp and null allele ~450 bp.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 1. PPAR{gamma} PCR genotyping strategy. (Upper panel) PPAR{gamma}(+/–) and PPAR{gamma}(+/+) mice were generated during the formation of our PPAR{gamma} conditional knockout mouse colony as described elsewhere (22). PCR primers were designed around the inserted lox P sites flanking exon 2 of the PPAR{gamma} gene. Primer sequences are provided. (Lower panel) Expected band sizes are 250 bp for the wild-type allele and 450 bp for the null allele. All mouse genotypes were confirmed prior to initiating DMBA treatment.

 
DMBA by gavage
DMBA was dissolved in sesame oil to give a 10 mg/ml stock concentration and a total of 44 PPAR{gamma}(+/+) and 39 PPAR{gamma}(+/–) 8–12-week-old female mice were gavaged p.o. with 0.1 ml (total 1 mg) DMBA once a week for 6 weeks. Gross/clinical examinations of mice were done weekly, for a total of 25 weeks, to monitor body weights, skin papilloma and tumor progression. Mice were killed by cervical dislocation either at the end of the study or earlier if they displayed significant weight loss, signs of distress or palpable tumors >2 cm in diameter.

Pathology
All mice were necropsied. Tissues including tumors were fixed in 10% phosphate-buffered formalin and embedded in paraffin. Sections were prepared and stained with hematoxylin and eosin, and subjected to a blind review by a pathologist.

Analysis of PPAR{gamma} gene expression by real-time quantitative PCR
Total RNA was isolated from untreated tissues of PPAR{gamma}(+/–) or wild-type mice as described previously (22). Extracted RNA (1 µg) was mixed with chloramphenicol acetyltransferase (CAT) RNA (Invitrogen, Carlsbad, CA) (50 pg) as the external control, and reverse transcribed using Super Script II (Invitrogen) according to the manufacturer's instructions. Quantitative gene expression analysis was performed on an ABI PRISM 7900HT machine (Applied Biosystems, Warrington, UK) according to the manufacturer's instructions, and using the methods of Hoekstra et al. (23), with the following modifications. In 96-well optical plates, 12.5 µl of SYBR green master mix (Applied Biosystems) was added to 50 ng of cDNA template, and 300 nM of forward and reverse primers in water. Plates were heated at 50°C for 2 min and 95°C for 10 min, then run for 45 PCR cycles comprised of 95°C for 15 s and 60°C for 60 s. Samples were then heated at 95°C for 20 min at the end of run. Primers for PPAR{gamma} (forward CATGCTTGTGAAGGATGCAAG; reverse TTCTGAAACCGACAGTACTGACAT) (SIGMA Genosys, The Woodlands, TX) were as described previously (23), while primers for CAT (forward ACACGCCACA1TCTTCGCAAT; reverse CACCGTTTTCCATGAGCAAACT) were designed using PrimerExpress software (Applied Biosystems).

Northern blot analysis
RNA isolation from tissues and papillomas, and northern blot analysis for PPAR{gamma} mRNA expression versus that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was performed as described elsewhere (22).

Statistical analysis
Statistical significance was determined for the rate of tumor formation in PPAR{gamma} wild-type and heterozygous mice with a Student's t-test or Fisher's Exact test where appropriate. Survival was analyzed using a Log Rank test. Significance was accepted for P values <0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In the present study, all female PPAR{gamma} heterozygous knockout [PPAR{gamma}(+/–)] and congenic wild-type littermate control [PPAR{gamma}(+/+)] mice were treated with DMBA. A PCR based assay was established to confirm the PPAR{gamma} genotype of mice and was performed prior to the start of the study (Figure 1). Body weights of PPAR{gamma}(+/–) and littermate control PPAR{gamma}(+/+) mice were not significantly different prior to the start of, or at any time during, the course of this study, suggesting this level of DMBA dosing was not toxic to the animals (Figure 2).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2. Effect of DMBA treatment on body weights of PPAR{gamma} heterozygous (+/–) and wild-type (+/+) control mice. PPAR{gamma} heterozygous (+/–) and wild-type (+/+) control mice were treated with DMBA, prepared as described in the Materials and Methods section and administered p.o. by gavage, once a week for 6 weeks. Mice were then followed once a week for a total of 25 weeks to monitor body weight. Values are expressed in grams and represent mean ± SD.

 
Compared with congenic PPAR{gamma}(+/+) littermates treated with DMBA, skin papillomas first started to appear in PPAR{gamma}(+/–) mice 3 weeks following the last dose of DMBA (week 9 from the start of the study). Skin papillomas were noted in areas ranging from ventral midline to dorsal lateral surfaces, and from sub-ocular to vaginal opening areas, but were not confined to any specific region. By the end of the 25th week from the start of the study, the multiplicity of skin papillomas was significantly greater among PPAR{gamma}(+/–) (0.87 papillomas/mouse) compared with PPAR{gamma}(+/+) controls (0.52 papillomas/mouse) (P < 0.05) (Figure 3A). In fact, upwards of 64% (25 out of 39) of PPAR{gamma}(+/–) compared with only 41% (18 out of 44) of PPAR{gamma}(+/+) controls presented with skin papillomas by the end of the study (P < 0.05) (Figure 3B). By the end of the observation period, ~41% (18 out of 44) of PPAR{gamma}(+/+) and ~61% (24 out of 39) of PPAR{gamma}(+/–) mice died, or had to be killed due to morbidity resulting from tumor progression, with the majority of cases occurring between weeks 13 and 21 (Figure 4A). Analysis of the survival curve revealed that 50% of PPAR{gamma}(+/–) mice died between weeks 19 and 20 from the start of the study while PPAR{gamma}(+/+) mice did not reach this plateau during the observational period of the study, although the overall survival curve was not statistically different (P = 0.059). Upon pathological analyses, the incidence of PPAR{gamma}(+/+) and PPAR{gamma}(+/–) mice presenting with any type of tumor was similar for both genotypes (93 and 95%, respectively), however the total tumor multiplicity was significantly higher among the PPAR{gamma} heterozygotes when compared with wild-type controls, respectively 3.69 (144 total tumors) versus 2.18 (96 total tumors) (P < 0.01) (Figure 4B).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Skin papillomas among DMBA-treated PPAR{gamma} heterozygous (+/–) and wild-type (+/+) control mice. (A) Skin papilloma multiplicity. PPAR{gamma} heterozygous (+/–) and wild-type (+/+) control mice were treated with DMBA as described in Figure 2 and followed once a week for a total of 25 weeks to monitor tumor progression. Skin papilloma multiplicity was calculated based on the number of papillomas per mouse having papillomas within a given genotype. (B) Skin papilloma incidence. Percentage of mice with papillomas was calculated based on numbers of mice in a given genotype showing skin papillomas out of the total number of mice in the genotype. Open circles, PPAR{gamma}(+/+); closed circles, PPAR{gamma}(+/–) mice.

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. DMBA-mediated carcinogenesis summary. (A) Survival curve. Survival curves were based on the number of mice still alive within a genotype in a given week. Open circles, PPAR{gamma}(+/+); closed circles, PPAR{gamma}(+/–) mice, P = 0.059. (B) Total tumors per mouse. Total tumors per mouse were calculated based on the combination of observed tumors and skin papillomas for a given genotype divided by the number of mice per genotype. *Different from respective wild-type controls (P < 0.001).

 
Pathological analysis revealed differences between tumors from wild-type and PPAR{gamma}(+/–) mice (Figure 5). Representative tumor samples are shown illustrating that compared with those from PPAR{gamma}(+/+) mice (Figure 5A, C and E), tumors derived from PPAR{gamma}(+/–) mice (Figure 5B, D and F–H) were in a more advanced state of progression. This was particularly true for mammary glands and ovarian tissues.



View larger version (140K):
[in this window]
[in a new window]
 
Fig. 5. Effect of PPAR{gamma} deficiency on DMBA-induced tumor pathology. Formalin-fixed tumors were sectioned and stained to determine cellular origin of the respective tumor and analysed in a blinded fashion by a pathologist. Representative tumor samples are shown illustrating that compared with those from PPAR{gamma}(+/+) mice (A, C and E), PPAR{gamma}(+/–) tumors (B, D, F, G and H) were in a more advanced state of progression. (A) Mammary duct papilloma. (B) Mammary adenocarcinoma. (C) Uterine hemangioma. (D) Uterine hemangiosarcoma. (E) Alveolar adenoma. (F) Ovarian granulosa cell carcinoma 200x. (G) Lung metastasis from ovarian granulosa cell carcinoma. (H) Liver metastasis from ovarian granulosa cell carcinoma 100x.

 
Tissue distribution and breakdown of the various tumors identified also revealed differences between the two genotypes (Table I). Notably, while the spectrum of tumors is consistent with the well established pattern of DMBA-initiated carcinogenesis, the ratio of total skin tumors per genotype was significantly higher among PPAR{gamma}(+/–) [1.21 total skin tumors per PPAR{gamma}(+/–) mice] compared with wild-type controls [0.64 total skin tumors/PPAR{gamma}(+/+) mice] (P = 0.01). Of the total tumors found in the skin, the incidences of not only papillomas (P < 0.05), but also squamous cell carcinomas (P < 0.06), were higher on their own among PPAR{gamma}(+/–) mice when compared with PPAR{gamma}(+/+) littermates, although the latter was not significant on a statistical level. When compared with respective PPAR{gamma}(+/+) mice, PPAR{gamma}(+/–) mice also had a 2.8-fold higher multiplicity of total mammary gland tumors per mouse (respectively, +/+ versus +/–: 0.18 versus 0.51, P = 0.07), wherein the number of adenosquamous carcinomas per mouse alone was 3.4-fold higher (respectively, +/+ versus +/–: 6 out of 44 versus 18 out of 39, P < 0.05) (Table I). Included within the listing for adenocarcinomas in the mammary gland (Table I), are the previous values for adenosquamous carcinomas, one acinar adenocarcinoma each for both PPAR{gamma}(+/+) and PPAR{gamma}(+/–) mice, as well as one myoepithelial carcinoma for PPAR{gamma}(+/–) mice. Interestingly, while the multiplicity of total ovarian tumors did not differ between the two genotypes, when the tumors were sorted by class into benign versus malignant, PPAR{gamma}(+/–) mice had a significantly higher multiplicity of malignant tumors per mouse when compared with wild-type controls (carcinomas out of total ovarian tumors, respectively +/+ versus +/–: 3 out of 12 versus 10 out of 13, P < 0.02). A similar trend was also observed for mammary tumors whereby the number of malignant (carcinoma) tumors per mouse in PPAR{gamma}(+/–) mice was 3.2-fold higher compared with congenic wild-type controls (respectively, +/+ versus +/–: 7 out of 44 mice versus 20 out of 39, P < 0.0001). More importantly, when total tumors in any tissue were sorted as a whole into benign or malignant (carcinoma) categories, DMBA-treated PPAR{gamma}(+/–) mice had a significant 3.2-fold higher proportion of malignant tumors per mouse compared with wild-type controls, respectively 1.23 (48 tumors out 39 mice) versus 0.39 (17 tumors out of 44 mice) (P < 0.05). The metastatic incidence to lung and/or liver was also higher among PPAR{gamma}(+/–) mice compared with PPAR{gamma} wild-type controls, where nine PPAR{gamma}(+/–) mice had metastases, four cases each originating from ovarian granulosa cell carcinomas or mammary gland adenocarcinomas and one case originating from hepatic hemangiosarcoma, versus only two such metastatic incidences among PPAR{gamma} wild-type mice, although this difference was not significant statistically.


View this table:
[in this window]
[in a new window]
 
Table I. DMBA-induced tumors in PPAR{gamma}(+/+) and PPAR{gamma}(+/–) mice

 
A QRT-PCR analysis of PPAR{gamma} RNA in several normal tissues and skin papillomas from wild-type and PPAR{gamma} heterozygous mice was performed (Table II). From the data, PPAR{gamma} RNA expression represented as a ratio of PPAR{gamma}/CAT levels is clearly evident in normal tissues from PPAR{gamma}(+/+) mice with the highest expression in white and brown adipose tissues and colon, and significantly lower expression in all cases among normal tissues from PPAR{gamma}(+/–) mice (P < 0.05). Levels of mRNA in the mammary gland were also relatively high, reflective of the high amount of fat in this tissue. However, relative levels of PPAR{gamma} mRNA in skin were <4% of that found in adipose tissue. Interestingly, DMBA-induced papillomas from PPAR{gamma}(+/+) mice failed to show any detectable PPAR{gamma} expression, as compared with either the low expression in normal skin or the relatively high expression among adipose tissue. The data were confirmed by northern blot analysis showing only faint mRNA bands in the epidermis and papillomas from PPAR{gamma}(+/+) mice (Figure 6).


View this table:
[in this window]
[in a new window]
 
Table II. QRT-PCR analysis of PPAR{gamma} tissue expression in untreated PPAR{gamma} heterozygous (+/–) and wild-type (+/+) mice, and respective DMBA-mediated skin papillomas

 


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 6. Northern blot analysis comparing PPAR{gamma} mRNA expression in untreated tissues and DMBA-mediated skin papillomas from PPAR{gamma} wild-type (+/+) mice. Untreated skin and epididymal white adipose tissue (WAT) or DMBA-mediated skin papillomas (PAP) were obtained from PPAR{gamma} wild-type (+/+) mice. RNA isolation and northern blot analysis for PPAR{gamma} mRNA expression versus that of GAPDH was performed as described elsewhere (22).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
These studies demonstrate that PPAR{gamma}(+/–) deficient mice have increased susceptibility toward DMBA-mediated carcinogenesis, suggesting that PPAR{gamma} functions to suppress tumorigenesis in mammary tissue, ovaries and skin. Compared with congenic PPAR{gamma}(+/+) littermate controls, PPAR{gamma}(+/–) mice had early evidence for increased susceptibility to DMBA-mediated carcinogenesis based on not only an increase in the incidence of mice with skin papillomas, but also an increase in the multiplicity of skin papillomas. In addition, compared with PPAR{gamma}(+/+) controls following DMBA treatment, PPAR{gamma}(+/–) mice had a decreased survival rate and an increased number of total tumors per mouse. Histological analysis of tumors revealed a pattern of DMBA-mediated carcinogenesis consistent with a previous report using this carcinogen (24) where the majority of tumors were located in the skin, ovaries and mammary glands, but other affected tissues were also noted including uterus, liver, lung, the hematopoietic system and pancreas. Furthermore, when tumors were classified on the basis of benign versus malignant, PPAR{gamma}(+/–) mice had a significant increase in malignant forms of all tumors identified, as well as an increase in metastatic tumors, when compared with PPAR{gamma}(+/+) controls. Hence, PPAR{gamma} appears to play a role in suppressing not only tumor initiation, but also progression following carcinogen treatment.

While vehicle-treated controls were not used in this study, vehicle (sesame oil) has been shown in numerous published studies to not only have an absence of pro-carcinogenic activity, but also has the potential, possibly through anti-oxidant properties, to act as a chemopreventive agent (2527). This suggests that the tumors observed in this study were due solely to the carcinogenic effects of DMBA (24,28). In addition, no observed spontaneous carcinogenesis was seen among untreated PPAR{gamma}(+/+) or PPAR{gamma}(+/–) mice, consistent with previous long-term observations using mammary gland directed WAP or MMTV-LTR promoter-mediated Cre recombination of PPAR{gamma} on both alleles (20), and our unpublished observations. In the former study, only 2 out of 30 PPAR{gamma} MMTV-LTR Cre+ mice and 1 out of 20 control mice had developed breast tumors after 15 months (20); however, the type and stage of these tumors was not analyzed. This indicates that PPAR{gamma} might only influence chemically induced, and not spontaneous, cancers. However, recombination of PPAR{gamma} was limited exclusively to mammary epithelium by the WAP Cre and, depending on the mouse line examined, to mammary ductal and alveolar epithelium, salivary glands, oocytes, ovarian granlulosa cells, megakaryocytes and B- and T-cells, or several secretory organs and the hematopoietic system by the MMTV-LTR Cre (20).

The results with DMBA-induced tumors are consistent with previous reports suggesting that PPAR{gamma} functions to suppress tumorigenesis in the colon following azoxymethane treatment (2931). Previous studies revealed loss of function somatic mutations in the PPAR{gamma} gene in sporadic human colon cancers (29). More recently, PPAR{gamma} was shown to influence colon cancer in the mouse (31). Following treatment with the colon carcinogen azoxymethane, PPAR{gamma}(+/–) mice alone were found to be more sensitive than wild-type mice as reflected by an increased formation of colon polyps. However, when PPAR{gamma}(+/–) were crossed to a model of familial adenomatous polyposis, Apc+/1638 mice, PPAR{gamma} haploinsufficiency did not influence polyp formation. Thus, this receptor does appear to act as an early tumor suppressor gene in the colon, albeit this effect was shown to be limited once the initiating effect had occurred as is found in Apc+/1638 mice (31). In addition, recent work has added further evidence to support the notion that PPAR{gamma} acts as a tumor suppressor gene in the colon based on reduction in azoymethane-induced aberrant crypt foci formation in Balb/c mice following treatment with PPAR{gamma} ligands (30).

Interestingly, the data here suggest that PPAR{gamma} also may play a role in progression given the advanced stage of tumors in the heterozygotes compared with wild-type controls. An anti-proliferative role for PPAR{gamma} is supported by several in vitro and in vivo studies demonstrating that both natural and synthetic PPAR{gamma} ligands block growth and/or induce regression in chemically induced prostate carcinomas (32,33). One previous report has shown that human microvascular endothelial cells can promote proliferation of neighboring pre-adipocytes via as yet unidentified paracrine signaling (34). This may help to explain the differences seen between colon and mammary gland. In light of the extensive vascularization present in mammary as compared with colon tissue, it is possible that PPAR{gamma}(+/–) mice may have enhanced signaling between endothelial cells and those DMBA-initiated cells present in mammary gland, thus promoting tumor growth as well, although this remains speculative.

The relative lower level of PPAR{gamma} RNA expression in all tissues from PPAR{gamma}(+/–) mice compared with PPAR{gamma} wild-type controls is consistent with a previous study showing decreased PPAR{gamma} protein expression in colons from PPAR{gamma}(+/–) compared with wild-type controls (31). However, the lack of detectable levels of PPAR{gamma} expression among DMBA-induced papillomas from either PPAR{gamma}(+/–) or wild-type mice is consistent with published reports of trace to undetectable levels of PPAR{gamma} mRNA in both mouse and human normal or lesional skin (3537). Similarly, several reports have shown decreased expression of PPAR{gamma} protein in human breast and colon cancers, where expression is highest in normal tissue and progressively decreases among samples from benign to malignant states of the disease (11,38,39). In a recent study, PPAR{gamma} mRNA and protein was also shown to be lowest among MNU-induced rat mammary tumors as compared with the higher expression seen in normal tissues (40). Immunostaining for PPAR{gamma} among DMBA-initiated tumors from PPAR{gamma}(+/–) and wild-type mice from this study (data not shown) demonstrated a pattern of protein expression consistent with that reported above. Since the mRNA and protein is low to undetectable among tumors from PPAR{gamma}(+/+) mice, analysis of PPAR{gamma} in tumors from PPAR{gamma}(+/–) mice to examine loss of heterozygosity was not feasible.

The relatively low expression of PPAR{gamma} in skin as described herein and elsewhere, suggests that the receptor is not acting as a direct tumor suppressor in the epidermal target tissue. However, there are other possible mechanisms to explain the increased DMBA-mediated skin tumors among PPAR{gamma}(+/–) mice as compared with PPAR{gamma}(+/+) controls. Given that cytochrome P450 (CYP) 1B1-null mice were reportedly protected from skin tumors compared with wild-type controls (24), and that skin is well known to express CYP1B1 (41), the increased incidence of skin tumors among PPAR{gamma}(+/–) mice compared with wild-type controls seen in this study suggests a possible role of PPAR{gamma} as a regulator of CYP1B1-mediated bioactivation of DMBA to its carcinogenic metabolites resulting in the initiation of transformed epidermal cells into latent neoplastic cells, although PPAR{gamma}-mediated regulation of detoxifying/cytoprotective and/or DNA repair pathways cannot be discounted and warrant further study. Furthermore, promotion and progression of initiated neoplastic cells may result from the influence of an increased inflammatory response among PPAR{gamma} haploinsufficient mice. Several reports have shown previously that an increase in inflammatory cell infiltrates following UV radiation promoted skin tumor growth, in an inflammatory-dependent but immunosuppression-independent manner, suggesting a paracrine role for macrophages (42,43). Similarly, reports that antibodies to tumor necrosis factor alpha (TNF{alpha}) were able to block DMBA-mediated skin tumors, and that TNF{alpha}-null mice were resistant to chemically mediated skin tumors, suggest that early induction of TNF{alpha} is critical for skin tumor promotion (44,45). PPAR{gamma} has a well-defined role as a negative regulator of both native and acquired immune responses (46,47), and its expression among cells of the immune system including macrophages is well known (22,48). In another mouse model of PPAR{gamma} haploinsufficiency, PPAR{gamma}(+/–) mice were reported to have increased arthritis further supporting an anti-inflammatory role for PPAR{gamma} (49). PPAR{gamma} agonists have also been shown to down-regulate pro-inflammatory mediators such as TNF{alpha} and COX-2 in PPAR{gamma}-expressing cells (5053). In addition, these pro-inflammatory mediators may up-regulate downstream targets such as prostaglandin E2 and matrix metalloproteinases in a variety of cell types including both macrophages and epidermal cells, and have been shown previously to correlate with the transformation of epithelial cells and skin tumor growth and progression (5456). Thus, decreased PPAR{gamma} expression among PPAR{gamma}(+/–) mice may result in the establishment of a pro-inflammatory environment upon invasion into the skin of immune cells such as macrophages, through induction of paracrine mediators. Ultimately, this altered environment may contribute to the growth and progression of skin tumors following DMBA treatment although this remains speculative. However, the possibility that a spread of tumor cells from lymphatic or blood vessels in the mammary glands or other metastasizing tumor sites contributed in part to the increased incidence of skin tumors among PPAR{gamma} haploinsufficient mice cannot be discounted.

After this paper had been accepted, Saez et al. (57) reported that ligand-independent PPAR{gamma} signaling promotes mammary tumor development, which may be the result of increased Wnt signaling. Generation of ligand-independent PPAR{gamma} target gene expression in the mammary gland was accomplished by placing a construct of a fusion protein of the PPAR{gamma}1 isoform with the activation domain of the herpes simplex virus VP16 co-activator protein, under the control of the MMTV promoter. These ‘MMTV-VpPPAR{gamma} mice were then bred with a susceptible strain of transgenic mice expressing the polyoma virus middle T antigen in the mammary gland (MMTV-PyV), shown previously to have a rapid spontaneous appearance of multifocal adenocarcinomas (58). While MMTV-VpPPAR{gamma} mice were not different from wild-type controls, animals heterozygous for both transgenes had accelerated tumor growth kinetics compared with MMTV-PyV mice, suggesting that following tumor initiation, PPAR{gamma} signaling acts as a strong tumor promoter in the mammary gland (57). It was further suggested that the observed PPAR{gamma} tumor-promoting effects were the result of enhanced Wnt signaling given the pattern of altered Wnt target gene expression, such as cyclin D1, as well as embryonic defects induced in zebrafish were comparable when either PPAR{gamma} or Wnt were activated (57). One explanation for the differences seen between the results of Saez et al. (57) and those here may be the result of the differences in targeting strategies. While the former study focused on constitutive ligand-independent expression of the PPAR{gamma}1 in epithelial cells of the mammary gland, the results observed here represent the effects of reduced expression of both PPAR{gamma} isoforms in all tissues examined. In addition, as discussed below, the increased expression of genes such as cyclin D1 in tumors from bigenic mice having constitutive PPAR{gamma} expression may be independent of Wnt activity and rather reflect a shift in the cellular use of co-regulator proteins such as p300, which would not be necessary for PPAR{gamma} activity, although this requires further investigation. Interestingly, crosses between PPAR{gamma} heterozygous mice, different from that used in this study, to MMTV-PyV mice were reported to have no significant difference in tumor latency or histology compared with mice with two functional copies of PPAR{gamma} (57). However, PPAR{gamma} expression is present in not only mammary epithelial, but also stromal cells (11), and RT-PCR has shown that PPAR{gamma} mRNA expression was highest in the latter cell type (20). It is possible that since the initiating effects of PyV are restricted to epithelial cells of the mammary gland that the tumors formed may not reflect the role of PPAR{gamma} with respect to the whole mammary gland response to tumorigenesis. It is also possible that differences in the genetic backgrounds of the mice used in the two studies contributed to the contrasting observations. Nevertheless, the results here suggest further work is necessary to clarify the role of both PPAR{gamma} in the various cell types of the mammary gland to tumorigenesis.

Several in vitro studies have suggested that growth inhibition of human breast cancer cell lines with PPAR{gamma} agonists is mediated partly by both reduced activation of epidermal growth factor receptors via inhibition of tyrosine phosphorylation (59), as well as up-regulation of PTEN expression (60). In addition, natural or synthetic ligands for PPAR{gamma} have been shown to down-regulate cyclin D1 (61,62). This down-regulation occurs both through inhibition of transcription, via competition with c-fos, which is normally bound to the cyclin D1 promoter, for cellular p300 co-regulator protein, as well as via increased proteasomal degradation through ubiquitin targeting. Similarly, another study reports that cyclin D1 up-regulation can repress PPAR{gamma} expression and transactivation (38). Moreover, Qin et al. (62), have shown recently that in MCF-7 cells estrogen receptor alpha (ER{alpha}) is similarly down-regulated via ubiquitin-mediated proteasomal degradation. Given that cyclin D1 plays a critical role in G0/G1->S phase cell cycle progression, and a role in early stage breast cancers for over-expression of ER{alpha} reported (63), in vivo disruption of one allele of PPAR{gamma} in our mouse model may result in increased cyclin D1 and ER{alpha} activation leading to the increased DMBA-mediated carcinogenesis seen here. Alternatively, BRCA1 has been implicated as a tumor suppressor in both breast and ovarian carcinomas given its role not only via the repression of estrogen receptor-mediated transcription (64,65), but also through induction of apoptotic pathway genes (66,67). Mutations in BRCA1 have also been associated with familial breast and ovarian cancer, and expression was found to be low to undetectable in sporadic breast cancers, ovarian carcinomas, as well as several breast cancer cell lines (68,69). More recently, PPAR{gamma} has been identified as a gene capable of directly regulating expression of BRCA1 through a functional PPAR{gamma} responsive element in the BRCA1 promoter, and consequently may play a critical role in BRCA1 regulation (70). In addition, PPAR{gamma} expression has been found in ovaries from several species, including humans (71) and mice (20), although primarily located within granulosa cells (72). Thus, decreased PPAR{gamma} expression among PPAR{gamma}(+/–) mice may result in the decreased expression of BRCA1 in mammary glands and ovaries, contributing to the increased carcinomas seen here following DMBA treatment.

Taken as a whole, the results here demonstrate that PPAR{gamma}(+/–) mice have an increased susceptibility to DMBA-initiated carcinogenesis. These results are the first to show an increased susceptibility in vivo of PPAR{gamma}(+/–) mice to DMBA-mediated carcinogenesis and thus suggest that PPAR{gamma} may act as a tumor modifier. The data also support evidence suggesting a beneficial role for PPAR{gamma}-specific ligands in the chemoprevention of mammary, ovarian and skin carcinogenesis.


    Acknowledgments
 
We thank Amanda Burns for expert technical assistance.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Fisher,B., Dignam,J., Bryant,J. et al. (1996) Five versus more than five years of tamoxifen therapy for breast cancer patients with negative lymph nodes and estrogen receptor-positive tumors. J. Natl Cancer Inst., 88, 1529–1542.[Abstract/Free Full Text]
  2. Jordan,V.C. (1995) Third annual William L. McGuire Memorial Lecture. ‘Studies on the estrogen receptor in breast cancer’—20 years as a target for the treatment and prevention of cancer. Breast Cancer Res. Treat., 36, 267–285.[CrossRef][Web of Science][Medline]
  3. Issemann,I. and Green,S. (1990) Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature, 347, 645–650.[CrossRef][Medline]
  4. Dreyer,C., Krey,G., Keller,H., Givel,F., Helftenbein,G. and Wahli,W. (1992) Control of the peroxisomal beta-oxidation pathway by a novel family of nuclear hormone receptors. Cell, 68, 879–887.[CrossRef][Web of Science][Medline]
  5. Kliewer,S.A., Forman,B.M., Blumberg,B., Ong,E.S., Borgmeyer,U., Mangelsdorf,D.J., Umesono,K. and Evans,R.M. (1994) Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc. Natl Acad. Sci. USA, 91, 7355–7359.[Abstract/Free Full Text]
  6. Braissant,O., Foufelle,F., Scotto,C., Dauca,M. and Wahli,W. (1996) Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta and -gamma in the adult rat. Endocrinology, 137, 354–366.[Abstract]
  7. Lemberger,T., Braissant,O., Juge-Aubry,C., Keller,H., Saladin,R., Staels,B., Auwerx,J., Burger,A.G., Meier,C.A. and Wahli,W. (1996) PPAR tissue distribution and interactions with other hormone-signaling pathways. Ann. N. Y. Acad. Sci., 804, 231–251.[Web of Science][Medline]
  8. Nagy,L., Tontonoz,P., Alvarez,J.G., Chen,H. and Evans,R.M. (1998) Oxidized LDL regulates macrophage gene expression through ligand activation of PPARgamma. Cell, 93, 229–240.[CrossRef][Web of Science][Medline]
  9. Tontonoz,P., Hu,E., Graves,R.A., Budavari,A.I. and Spiegelman,B.M. (1994) mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev., 8, 1224–1234.[Abstract/Free Full Text]
  10. Muller,G., Ertl,J., Gerl,M. and Preibisch,G. (1997) Leptin impairs metabolic actions of insulin in isolated rat adipocytes. J. Biol. Chem., 272, 10585–10593.[Abstract/Free Full Text]
  11. Mueller,E., Sarraf,P., Tontonoz,P., Evans,R.M., Martin,K.J., Zhang,M., Fletcher,C., Singer,S. and Spiegelman,B.M. (1998) Terminal differentiation of human breast cancer through PPAR gamma. Mol. Cell, 1, 465–470.[CrossRef][Web of Science][Medline]
  12. Kubota,N., Terauchi,Y., Miki,H. et al. (1999) PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol. Cell, 4, 597–609.[CrossRef][Web of Science][Medline]
  13. McIntyre,T.M., Pontsler,A.V., Silva,A.R. et al. (2003) Identification of an intracellular receptor for lysophosphatidic acid (LPA): LPA is a transcellular PPARgamma agonist. Proc. Natl Acad. Sci. USA, 100, 131–136.[Abstract/Free Full Text]
  14. Larsen,T.M., Toubro,S. and Astrup,A. (2003) PPARgamma agonists in the treatment of type II diabetes: is increased fatness commensurate with long-term efficacy? Int. J. Obes. Relat. Metab. Disord., 27, 147–161.[CrossRef][Web of Science][Medline]
  15. Elstner,E., Muller,C., Koshizuka,K., Williamson,E.A., Park,D., Asou,H., Shintaku,P., Said,J.W., Heber,D. and Koeffler,H.P. (1998) Ligands for peroxisome proliferator-activated receptorgamma and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice. Proc. Natl Acad. Sci. USA, 95, 8806–8811.[Abstract/Free Full Text]
  16. Mehta,R.G., Williamson,E., Patel,M.K. and Koeffler,H.P. (2000) A ligand of peroxisome proliferator-activated receptor gamma, retinoids and prevention of preneoplastic mammary lesions. J. Natl Cancer Inst., 92, 418–423.[Abstract/Free Full Text]
  17. Pighetti,G.M., Novosad,W., Nicholson,C., Hitt,D.C., Hansens,C., Hollingsworth,A.B., Lerner,M.L., Brackett,D., Lightfoot,S.A. and Gimble,J.M. (2001) Therapeutic treatment of DMBA-induced mammary tumors with PPAR ligands. Anticancer Res., 21, 825–829.[Web of Science][Medline]
  18. Suh,N., Wang,Y., Williams,C.R., Risingsong,R., Gilmer,T., Willson,T.M. and Sporn,M.B. (1999) A new ligand for the peroxisome proliferator-activated receptor-gamma (PPAR-gamma), GW7845, inhibits rat mammary carcinogenesis. Cancer Res., 59, 5671–5673.[Abstract/Free Full Text]
  19. Wagner,K.U., Wall,R.J., St-Onge,L., Gruss,P., Wynshaw-Boris,A., Garrett,L., Li,M., Furth,P.A. and Hennighausen,L. (1997) Cre-mediated gene deletion in the mammary gland. Nucleic Acids Res., 25, 4323–4330.[Abstract/Free Full Text]
  20. Cui,Y., Miyoshi,K., Claudio,E., Siebenlist,U.K., Gonzalez,F.J., Flaws,J., Wagner,K.U. and Hennighausen,L. (2002) Loss of the peroxisome proliferation-activated receptor gamma (PPARgamma) does not affect mammary development and propensity for tumor formation but leads to reduced fertility. J. Biol. Chem., 277, 17830–17835.[Abstract/Free Full Text]
  21. Barak,Y., Nelson,M.C., Ong,E.S., Jones,Y.Z., Ruiz-Lozano,P., Chien,K.R., Koder,A. and Evans,R.M. (1999) PPAR gamma is required for placental, cardiac and adipose tissue development. Mol. Cell, 4, 585–595.[CrossRef][Web of Science][Medline]
  22. Akiyama,T.E., Sakai,S., Lambert,G. et al. (2002) Conditional disruption of the peroxisome proliferator-activated receptor gamma gene in mice results in lowered expression of ABCA1, ABCG1 and apoE in macrophages and reduced cholesterol efflux. Mol. Cell. Biol., 22, 2607–2619.[Abstract/Free Full Text]
  23. Hoekstra,M., Kruijt,J.K., Van Eck,M. and Van Berkel,T.J. (2003) Specific gene expression of ATP-binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial and Kupffer cells. J. Biol. Chem., 278, 25448–25553.[Abstract/Free Full Text]
  24. Buters,J.T., Sakai,S., Richter,T., Pineau,T., Alexander,D.L., Savas,U., Doehmer,J., Ward,J.M., Jefcoate,C.R. and Gonzalez,F.J. (1999) Cytochrome P450 CYP1B1 determines susceptibility to 7, 12-dimethylbenz[a]anthracene-induced lymphomas. Proc. Natl Acad. Sci. USA, 96, 1977–1982.[Abstract/Free Full Text]
  25. Taguchi,O., Michael,S.D. and Nishizuka,Y. (1988) Rapid induction of ovarian granulosa cell tumors by 7,12-dimethylbenz(a)anthracene in neonatally estrogenized mice. Cancer Res., 48, 425–429.[Abstract/Free Full Text]
  26. Kapadia,G.J., Azuine,M.A., Tokuda,H., Takasaki,M., Mukainaka,T., Konoshima,T. and Nishino,H. (2002) Chemopreventive effect of resveratrol, sesamol, sesame oil and sunflower oil in the Epstein-Barr virus early antigen activation assay and the mouse skin two-stage carcinogenesis. Pharmacol. Res., 45, 499–505.[CrossRef][Web of Science][Medline]
  27. Kaufmann,Y., Luo,S., Johnson,A., Babb,K. and Klimberg,V.S. (2003) Timing of oral glutamine on DMBA-induced tumorigenesis. J. Surg. Res., 111, 158–165.[CrossRef][Web of Science][Medline]
  28. Fischer,S.M., Conti,C.J., Locniskar,M., Belury,M.A., Maldve,R.E., Lee,M.L., Leyton,J., Slaga,T.J. and Bechtel,D.H. (1992) The effect of dietary fat on the rapid development of mammary tumors induced by 7,12-dimethylbenz(a)anthracene in SENCAR mice. Cancer Res., 52, 662–666.[Abstract/Free Full Text]
  29. Sarraf,P., Mueller,E., Smith,W.M., Wright,H.M., Kum,J.B., Aaltonen,L.A., de la Chapelle,A., Spiegelman,B.M. and Eng,C. (1999) Loss-of-function mutations in PPAR gamma associated with human colon cancer. Mol. Cell, 3, 799–804.[CrossRef][Web of Science][Medline]
  30. Osawa,E., Nakajima,A., Wada,K. et al. (2003) Peroxisome proliferator-activated receptor gamma ligands suppress colon carcinogenesis induced by azoxymethane in mice. Gastroenterology, 124, 361–367.[CrossRef][Web of Science][Medline]
  31. Girnun,G.D., Smith,W.M., Drori,S. et al. (2002) APC-dependent suppression of colon carcinogenesis by PPARgamma. Proc. Natl Acad. Sci. USA, 99, 13771–13776.[Abstract/Free Full Text]
  32. Butler,R., Mitchell,S.H., Tindall,D.J. and Young,C.Y. (2000) Nonapoptotic cell death associated with S-phase arrest of prostate cancer cells via the peroxisome proliferator-activated receptor gamma ligand, 15-deoxy-delta12,14-prostaglandin J2. Cell Growth Differ., 11, 49–61.[Abstract/Free Full Text]
  33. Kubota,T., Koshizuka,K., Williamson,E.A., Asou,H., Said,J.W., Holden,S., Miyoshi,I. and Koeffler,H.P. (1998) Ligand for peroxisome proliferator-activated receptor gamma (troglitazone) has potent antitumor effect against human prostate cancer both in vitro and in vivo. Cancer Res., 58, 3344–3352.[Abstract/Free Full Text]
  34. Hutley,L.J., Herington,A.C., Shurety,W., Cheung,C., Vesey,D.A., Cameron,D.P. and Prins,J.B. (2001) Human adipose tissue endothelial cells promote preadipocyte proliferation. Am. J. Physiol. Endocrinol. Metab., 281, E1037–1044.[Abstract/Free Full Text]
  35. Michalik,L., Desvergne,B., Tan,N.S. et al. (2001) Impaired skin wound healing in peroxisome proliferator-activated receptor (PPAR)alpha and PPARbeta mutant mice. J. Cell Biol., 154, 799–814.[Abstract/Free Full Text]
  36. Westergaard,M., Henningsen,J., Johansen,C. et al. (2003) Expression and localization of peroxisome proliferator-activated receptors and nuclear factor kappaB in normal and lesional psoriatic skin. J. Invest. Dermatol., 121, 1104–1117.[CrossRef][Web of Science][Medline]
  37. Rosenfield,R.L., Deplewski,D. and Greene,M.E. (2000) Peroxisome proliferator-activated receptors and skin development. Horm. Res., 54, 269–274.[CrossRef][Web of Science][Medline]
  38. Wang,C., Pattabiraman,N., Zhou,J.N. et al. (2003) Cyclin D1 repression of peroxisome proliferator-activated receptor gamma expression and transactivation. Mol. Cell. Biol., 23, 6159–6173.[Abstract/Free Full Text]
  39. Bogazzi,F., Ultimieri,F., Raggi,F. et al. (2003) Changes in the expression of the peroxisome proliferator-activated receptor gamma gene in the colonic polyps and colonic mucosa of acromegalic patients. J. Clin. Endocrinol. Metab., 88, 3938–3942.[Abstract/Free Full Text]
  40. Badawi,A.F., Eldeen,M.B., Liu,Y., Ross,E.A. and Badr,M.Z. (2004) Inhibition of rat mammary gland carcinogenesis by simultaneous targeting of cyclooxygenase-2 and peroxisome proliferator-activated receptor gamma. Cancer Res., 64, 1181–1189.[Abstract/Free Full Text]
  41. Baron,J.M., Holler,D., Schiffer,R., Frankenberg,S., Neis,M., Merk,H.F. and Jugert,F.K. (2001) Expression of multiple cytochrome p450 enzymes and multidrug resistance-associated transport proteins in human skin keratinocytes. J. Invest. Dermatol., 116, 541–548.[CrossRef][Web of Science][Medline]
  42. Sluyter,R. and Halliday,G.M. (2001) Infiltration by inflammatory cells required for solar-simulated ultraviolet radiation enhancement of skin tumor growth. Cancer Immunol. Immunother., 50, 151–156.[CrossRef][Web of Science][Medline]
  43. Sluyter,R. and Halliday,G.M. (2000) Enhanced tumor growth in UV-irradiated skin is associated with an influx of inflammatory cells into the epidermis. Carcinogenesis, 21, 1801–1807.[Abstract/Free Full Text]
  44. Moore,R.J., Owens,D.M., Stamp,G. et al. (1999) Mice deficient in tumor necrosis factor-alpha are resistant to skin carcinogenesis. Nature Med., 5, 828–831.[CrossRef][Web of Science][Medline]
  45. Scott,K.A., Moore,R.J., Arnott,C.H., East,N., Thompson,R.G., Scallon,B.J., Shealy,D.J. and Balkwill,F.R. (2003) An anti-tumor necrosis factor-alpha antibody inhibits the development of experimental skin tumors. Mol. Cancer Ther., 2, 445–451.[Abstract/Free Full Text]
  46. Ricote,M., Valledor,A.F. and Glass,C.K. (2004) Decoding transcriptional programs regulated by PPARs and LXRs in the macrophage: effects on lipid homeostasis, inflammation and atherosclerosis. Arterioscler. Thromb. Vasc. Biol., 24, 230–239.[Abstract/Free Full Text]
  47. Klappacher,G.W. and Glass,C.K. (2002) Roles of peroxisome proliferator-activated receptor gamma in lipid homeostasis and inflammatory responses of macrophages. Curr. Opin. Lipidol., 13, 305–312.[CrossRef][Web of Science][Medline]
  48. Clark,R.B., Bishop-Bailey,D., Estrada-Hernandez,T., Hla,T., Puddington,L. and Padula,S.J. (2000) The nuclear receptor PPAR gamma and immunoregulation: PPAR gamma mediates inhibition of helper T cell responses. J. Immunol., 164, 1364–1371.[Abstract/Free Full Text]
  49. Setoguchi,K., Misaki,Y., Terauchi,Y., Yamauchi,T., Kawahata,K., Kadowaki,T. and Yamamoto,K. (2001) Peroxisome proliferator-activated receptor-gamma haploinsufficiency enhances B cell proliferative responses and exacerbates experimentally induced arthritis. J. Clin. Invest., 108, 1667–1675.[CrossRef][Web of Science][Medline]
  50. Jiang,C., Ting,A.T. and Seed,B. (1998) PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines. Nature, 391, 82–86.[CrossRef][Medline]
  51. Ricote,M., Li,A.C., Willson,T.M., Kelly,C.J. and Glass,C.K. (1998) The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature, 391, 79–82.[CrossRef][Medline]
  52. Zingarelli,B., Sheehan,M., Hake,P.W., O'Connor,M., Denenberg,A. and Cook,J.A. (2003) Peroxisome proliferator activator receptor-gamma ligands, 15-deoxy-Delta (12,14)-prostaglandin J2 and ciglitazone, reduce systemic inflammation in polymicrobial sepsis by modulation of signal transduction pathways. J. Immunol., 171, 6827–6837.[Abstract/Free Full Text]
  53. Wellen,K.E., Uysal,K.T., Wiesbrock,S., Yang,Q., Chen,H. and Hotamisligil,G.S. (2004) Interaction of TNF{alpha}- and thiazolidinedione-regulated pathways in obesity. Endocrinology, 145, 2214–2220.[Abstract/Free Full Text]
  54. Kerkela,E., Ala-Aho,R., Jeskanen,L., Rechardt,O., Grenman,R., Shapiro,S.D., Kahari,V.M. and Saarialho-Kere,U. (2000) Expression of human macrophage metalloelastase (MMP-12) by tumor cells in skin cancer. J. Invest. Dermatol., 114, 1113–1119.[CrossRef][Web of Science][Medline]
  55. Seung,L.P., Rowley,D.A., Dubey,P. and Schreiber,H. (1995) Synergy between T-cell immunity and inhibition of paracrine stimulation causes tumor rejection. Proc. Natl Acad. Sci. USA, 92, 6254–6258.[Abstract/Free Full Text]
  56. Seo,J.Y., Kim,E.K., Lee,S.H., Park,K.C., Kim,K.H., Eun,H.C. and Chung,J.H. (2003) Enhanced expression of cylooxygenase-2 by UV in aged human skin in vivo. Mech. Ageing Dev., 124, 903–910.[CrossRef][Web of Science][Medline]
  57. Saez,E., Rosenfeld,J., Livolsi,A., Olson,P., Lombardo,E., Nelson,M., Banayo,E., Cardiff,R.D., Izpisua-Belmonte,J.C. and Evans,R.M. (2004) PPAR gamma signaling exacerbates mammary gland tumor development. Genes Dev., 18, 528–540.[Abstract/Free Full Text]
  58. Guy,C.T., Cardiff,R.D. and Muller,W.J. (1992) Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol. Cell. Biol., 12, 954–961.[Abstract/Free Full Text]
  59. Pignatelli,M., Cortes-Canteli,M., Lai,C., Santos,A. and Perez-Castillo,A. (2001) The peroxisome proliferator-activated receptor gamma is an inhibitor of ErbBs activity in human breast cancer cells. J. Cell. Sci., 114, 4117–4126.[Medline]
  60. Patel,L., Pass,I., Coxon,P., Downes,C.P., Smith,S.A. and Macphee,C.H. (2001) Tumor suppressor and anti-inflammatory actions of PPARgamma agonists are mediated via upregulation of PTEN. Curr. Biol., 11, 764–768.[CrossRef][Web of Science][Medline]
  61. Wang,C., Fu,M., D'Amico,M., Albanese,C., Zhou,J.N., Brownlee,M., Lisanti,M.P., Chatterjee,V.K., Lazar,M.A. and Pestell,R.G. (2001) Inhibition of cellular proliferation through IkappaB kinase-independent and peroxisome proliferator-activated receptor gamma-dependent repression of cyclin D1. Mol. Cell. Biol., 21, 3057–3070.[Abstract/Free Full Text]
  62. Qin,C., Burghardt,R., Smith,R., Wormke,M., Stewart,J. and Safe,S. (2003) Peroxisome proliferator-activated receptor gamma agonists induce proteasome-dependent degradation of cyclin D1 and estrogen receptor alpha in MCF-7 breast cancer cells. Cancer Res., 63, 958–964.[Abstract/Free Full Text]
  63. Hayashi,S.I., Eguchi,H., Tanimoto,K., Yoshida,T., Omoto,Y., Inoue,A., Yoshida,N. and Yamaguchi,Y. (2003) The expression and function of estrogen receptor alpha and beta in human breast cancer and its clinical application. Endocr. Relat. Cancer, 10, 193–202.[Abstract]
  64. Fan,S., Wang,J., Yuan,R. et al. (1999) BRCA1 inhibition of estrogen receptor signaling in transfected cells. Science, 284, 1354–1356.[Abstract/Free Full Text]
  65. Fan,S., Ma,Y.X., Wang,C. et al. (2001) Role of direct interaction in BRCA1 inhibition of estrogen receptor activity. Oncogene, 20, 77–87.[CrossRef][Web of Science][Medline]
  66. Harkin,D.P., Bean,J.M., Miklos,D. et al. (1999) Induction of GADD45 and JNK/SAPK-dependent apoptosis following inducible expression of BRCA1. Cell, 97, 575–586.[CrossRef][Web of Science][Medline]
  67. MacLachlan,T.K., Somasundaram,K., Sgagias,M., Shifman,Y., Muschel,R.J., Cowan,K.H. and El-Deiry,W.S. (2000) BRCA1 effects on the cell cycle and the DNA damage response are linked to altered gene expression. J. Biol. Chem., 275, 2777–2785.[Abstract/Free Full Text]
  68. Thompson,M.E., Jensen,R.A., Obermiller,P.S., Page,D.L. and Holt,J.T. (1995) Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast cancer progression. Nature Genet., 9, 444–450.[CrossRef][Web of Science][Medline]
  69. Wilson,C.A., Ramos,L., Villasenor,M.R. et al. (1999) Localization of human BRCA1 and its loss in high-grade, non-inherited breast carcinomas. Nature Genet., 21, 236–240.[CrossRef][Web of Science][Medline]
  70. Pignatelli,M., Cocca,C., Santos,A. and Perez-Castillo,A. (2003) Enhancement of BRCA1 gene expression by the peroxisome proliferator- activated receptor gamma in the MCF-7 breast cancer cell line. Oncogene, 22, 5446–5450.[CrossRef][Web of Science][Medline]
  71. Lambe,K.G. and Tugwood,J.D. (1996) A human peroxisome-proliferator-activated receptor-gamma is activated by inducers of adipogenesis, including thiazolidinedione drugs. Eur. J. Biochem., 239, 1–7.[Web of Science][Medline]
  72. Komar,C.M., Braissant,O., Wahli,W. and Curry,T.E.,Jr (2001) Expression and localization of PPARs in the rat ovary during follicular development and the periovulatory period. Endocrinology, 142, 4831–4838.[Abstract/Free Full Text]
Received December 5, 2003; revised March 19, 2004; accepted March 31, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
Y. Yin, H. Yuan, X. Zeng, L. Kopelovich, and R. I. Glazer
Inhibition of Peroxisome Proliferator-Activated Receptor {gamma} Increases Estrogen Receptor-Dependent Tumor Specification
Cancer Res., January 15, 2009; 69(2): 687 - 694.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. D. Conzen
Minireview: Nuclear Receptors and Breast Cancer
Mol. Endocrinol., October 1, 2008; 22(10): 2215 - 2228.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. Schmuth, Y. J. Jiang, S. Dubrac, P. M. Elias, and K. R. Feingold
Thematic Review Series: Skin Lipids. Peroxisome proliferator-activated receptors and liver X receptors in epidermal biology
J. Lipid Res., March 1, 2008; 49(3): 499 - 509.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T. L. Guo, R. P. Chi, D. M. Hernandez, W. Auttachoat, and J. F. Zheng
Decreased 7,12-dimethylbenz[a]anthracene-induced carcinogenesis coincides with the induction of antitumor immunities in adult female B6C3F1 mice pretreated with genistein
Carcinogenesis, December 1, 2007; 28(12): 2560 - 2566.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Chandramouli, J. Shi, Y. Feng, H. Holubec, R. M.Shanas, A. K. Bhattacharyya, W. Zheng, and M. A. Nelson
Haploinsufficiency of the cdc2l gene contributes to skin cancer development in mice
Carcinogenesis, September 1, 2007; 28(9): 2028 - 2035.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. D. Yee, N. Williams, P. Wen, D. C. Young, J. Lester, M. V. Johnson, W. B. Farrar, M. J. Walker, S. P. Povoski, S. Suster, et al.
Pilot Study of Rosiglitazone Therapy in Women with Breast Cancer: Effects of Short-term Therapy on Tumor Tissue and Serum Markers
Clin. Cancer Res., January 1, 2007; 13(1): 246 - 252.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Q. Yang, R. Kurotani, A. Yamada, S. Kimura, and F. J. Gonzalez
Peroxisome Proliferator-Activated Receptor {alpha} Activation during Pregnancy Severely Impairs Mammary Lobuloalveolar Development in Mice
Endocrinology, October 1, 2006; 147(10): 4772 - 4780.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
P. Lei, M. Abdelrahim, and S. Safe
1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methanes inhibit ovarian cancer cell growth through peroxisome proliferator-activated receptor-dependent and independent pathways.
Mol. Cancer Ther., September 1, 2006; 5(9): 2324 - 2336.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
M Adachi, R Kurotani, K Morimura, Y Shah, M Sanford, B B Madison, D L Gumucio, H E Marin, J M Peters, H A Young, et al.
Peroxisome proliferator activated receptor {gamma} in colonic epithelial cells protects against experimental inflammatory bowel disease
Gut, August 1, 2006; 55(8): 1104 - 1113.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. A. Peraza, A. D. Burdick, H. E. Marin, F. J. Gonzalez, and J. M. Peters
The Toxicology of Ligands for Peroxisome Proliferator-Activated Receptors (PPAR)
Toxicol. Sci., April 1, 2006; 90(2): 269 - 295.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Lu, K. Imamura, S. Nomura, K.-i. Mafune, A. Nakajima, T. Kadowaki, N. Kubota, Y. Terauchi, G. Ishii, A. Ochiai, et al.
Chemopreventive Effect of Peroxisome Proliferator-Activated Receptor {gamma} on Gastric Carcinogenesis in Mice
Cancer Res., June 1, 2005; 65(11): 4769 - 4774.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
25/9/1747    most recent
bgh160v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Nicol, C. J.
Right arrow Articles by Gonzalez, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nicol, C. J.
Right arrow Articles by Gonzalez, F. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?