Skip Navigation


Carcinogenesis Advance Access originally published online on September 30, 2004
Carcinogenesis 2005 26(1):229-238; doi:10.1093/carcin/bgh292
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
26/1/229    most recent
bgh292v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tanaka, T.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, T.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis vol.26 no.1 © Oxford University Press 2005; all rights reserved.

ARTICLE

Colonic adenocarcinomas rapidly induced by the combined treatment with 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine and dextran sodium sulfate in male ICR mice possess ß-catenin gene mutations and increases immunoreactivity for ß-catenin, cyclooxygenase-2 and inducible nitric oxide synthase

Takuji Tanaka1,4, Rikako Suzuki1,2, Hiroyuki Kohno1, Shigeyuki Sugie1, Mami Takahashi3 and Keiji Wakabayashi3

1 The Oncologic Pathology, Kanazawa Medical University, 1-1 Daigaku, Uchinada, Ishikawa 920-0293, Japan, 2 Resarch Fellow of the Japan Science for the Promotion of Science, FS Building, 8 Ichibancho, Chiyoda-, Tokyo 102-8472, Japan and 3 Cancer Prevention Basic Research Project, National Cancer Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045, Japan

4 To whom correspondence should be addressed Email: takutt{at}kanazawa-med.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Heterocyclic amines are known to be important environmental carcinogens in several organs including the colon. The aim of this study was to induce colonic epithelial malignancies within a short-term period and analyze the expression of cycooxygenase (COX)-2, inducible nitric oxide synthase (iNOS) and ß-catenin, and mutations of ß-catenin gene in induced tumors. Male Crj: CD-1 mice were given a single i.g. administration (200 mg/kg body wt) of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) or 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) followed by 2% dextran sodium sulfate (DSS) in the drinking water for a week. The expression of ß-catenin, COX-2 and iNOS was immunohistochemically assessed in colonic epithelial lesions and the ß-catenin gene mutations in colonic adenocarcinomas induced were analyzed by the single strand conformation polymorphism method, restriction enzyme fragment length polymorphism and direct sequencing. At week 16, a high incidence of colonic neoplasms with dysplastic lesions developed in mice that received PhIP and DSS, but only a few developed in those given MeIQx and DSS. Immunohistochemically, the adenocarcinomas induced were all positive for three proteins. All seven adenocarcinomas induced by PhIP and DSS have mutations. The findings suggest that DSS exerts powerful tumor-promoting effects on PhIP-initiated colon carcinogenesis in mice and this mouse model is useful for investigating environment-related colon carcinogenesis within a short-term period.

Abbreviations: ACF, aberrant crypt foci; AOM, azoxymethane; APC, adenomatous polyposis coli; COX, cyclooxygenase; DSS, dextran sodium sulfate; H&E, hematoxylin and eosin; HCA, heterocyclic amine; iNOS, inducible nitric oxide synthase; MeIQx, 2-amino-3,8-dimethylimidazo[4,5-f] quinoxaline; MeIQ, 2-amino-3,4-dimethylimidazo[4,5-f]quinoline: PhIP, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Dietary factors intensively influence the occurrence of certain types of epithelial malignancies, such as colorectal and breast cancers (1). In Japan, the incidence of colorectal malignancy has been increasing with westernization of the dietary habits of Japanese people (2,3). Therefore, dietary factors involving the occurrence of this malignancy should be investigated extensively in order to control the disease.

In 1976, Sugimura's scientific group found new mutagenic chemicals, classified as heterocyclic amines (HCAs), from cooked meat and fish and heating amino acids and proteins (1,4,5). Thereafter, extensive work with rodents revealed the carcinogenicity of 10 HCAs, including 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) (6). The target organs for their tumorigenicity are liver, urinary bladder, intestine, blood vessels, skin, mammary gland, oral cavity, prostate, hematopoietic system, etc. (1,48). In 1991, Gerhardsson de Verdier et al. (9) reported that regular consumers of well-done fried meat led to colorectal and pancreatic malignancies. This was supported by the findings of the involvement of well-done cooked meat consumption and exposure of HCAs, specifically PhIP and MeIQx, in the occurrence of human colorectal and breast cancers (10,11). Thus, the intake of well-done meats containing HCAs is suspected to be associated with an increased risk of certain types of cancer in humans (5,7,12). Among various types of HCAs, PhIP and MeIQx are most abundant in cooked food. Thus, in view of environmental (especially dietary) factors and carcinogenesis, investigations (using genetic analysis and animal models) of the involvement of HCAs, particularly PhIP and MeIQx, in human colon carcinogenesis and genetic analysis are important (4).

In animal experiments, dietary feeding with PhIP induces aberrant crypt foci (ACF), which are putative precursor lesions for large bowel adenocarcinomas (13), in both rats (14) and mice (15). Dietary exposure to PhIP for 52 weeks, as other HCAs, such as 2-amino-6-methyldipyrido[1,2-a:3', 2'-d]imidazole (Glu-P-1), 2-aminodipyrido[1,2-a:3',2'-d] imidazole (Glu-P-2), 2-amino-3-methylimidazo[4,5-f] quinoline (IQ) and 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ), produces large intestinal carcinomas in rats (16), but not in mice (6). Ochiai et al. (17) reported recently that administration of 300 p.p.m. PhIP in a high-fat diet after 40 weeks followed by continuous feeding with a high-fat diet, mice developed small intestinal neoplasms. Although colonic adenocarcinomas developed in C57BL/6N and BBN female mice fed the diet containing 300 p.p.m. MeIQ for 92 weeks (18), there were no reports on the colonic carcinogenicity of MeIQx in rats and mice (6). However, MeIQx in a diet could induce ACF in both rats (19) and mice (20). These findings suggest a weak cancer initiating capability of both food-borne carcinogens in the large bowel of rats and mice, and therefore a long-term administration of PhIP and MeIQx is required for the induction of intestinal adenocarcinomas in rodents. In addition, the incidence and multiplicity of ACF and colonic malignancies except malignant lymphoma (17) induced by these two HCAs was relatively low. Therefore, we needed a novel and efficient animal model for determining the possible involvement and mode of action of these two HCAs in human colon carcinogenesis.

ß-Catenin, acting as a structural protein at cell–cell adherent junctions and as a transcriptional activator mediating Wnt signal transduction (21), participates in a large cytoplasmic protein complex, which contains the serine/threonine protein kinase glycogen synthase kinase-3ß (GSK-3ß), the tumor suppressor gene product of adenomatous polyposis coli (APC), and axin/conductin (22). Frequent mutation of the ß-catenin gene was found in chemically induced colonic neoplasms in rodents (2325). For example, ß-catenin mutations were observed frequently in azoxymethane (AOM)-induced colon tumors in rats and mice (25,26). Also, colon adenocarcinomas induced by IQ or PhIP in rats have mutations in the ß-catenin gene (23). Mutation of the APC gene is known to repress the degradation and result in the accumulation of the ß-catenin (27). About 80% of colorectal neoplasms harbor mutations in the APC gene and half of the reminder have ß-catenin gene mutations (2830). In the colonic adenomas and adenocarcinomas, ß-catenin was universally localized to the cytoplasm and/or nucleus (31). These findings suggest that the mutation of the ß-catenin gene plays an important role in the development of colon carcinogenesis in rodents as well as in humans.

We recently have developed a novel mouse model for inflammation-related colon carcinogenesis utilizing a single and low dose of AOM, a specific colonic carcinogen in rodents, followed by a strong tumor-promoter dextran sodium sulfate (DSS) in drinking water (32). This model can be used for detecting the chemicals with weak colonic carcinogenicity in mice within a short-term period and for analyzing gene mutations in induced colonic neoplasms. Using this model with a slight modification, in the current study, we tried to induce colonic neoplasms in mice gavaged with a single dose of PhIP or MeIQx followed by a 1-week exposure of DSS in the drinking water. In addition, we analyzed mutations of the ß-catenin gene in induced colonic adenocarcinomas and compared them with those found in colonic malignancies induced by AOM and DSS (32). Immunohistochemical expression of ß-catenin, inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2 were also evaluated in colonic neoplasms.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Animals, chemicals and diets
Male Crj: CD-1 (ICR) mice (Charles River Japan, Tokyo, Japan) aged 5 weeks were used. They were maintained at Kanazawa Medical University Animal Facility according to the Institutional Animal Care Guidelines. All animals were housed in plastic cages (4 or 5 mice/cage) with free access to drinking water and a pelleted basal diet, CRF-1 (Oriental Yeast, Tokyo, Japan), under controlled conditions of humidity (50 ± 10%), light (12/12 h light/dark cycle) and temperature (23 ± 2°C). After 7 days quarantine, they were randomized by body weight into experimental and control groups. PhIP and MeIQx were purchased from Wako Pure Chemical (Osaka, Japan). DSS (molecular weight 40 000) was obtained from ICN Biochemicals (Aurora, OH).

Experimental procedure
A total of 38 male ICR mice were divided into six experimental and control groups. Groups 1 (nine mice) and 2 (10 mice) were given a single i.g. intubation of PhIP (200 mg/kg body wt) and MeIQx (200 mg/kg body wt), respectively. Starting 1 week after the intubation, animals in groups 1 and 2 were given 2% (w/v) DSS in the drinking water for 7 days, and then followed without any further treatment for 14 weeks. Groups 3 (five mice) and 4 (five mice) were given PhIP and MeIQx alone, respectively. Group 5 (five mice) was given 2% DSS alone. Group 6 (five mice) was untreated. All animals were killed at week 16 by ether overdose. The large bowels were flushed with saline, excised, the length measured (from ileocecal junction to the anal verge), cut open longitudinally along the main axis and then washed with saline. Macroscopic inspection of the large bowels was carefully carried out and they were cut and fixed in 10% buffered formalin for at least 24 h. Histological examination was performed on paraffin-embedded sections after hematoxylin and eosin (H&E) staining. Some tumors were frozen at –80°C. On H&E-stained sections, histological alterations, such as mucosal ulceration, dysplasia and colonic neoplasms, were examined. Colonic neoplasms were diagnosed according to the description by Ward (33). Histopathological examination was also carried out on other organs.

Immunohistochemistry
Using the protocol of our previous study (32), immunohistochemistry for ß-catenin, COX-2 and iNOS was performed on 3-µm-thick paraffin-embedded sections from the colons of mice in groups 1 and 2, utilizing the labeled streptavidin–biotin method using a LSAB KIT (DAKO, Glostrup, Denmark) with microwave accentuation. The paraffin-embedded sections were heated for 30 min at 65°C, deparaffinized in xylene and re-hydrated through graded ethanols at room temperature. A 0.05 M Tris–HCl buffer (pH 7.6) was used to prepare solutions and for washes between various steps. Incubations were performed in a humidified chamber. Sections were treated for 40 min at room temperature with 2% BSA and incubated overnight at 4°C with primary antibodies, such as anti-ß-catenin mouse monoclonal antibody (diluted 1:1000, Transduction Laboratories, Lexington, KY), anti-COX-2 mouse monoclonal antibody (diluted 1:200, Transduction Laboratories), and anti-iNOS mouse monoclonal antibody (cat. no. N32020 [GenBank] -150, diluted 1:250, Transduction Laboratories). To reduce the non-specific staining of mouse tissue by the mouse antibodies, a Mouse On Mouse IgG blocking reagent (Vector Laboratories, Burlingame, CA) was applied for 1 h. Horseradish peroxidase activity was visualized by treatment with H2O2 and 3,3'-diaminobenzidine for 5 min. At the last step, the sections were weakly counterstained with Mayer's hematoxylin (Merck, Tokyo, Japan). For each case, negative controls were performed on serial sections. On the control sections, incubation with the primary antibodies was omitted. Intensity and localization of immunoreactivities against all primary antibodies used were examined on all sections using a microscope (Olympus BX41, Olympus Optical, Tokyo, Japan) and recorded.

DNA extraction
For analysis of ß-catenin mutations, seven colonic adenocarcinomas (three paraffin-embedded and four frozen materials) from PhIP/DSS-treated mice and one paraffin-embedded adenocarcinoma from a mouse treated with MeIQx/DSS were used. Also, 14 adenocarcinomas embedded in paraffin from our previous experiment (32) were used for analysis of ß-catenin mutations for comparison. DNA was extracted from frozen tissue using Wizard® Genomic DNA Purification Kit (Promega, Madison, WI) or from paraffin-embedded sections using DEXPATTM (TaKaRa Shuzo, Shiga, Japan). Tumor tissues were scraped off from paraffin sections using needles to avoid contamination with their surrounding tissue.

PCR-single strand conformation polymorphism (SSCP) analysis
DNA from colonic adenocarcinomas was PCR-amplified with primers (5'-primer, GCTGACCTGATGGAGTTGGA; 3'-primer, GCTACTTGCTCTTGCGTGAA), which were designed to amplify exon 3 of the ß-catenin gene containing the consensus sequence for GSK-3ß phosphorylation (25). The length of the PCR product with these primers is 227 bp. The primers were synthesized with a 394 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) and purified with an OPC cartridge (Applied Biosystems). PCR for non-radioisotopic SSCP was performed in 50 µl of reaction mixture consisting of 0.5 µM of each primer, 1x PCR buffer (Perkin Elmer, Applied Biosystems Division, Foster City, CA), 200 µM each dNTP, 2.5 U AmpliTaq GoldTM (Perkin Elmer) and 0.5–5 µl of template DNA. The mixture was heated at 94°C for 9 min and subjected to 40 or 35 cycles of denaturation (94°C, 1 min), annealing (55°C, 2 min) and extension (72°C, 3 min) using a Perkin Elmer-Cetus thermal cycler. The PCR products were purified and concentrated to 20 µl using Microcon 100 (Amicon, Beverley, MA). Ten volumes of 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol were added to 0.5 µl of purified PCR products, heated to 90°C for 3 min and applied to 10% polyacrylamide gels containing 5% glycerol. Electrophoresis was carried out at 300 V for 2 h at 20°C and the gels were soaked in 10% trichloroacetic acid and in 50% methanol for 10 min each. DNA bands were detected by silver staining using 2-D Silver Staining Solution II (Daiichi Chemical DNA, Tokyo, Japan).

Restriction fragment length polymorphism (RFLP) assay for PCR products of ß-catenin
To detect ß-catenin mutations at codons 32, 33 and 34, PCR products were treated with a restriction enzyme HinfI and electrophoresed on 5% agarose gels. Recognition sequences of HinfI are GANTC. The PCR product of 227 bp is digested by HinfI to 82, 7 and 138 bp in the case of the wild-type, to 89 and 138 bp with mutations at the first or second bases of codons 32 or 33 and to 82 and 145 bp with mutations at the second or third bases of codons 34 or 35.

Direct DNA sequencing
With 1 µl of the purified PCR products and 5'DyeAmidite-667-labeled 5' or 3' PCR primers (synthesized by Pharmacia Biotech, Tokyo, Japan), cycle sequencing reactions were carried out using a Thermo SequenaseTM fluorescent labeled primer cycle sequencing kit (Amersham) and the sequences were determined with an ALF expressTM DNA sequencer (Pharmacia Biotech).

Statistical analysis
All measurements were compared by Student's t-test, Welch's t-test, {chi}2 test or Fisher's exact probability test for paired samples.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
General observation
During the study, bloody stools were found during and soon after DSS exposure (days 12–21) in a few mice that received 2% DSS in the drinking water and their body weight gains were slightly decreased (data not shown). However, thereafter no such clinical symptoms were observed. The body and liver weights, and the lengths of the large bowel of mice in all groups were measured at the end of the study (week 16) and are listed in Table I. The mean body weight of group 1 (PhIP->2% DSS) was significantly larger than that of group 3 (PhIP alone, P < 0.02) or 6 (untreated, P < 0.05). The mean length of the large bowel of mice in group 1 was significantly lower than that of mice in group 3 (P < 0.01). The mean length of the large bowel in the mice of group 2 (MeIQx->2% DSS) was significantly smaller than that of mice in group 4 (MeIQx alone, P < 0.005). These shortenings were caused by DSS-induced inflammation in the colonic mucosa. Those values in groups 3 (P < 0.02) and 4 (P < 0.05) were significantly greater than that of group 6.


View this table:
[in this window]
[in a new window]
 
Table I. Body weight and length of large bowel at the end of the experiment

 
Pathological findings
Macroscopically, nodular, polypoid or flat-type colonic tumors were observed in the middle and distal colon of all mice in groups 1 (Figure 1a) and 2 (Figure 1b). Their histopathology was well or moderately differentiated tubular adenocarcinoma (Figures 2a, 3a, 4 and 5a) or tubular adenoma (Figures 2b and 3b). A few tumors were diagnosed as adenocarcinoma in adenoma (Figure 4). There were no tumors in any organs other than the large bowel in these two groups. As shown in Table II, the incidence of adenocarcinoma and tubular adenoma in group 1 was 56% with a multiplicity of 0.78 ± 0.97 and 33% with 0.44 ± 0.73 multiplicity, respectively. Two mice in group 2 had colonic neoplasms: two small tubular adenomas (20% incidence with 0.20 ± 0.42 multiplicity) and one well-differentiated tubular adenocarcinoma (10% incidence with 0.10 ± 0.32 multiplicity) in the distal colon (Table II). In the mice of groups 3–6, no neoplasms developed in any organs including the large bowel. Besides colonic neoplasms, all mice of groups 1 and 9 (90%) of 10 mice of group 2 had colonic dysplasia (Figures 2c and 3c). Their multiplicities were 3.11 ± 1.45 in group 1 and 2.30 ± 1.62 in group 2. As indicated in Table III, colonic dysplasia also developed in the mice of groups 3 (40% incidence with a multiplicity of 0.60 ± 0.80) and 4 (40% incidence with a multiplicity of 0.60 ± 0.80). There were no dysplastic lesions in the mice of groups 5 and 6. In addition, colonic mucosal ulceration was found in the distal colon of mice in groups 1, 2 and 5 (Table III).



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 1. Macroscopic view of large bowels. (a) Mice treated with PhIP/DSS (group 1) and (b) those given MeIQx/DSS (group 2). Arrows indicate colonic tumors.

 


View larger version (133K):
[in this window]
[in a new window]
 
Fig. 2. Histopathology of colonic lesions developed in mice treated with PhIP/DSS. (a) A tubular adenocarcinoma invaded into the submucosa; (b) a tubular adenoma; and (c) dysplasia with mucosal ulceration. H&E stain, original magnification, (a) x20, (b) x50, (c) x50.

 


View larger version (88K):
[in this window]
[in a new window]
 
Fig. 3. Histopathology of colonic lesions developed in mice treated with MeIQx/DSS. (a) A polypoid tubular adenocarcinoma; (b) tubular adenomas; and (c) dysplasia with mucosal ulceration. H&E stain, original magnification, (a) x10, (b) x50, (c) x50.

 


View larger version (156K):
[in this window]
[in a new window]
 
Fig. 4. Histopathology of an adenocarcinoma in adenoma developed in the large bowel of a mouse treated with PhIP/DSS. H&E stain, original magnification, x50.

 


View larger version (171K):
[in this window]
[in a new window]
 
Fig. 5. Histopathology and immunohistochemistry of ß-catenin, COX-2, and iNOS in a colonic adenocarcinoma developed in a mouse given PhIP/DSS. (a) H&E staining; (b) ß-catenin immunohistochemistry; (c) COX-2 immunohistochemistry; and (d) iNOS immunohistochemistry. Original magnification, (a–d) x50.

 

View this table:
[in this window]
[in a new window]
 
Table II. Incidence and multiplicity of colonic neoplasms induced by PhIP or MeIQx followed by DSS

 

View this table:
[in this window]
[in a new window]
 
Table III. Incidence and multiplicity of dysplastic lesions in the large bowel

 
Immunohistochemical findings
The immunoreactivities against ß-catenin, COX-2 and iNOS were found in all colonic lesions, including neoplasms (four adenomas and seven adenocarcinomas in group 1; and two adenomas and one adenocarcinoma in group 2) and dysplastic lesions (28 in group 1; and 23 in group 2). The immunoreactivity showed dark brown reaction products with a slight variation in the intensity and distribution (Figures 5b–d and 6b–d). Strong ß-catenin expression was seen in the nucleus and cytoplasm of adenocarcinoma cells (Figures 5b and 6b). Although the intensity was relatively weaker than carcinoma cells, adenoma cells showed positivity for ß-catenin in their cytoplasm and cell membrane. ß-Catenin immunoreactivity was also found in the cell membrane and cytoplasm of dysplastic cells. Non-lesional cryptal cells showed weak positivity of ß-catenin in their cell membrane. In addition, positive reaction against the ß-catenin antibody was found in the vascular endothelium, infiltrated inflammatory cells and ganglion cells in myenteric (Auerbach's) plexus. Strong COX-2 immunoreactivity was also found in adenocarcinoma (Figures 5c and 6c) and adenoma cells in their cytoplasm. Dysplastic cells showed weak positivity for COX-2, when compared with neoplastic cells. Non-lesional cryptal cells at lower part of crypts were weakly positive for COX-2, while a strongly positive reaction of COX-2 was seen in the endothelium of small blood vessels and inflammatory cells infiltrated in the lamina propria. Smooth muscle cells and fibroblasts in the wall of the large bowel showed a weak reaction of COX-2. iNOS-immunohistochemistry showed strong immunoreactivity in the cytoplasm of adenocarcinoma (Figures 5d and 6d) and adenoma cells: the intensity was greater in carcinoma cells when compared with adenoma cells. Also, dysplastic cells were positive for iNOS in their cytoplasm, but the intensity was weaker than adenoma cells. The faint positive reaction was found in the cytoplasm of non-lesional cryptal cells. Immunohistochemical iNOS expression was strong in the endothelial cells of small blood vessels and inflammatory cells in the lamina propria. COX-2- and iNOS-stained inflammatory cells were also frequently observed in areas of mucosal ulceration in groups 1, 2 and 5.



View larger version (177K):
[in this window]
[in a new window]
 
Fig. 6. Histopathology and immunohistochemistry of ß-catenin, COX-2, and iNOS in a colonic adenocarcinoma developed in a mouse treated with MeIQx/DSS. (a) H&E staining; (b) ß-catenin immunohistochemistry; (c) COX-2 immunohistochemistry; and (d) iNOS immunohistochemistry. Original magnification, (a–d) x50.

 
Mutation in ß-catenin gene
In the current experiment, mutations of exon 3 of the ß-catenin gene were investigated by PCR–SSCP and RFLP analyses (Figures 7 and 8). Among the PhIP/DSS-treated mice, ß-catenin genes of all of the seven colonic adenocarcinomas (100%) have mutations restricted to codons 32 and 34 (Table IV). In codon 32, the mutations found were GAT (Asp) to AAT (Asn) (PhIP/DSS-2, 3, 4, 5), to CAT (His) (PhIP/DSS-1) and TAT (Tyr) (PhIP/DSS-6) and in codon 34 GGA (Gly) to GTA (Val) (PhIP/DSS-7). However, mutation in the ß-catenin gene was not detected in the MeIQx/DSS-induced colonic adenocarcinoma (Figures 7 and 8; Table IV), although only one sample was investigated. In these analyses, positive controls with mutations in codons 32 and 34 showed band shifts (Figures 7 and 8).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 7. PCR–SSCP analysis of the ß-catenin gene in mouse colon adenocarcinomas. (a) PhIP/DSS–induced mouse colon adenocarcinomas (lanes 1–7); and MeIQx/DSS-induced mouse colon adenocarcinomas (lane 8). (b) AOM/DSS-induced mouse colon adenocarcinomas (lanes 1–14). Lanes N, normal colon mucosa samples. Tumor-specific bands are indicated by arrow heads.

 


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 8. RFLP analysis of the ß-catenin gene in mouse colon adenocarcinomas. (a) PhIP/DSS (lanes 1–7) and MeIQx/DSS (lane 8) induced mouse colonic adenocarcinomas. (b) AOM/DSS-induced mouse colon adenocarcinomas (lanes 1–14). Lane M, DNA size markers (X174/HaeIII digest). Tumor-specific bands are indicated by arrow heads.

 

View this table:
[in this window]
[in a new window]
 
Table IV. Mutations in exon 3 of the ß-catenin gene in PhIP/DSS or MeIQx/DSS-induced mouse colonic adenocarcinomas

 
With respect to AOM/DSS-induced mouse colonic adenocarcinomas (32), ß-catenin mutations in codons 32 through to 34 were detected in 11 (79%) out of 14 (Figures 7 and 8; Table V). These mutations included GAT (Asp) to AAT (Asn) (AOM/DSS-6, 11, 13), to GGT (Gly) (AOM/DSS-3) at codon 32, TCT (Ser) to TTT (Phe) at codon 33 (AOM/DSS-4, 8, 10), and GGA (Gly) to GAA (Glu) (AOM/DSS-7, 9, 12, 14) at codon 34 (Table V; Figure 8). Except for a mutation at the second base of codon 32 (AOM/DSS-3), all were G:C to A:T transitions (Figure 9).


View this table:
[in this window]
[in a new window]
 
Table V. Mutations in exon 3 of the ß-catenin gene in AOM/DSS-induced mouse colonic adenocarcinomas

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 9. Sequence of ß-catenin exon 3 with the codon numbers and ß-catenin mutations found in PhIP/DSS-, MeIQx/DSS- and AOM/DSS-induced mouse colonic tumors.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The results of the present work indicate that a single i.g. intubation of PhIP (200 mg/kg body wt) followed by 1-week exposure of 2% DSS in drinking water could produce colonic adenocarcinomas with 56% incidence and 0.78 ± 0.97 multiplicity in male ICR mice within 16 weeks. Also, a single gavage with MeIQx (200 mg/kg body wt) followed by 2% DSS in the drinking water induced colonic epithelial malignancy, although their incidence (10%) and multiplicity (0.10 ± 0.32) was low. Colonic adenocarcinomas induced by this treatment schedule were immunohistochemically positive for ß-catenin, COX-2 and iNOS. Moreover, all examined adenocarcinomas in mice treated with PhIP/DSS and MeIQx/DSS had ß-catenin mutations.

Several researchers have made great efforts to establish an efficient experimental animal model for colon carcinogenesis induced by PhIP or MeIQx (34,35). Nakagama's group developed efficient animal models for PhIP-induced colon carcinogenesis, where rats were given cycle treatments with dietary PhIP (300 or 400 p.p.m.) and a high-fat diet or PhIP in the diet followed by a high-fat diet (36,37). Tsukamoto et al. (35) also reported that i.g. administration of PhlP (three times a week for 7 weeks at a dose of 100 mg/kg body wt) could efficiently induce large intestinal tumors within 50 weeks in male F344 rats. Indeed, ACF and colonic neoplasms could develop in rats using such protocols, but their incidence and multiplicity were low and the experimental period was long. As for intestinal carcinogenicity of PhIP in mice, dietary PhIP (300 p.p.m.) in a high-fat diet for 40 weeks and followed by a high-fat diet without PhIP for 30 or 45 weeks induced small intestinal and cecal tumors (adenomas and adenocarcinomas) (17). There were no reports on MeIQx-induced colonic epithelial malignancies, although dietary feeding with MeIQx could produce ACF in mice (20). In the current study we could develop large bowel neoplasms within 16 weeks by an experimental protocol of a single and low-dose i.g. administration of PhIP or MeIQx (200 mg/kg body wt) followed by 1-week exposure of 2% DSS in the drinking water. The findings also indicated a powerful tumor-promoting ability of DSS, as found in our previous experiment using AOM as a carcinogen (32). Thus, our model can be applied to investigate colonic carcinogenesis induced by environmental carcinogens (HCAs, etc.) and/or modulators (promoters and chemopreventors) (32,34) and to genetic analysis of the susceptibility to colon tumorigenesis (38).

There have been no studies on the mutation of ß-catenin in mouse colonic tumors induced by HCAs, although ß-catenin mutations at codons 32 and 34 are the most common in PhIP-induced colonic neoplasms in rats (3537). Our results on ß-catenin mutations are in accordance with these findings (3537). To our knowledge, the mutation of ß-catenin, GAT->CAT or TAT, at codon 32 was not reported. To identify whether these mutations came from DSS or were characteristics of the mice, more detailed analysis should be carried out. All mutations are involved in guanine, consistent with a report that PhIP preferentially forms DNA adducts at guanines (39). In the present study, we could not find a ß-catenin gene mutation in a mouse colonic adenocarcinoma produced by MeIQx/DSS, but we will analyze the mutation in our on-going experiments where more colonic tumors will develop in mice treated with MeIQx and DSS. In AOM/DSS-induced colon tumors (32), mutations of the ß-catenin gene were present in codons 32 through to 34. The location was slightly different from a report documenting that ß-catenin mutations in mouse colon tumors induced by AOM were found in codons 33, 37 and 41, encoding serine and threonine that are direct targets for phosphorylation by GSK-3ß (26). Codon 34 also encodes neighboring serine and threonine residues (26). Mutations of codons 33 and 34 were detected in both the present investigation and another report (26). However, mutation of codon 32 was not found in the other report (26). Therefore, it may be speculated that mutations of codons 33 and 34 might be caused by AOM exposure and that of codon 32 by DSS administration, as Koesters et al. (40) reported that the different mutational spectra observed in Ctnnb1 directly relates to the particular carcinogenic treatment. We did not identify the mutations of codons 37 and 41 in the present study. This might be explained by the different experimental protocol between the present study and the previous report on ß-catenin mutations in mouse colon cancer, where mice were treated with AOM at a dose of 10 mg/kg body wt, once a week for 6 weeks and the experiment was terminated at week 30 (26). The second G of the CTGGA sequence was commonly mutated to A in codons 32 and 34 of the rat ß-catenin gene and this site is considered to be a mutational hot-spot with AOM (25,41). In this study, 10 of 11 mutations being G:C->A:T transitions at codons 32, 33 and 34, the mutation of the second G of the CTGGA might be particularly important in colon carcinogenesis. We reported recently the increased expression of COX-2 and iNOS in mouse colon adenocarcinoma in an AOM/DSS mouse colon carcinogenesis model (32). The reaction products of iNOS and COX-2, nitric oxide and prostaglandin E2 respectively, could contribute to colon tumorigenesis. Also, there is evidence of an involvement of the Wnt–APC–ß-catenin/Tcf pathway in COX-2 expression (4244). Although the relationship between its pathway and iNOS expression is still unclear, ß-catenin was accumulated in the cytoplasm and nucleus in the colonic tumors induced by AOM/DSS (32) and those developed in this study. Therefore, mutation of ß-catenin may play important roles in mouse and rat colon carcinogenesis. Furthermore, mutation of ß-catenin is an early event of colorectal carcinogenesis (35,41); analysis of this at an early stage of colon carcinogenesis should be done in this model. Since c-myc and cyclinD1 were identified as targets of the ß-catenin/APC pathway (45,46), this gene expression might also influence colon carcinogenesis in the present model.

In the present study, all colonic neoplasms induced by PhIP or MeIQx followed by DSS were immunohistochemically positive for iNOS and COX-2. The iNOS and COX-2 were reported to be over-expressed in colon tumors or ACF that develop in rats after the administration of the colon-specific carcinogen, AOM (41,47,48). iNOS may regulate COX-2 production of pro-inflammatory prostaglandins, which are known to play a key role in colon tumor development (49). The results in the current study indicate a powerful tumor-promoting ability of DSS, since the doses of PhIP and MeIQx used were too small to induce colonic neoplasms. It is probable that peroxynitrite acts as an oxidant for the heme of COX-2 and activates the enzyme (50,51). Our recent study using an AOM/DSS model (52) has suggested the possibility. Also, nitric oxide and its metabolites may affect tumor formation and/or progression. As found in ulcerative colitis-related colon carcinogenesis in humans, iNOS expression and nitrotyrosine accumulation in inflamed colonic mucosa caused by DSS treatment may be involved in the colonic tumor development in the current study (32,53).

In conclusion, the results in the current study indicate that a single i.g. administration of a low dose of the genotoxic food-derived carcinogens, especially PhIP, followed by DSS resulted in a high incidence of colonic epithelial malignancies with ß-catenin mutations within 16 weeks. Also, our findings suggest the importance of inflammation caused by DSS exposure in mouse colon carcinogenesis under this experimental condition. The experimental protocol described here could be applied to investigate colonic carcinogenesis induced by environmental carcinogens and/or modulators and to genetic analysis of the susceptibility to colon tumorigenesis. Such collaborating studies with other laboratories are on-going in order to fight against colon cancer development.


    Acknowledgments
 
We express our thanks to the staff of the Research Animal Facility. We also thank Mrs Sotoe Yamamoto for her secretarial assistance. This study was supported in part by the Grant-in-Aid for Cancer Research from the Ministry of Health, Labour and Welfare of Japan; the Grant-in-Aid for the 3rd Term for a Comprehensive 10-year Strategy for Cancer Control from the Ministry of Health, Labour and Welfare of Japan; the Grants-in-Aid for Scientific Research (nos 152052 and 15592007) from the Ministry of Education, Culture, Sports, Science and Technology of Japan; and the grants (H2004-6 and C2004-4) from Kanazawa Medical University.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Sugimura,T. (2000) Nutrition and dietary carcinogens. Carcinogenesis, 21, 387–395.[Abstract/Free Full Text]
  2. Kotake,K., Honjo,S., Sugihara,K., Kato,T., Kodaira,S., Takahashi,T., Yasutomi,M., Muto,T. and Koyama,Y. (2003) Changes in colorectal cancer during a 20-year period: an extended report from the multi-institutional registry of large bowel cancer, Japan. Dis. Colon Rectum, 46 (10 suppl.), 532–543.
  3. Tamakoshi,K., Tokudome,S., Kuriki,K., Takekuma,K. and Toyoshima,H. (2001) Epidemiology and primary prevention of colorectal cancer (in Japanese). Jpn. J. Cancer Chemother., 28, 146–150.
  4. Nagao,M. (1999) A new approach to risk estimation of food-borne carcinogens–heterocyclic amines-based on molecular information. Mutat. Res., 431, 3–12.[Web of Science][Medline]
  5. Sugimura,T. (1997) Overview of carcinogenic heterocyclic amines. Mutat. Res., 376, 211–219.[Web of Science][Medline]
  6. Ohgaki,H. (2000) 7.1 Rodents. In Nagao,M. and Sugimura,T. (eds), Food Borne Carcinogens: Heterocyclic Amines. John Wiley & Sons, Ltd, New York, NY, pp. 198–228.
  7. Weisburger,J.H. (2002) Comments on the history and importance of aromatic and heterocyclic amines in public health. Mutat. Res., 506/507, 9–20.
  8. Wakabayashi,K., Nagao,M., Esumi,H. and Sugimura,T. (1992) Food-derived mutagens and carcinogens. Cancer Res., 52 (suppl.), 2092s–2098s.[Abstract/Free Full Text]
  9. Gerhardsson de Verdier,M., Hagman,U., Peters,R.K., Steineck,G. and Overvik,E. (1991) Meat, cooking methods and colorectal cancer: a case-referent study in Stockholm. Int. J. Cancer, 49, 520–525.[Web of Science][Medline]
  10. Sinha,R. and Rothman,N. (1997) Exposure assessment of heterocyclic amines (HCAs) in epidemiologic studies. Mutat. Res., 376, 195–202.[Web of Science][Medline]
  11. Sinha,R. and Norat,T. (2002) Meat Cooking and Cancer Risk, Volume 156. IARC Scientific Publications, IARC, Lyon, pp. 181–186.
  12. Wakabayashi,K., Ushiyama,H., Takahashi,M., Nukaya,H., Kim,S.B., Hirose,M., Ochiai,M., Sugimura,T. and Nagao, M. (1993) Exposure to heterocyclic amines. Environ. Health Perspect., 99, 129–134.[Web of Science][Medline]
  13. Bird,R.P. (1987) Observation and quantification of aberrant crypts in the murine colon treated with a colon carcinogen: preliminary findings. Cancer Lett., 37, 147–151.[CrossRef][Web of Science][Medline]
  14. Ochiai,M., Nakagama,H., Watanabe,M., Ishiguro,Y., Sugimura,T. and Nagao,M. (1996) Efficient method for rapid induction of aberrant crypt foci in rats with 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. Jpn. J. Cancer Res., 87, 1029–1033.[CrossRef][Web of Science]
  15. Kristiansen,E. (1996) The role of aberrant crypt foci induced by the two heterocyclic amines 2-amino-3-methyl-imidazo[4,5-f]quinoline (IQ) and 2-amino-1-methyl-6-phenyl-imidazo[4,5-b]pyridine (PhIP) in the development of colon cancer in mice. Cancer Lett., 110, 187–192.[CrossRef][Web of Science][Medline]
  16. Ito,N., Hasegawa,R., Sano,M., Tamano,S., Esumi,H., Takayama,S. and Sugimura,T. (1991) A new colon and mammary carcinogen in cooked food, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). Carcinogenesis, 12, 1503–1506.[Abstract/Free Full Text]
  17. Ochiai,M., Imai,H., Sugimura,T., Nagao,M. and Nakagama,H. (2002) Induction of intestinal tumors and lymphomas in C57BL/6N mice by a food-borne carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b] pyridine. Jpn. J. Cancer Res., 63, 478–483.
  18. Fujita,H., Nagano,K., Ochiai,M., Ushijima,T., Sugimura,T., Nagao,M. and Mastushima,T. (1999) Difference in target organs in carcinogenicity of a heterocyclic amine, 2-amino-3,4-dimethylimidazo[4,5-f]quinoline, in different strains of mice. Jpn. J. Cancer Res., 90, 1203–1206.[CrossRef][Web of Science]
  19. Tanakamaru,Z., Mori,I., Nishikawa,A., Furukawa,F., Takahashi,M. and Mori,H. (2001) Essential similarities between spontaneous and MeIQx-promoted aberrant crypt foci in the F344 rat colon. Cancer Lett., 172, 143–149.[CrossRef][Web of Science][Medline]
  20. Okonogi,H., Ushijima,T., Shimizu,H., Sugimura,T. and Nagao,M. (1997) Induction of aberrant crypt foci in C57BL/6N mice by 2-amino-9H-pyrido[2,3-b]indole (A{alpha}C) and 2-amino-3,8-dimethylimidazo[4,5-f] quinoxaline (MeIQx). Cancer Lett., 111, 105–109.[CrossRef][Web of Science][Medline]
  21. Miller,J.R. and Moon,R.T. (1996) Signal transduction through ß-catenin and specification of cell fate during embryogenesis. Genes Dev., 10, 2527–2539.[Free Full Text]
  22. Kishida,S., Yamamoto,H., Ikeda,S., Kishida,M., Sakamoto,I., Koyama,S. and Kikuchi,A. (1998) Axin, a negative regulator of the wnt signaling pathway, directly interacts with adenomatous polyposis coli and regulates the stabilization of ß-catenin. J. Biol. Chem., 273, 10823–10826.[Abstract/Free Full Text]
  23. Dashwood,R.H., Suzui,M., Nakagama,H., Sugimura,T. and Nagao,M. (1998) High frequency of ß-catenin (ctnnb1) mutations in the colon tumors induced by two heterocyclic amines in the F344 rat. Cancer Res., 58, 1127–1129.[Abstract/Free Full Text]
  24. Suzui,M., Ushijima,T., Dashwood,R.H., Yoshimi,N., Sugimura,T., Mori,H. and Nagao,M. (1999) Frequent mutations of the rat ß-catenin gene in colon cancers induced by methylazoxymethanol acetate plus 1-hydroxyanthraquinone. Mol Carcinogen., 24, 232–237.[CrossRef][Web of Science][Medline]
  25. Takahashi,M., Fukuda,K., Sugimura,T. and Wakabayashi,K. (1998) ß-Catenin is frequently mutated and demonstrates altered cellular location in azoxymethane-induced rat colon tumors. Cancer Res., 58, 42–46.[Abstract/Free Full Text]
  26. Takahashi,M., Nakatsugi,S., Sugimura,T. and Wakabayashi,K. (2000) Frequent mutations of the ß-catenin gene in mouse colon tumors induced by azoxymethane. Carcinogenesis, 21, 1117–1120.[Abstract/Free Full Text]
  27. Morin,P.J., Sparks,A.B., Korinek,V., Barker,N., Clevers,H., Vogelstein,B. and Kinzler,K.W. (1997) Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science, 275, 1787–1790.[Abstract/Free Full Text]
  28. Miyoshi,Y., Nagase,H., Ando,H., Horii,A., Ichii,S., Nakatsuru,S., Aoki,T., Miki,Y., Mori,T. and Nakamura,Y. (1992) Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in the APC gene. Hum. Mol. Genet., 1, 229–233.[Abstract/Free Full Text]
  29. Powell,S.M., Zilz,N., Beazer-Barclay,Y., Bryan,T.M., Hamilton,S.R., Thibodeau,S.N., Vogelstein,B. and Kinzler,K.W. (1992) APC mutations occur early during colorectal tumorigenesis. Nature, 359, 235–237.[CrossRef][Medline]
  30. Sparks,A.B., Morin,P.J., Vogelstein,B. and Kinzler,K.W. (1998) Mutational analysis of the APC/ß-catenin/Tcf pathway in colorectal cancer. Cancer Res., 58, 1130–1134.[Abstract/Free Full Text]
  31. Iwamoto,M., Ahnen,D.J., Franklin,W.A. and Maltzman,T.H. (2000) Expression of ß-catenin and full-length APC protein in normal and neoplastic colonic tissues. Carcinogenesis, 21, 1935–1940.[Abstract/Free Full Text]
  32. Tanaka,T., Kohno,H., Suzuki,R., Yamada,Y., Sugie,S. and Mori,H. (2003) A novel inflammation-related mouse colon carcinogenesis model induced by azoxymethane and dextran sodium sulfate. Cancer Sci., 94, 965–973.[CrossRef][Medline]
  33. Ward,J.M. (1974) Morphogenesis of chemically induced neoplasms of the colon and small intestine in rats. Lab. Invest., 30, 505–513.[Web of Science][Medline]
  34. Nakagama,H., Ochiai,M., Ubagai,T., Tajima,R., Fujiwara,K., Sugimura,T. and Nagao,M. (2002) A rat colon cancer model induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine, PhIP. Mutat. Res., 506–507, 137–144.
  35. Tsukamoto,T., Tanaka,H., Fukami,H., Inoue,M., Takahashi,M., Wakabayashi,K. and Tatematsu,M. (2000) More frequent ß-catenin gene mutations in adenomas than in aberrant crypt foci or adenocarcinomas in the large intestines of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)-treated rats. Jpn. J. Cancer Res., 91, 792–796.[CrossRef][Web of Science]
  36. Ubagai,T., Ochiai,M., Kawamori,T., Imai,H., Sugimura,T., Nagao,M. and Nakagama,H. (2002) Efficient induction of rat large intestinal tumors with a new spectrum of mutations by intermittent administration of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine in combination with a high fat diet. Carcinogenesis, 23, 197–200.[Abstract/Free Full Text]
  37. Ochiai,M., Ushigome,M., Fujiwara,K., Ubagai,T., Kawamori,T., Sugimura,T., Nagao,M. and Nakagama,H. (2003) Characterization of dysplastic aberrant crypt foci in the rat colon induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. Am. J. Pathol., 163, 1607–1614.[Abstract/Free Full Text]
  38. Nakagama,H., Souda,K., Ochiai,M., Ishiguro,Y., Sugimura,T. and Nagao,M. (1999) Genetic analysis of the susceptibility in rats to aberrant crypt foci formation by 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine, PhIP. Cancer Lett., 143, 205–209.[CrossRef][Web of Science][Medline]
  39. Nagaoka,H., Wakabayashi,K., Kim,S.B., Kim,I.S., Tanaka,Y., Ochiai,M., Tada,A., Nukaya,H., Sugimura,T. and Nagao,M. (1992) Adduct formation at C-8 of guanine on in vitro reaction of the ultimate form of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine with 2'-deoxyguanosine and its phosphate esters. Jpn. J. Cancer Res., 83, 1025–1029.[CrossRef][Web of Science]
  40. Koesters,R., Hans,M., Benner,A., Prosst,R., Boehm,J., Gahlen,J. and Doeberitz,M.K. (2001) Predominant mutation of codon 41 of the ß-catenin proto-oncogene in rat colon tumors induced by 1,2-dimethylhydrazine using a complete carcinogenic protocol. Carcinogenesis, 22, 1885–1890.[Abstract/Free Full Text]
  41. Takahashi,M., Mutoh,M., Kawamori,T., Sugimura,T. and Wakabayashi,K. (2000) Altered expression of ß-catenin, inducible nitric oxide synthase and cyclooxygenase-2 in azoxymethane-induced rat colon carcinogenesis. Carcinogenesis, 21, 1319–1327.[Abstract/Free Full Text]
  42. Prescott,S.M. and White,R.L. (1996) Self-promotion? Intimate connections between APC and prostaglandin H synthase-2. Cell, 87, 783–786.[CrossRef][Web of Science][Medline]
  43. Howe,L.R., Subbaramaiah,K., Chung,W.J., Dannenberg,A.J. and Brown,A.M. (1999) Transcriptional activation of cyclooxygenase-2 in Wnt-1-transformed mouse mammary epithelial cells. Cancer Res., 59, 1572–1577.[Abstract/Free Full Text]
  44. Mei,J.M., Hord,N.G., Winterstein,D.F., Donald,S.P. and Phang,J.M. (1999) Differential expression of prostaglandin endoperoxide H synthase-2 and formation of activated ß-catenin-LEF-1 transcription complex in mouse colonic epithelial cells contrasting in Apc. Carcinogenesis, 20, 737–740.[Abstract/Free Full Text]
  45. Tetsu,O. and McCormick,F. (1999) ß-Catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature, 398, 422–426.[CrossRef][Medline]
  46. He,T.C., Sparks,A.B., Rago,C., Hermeking,H., Zawel,L., da Costa,L.T., Morin,P.J., Vogelstein,B. and Kinzler,K.W. (1998) Identification of c-MYC as a target of the APC pathway. Science, 281, 1509–1512.[Abstract/Free Full Text]
  47. Tanaka,T., Kohno,H., Shimada,R., Kagami,S., Yamaguchi,F., Kataoka,S., Ariga,T., Murakami,A., Koshimizu,K. and Ohigashi,H. (2000) Prevention of colonic aberrant crypt foci by dietary feeding of garcinol in male F344 rats. Carcinogenesis, 21, 1183–1189.[Abstract/Free Full Text]
  48. Rao,C.V., Indranie,C., Simi,B., Manning,P.T., Connor,J.R. and Reddy,B.S. (2002) Chemopreventive properties of a selective inducible nitric oxide synthase inhibitor in colon carcinogenesis, administered alone or in combination with celecoxib, a selective cyclooxygenase-2 inhibitor. Cancer Res., 62, 165–170.[Abstract/Free Full Text]
  49. Lala,P.K. and Chakraborty,C. (2001) Role of nitric oxide in carcinogenesis and tumour progression. Lancet Oncol., 2, 149–156.[CrossRef][Medline]
  50. Seril,D.N., Liao,J., Ho,K.L., Yang,C.S. and Yang,G.Y. (2002) Inhibition of chronic ulcerative colitis-associated colorectal adenocarcinoma development in a murine model by N-acetylcysteine. Carcinogenesis, 23, 993–1001.[Abstract/Free Full Text]
  51. Mabley,J.G., Liaudet,L., Pacher,P., Southan,G.J., Salzman,A.L. and Szabo,C. (2002) Part II: beneficial effects of the peroxynitrite decomposition catalyst FP15 in murine models of arthritis and colitis. Mol. Med., 8, 581–590.[Web of Science][Medline]
  52. Suzuki,R., Kohno,H., Sugie,S. and Tanaka,T. (2004) Sequential observations on the occurrence of preneoplastic and neoplastic lesions in the mouse colon treated with azoxymethane and dextran sodium sulfate. Cancer Sci., 95, 721–727.[CrossRef][Medline]
  53. Ohshima,H. and Bartsch,H. (1994) Chronic infections and inflammatory processes as cancer risk factors: possible role of nitric oxide in carcinogenesis. Mutat Res., 305, 253–264.[Web of Science][Medline]
Received July 21, 2004; revised September 15, 2004; accepted September 17, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
D. W. Rosenberg, C. Giardina, and T. Tanaka
Mouse models for the study of colon carcinogenesis
Carcinogenesis, February 1, 2009; 30(2): 183 - 196.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W.-C. L. Chang, R. A. Coudry, M. L. Clapper, X. Zhang, K.-L. Williams, C. S. Spittle, T. Li, and H. S. Cooper
Loss of p53 enhances the induction of colitis-associated neoplasia by dextran sulfate sodium
Carcinogenesis, November 1, 2007; 28(11): 2375 - 2381.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T. Imai, K. Fukuta, M. Hasumura, Y.-M. Cho, Y. Ota, S. Takami, H. Nakagama, and M. Hirose
Significance of inflammation-associated regenerative mucosa characterized by Paneth cell metaplasia and {beta}-catenin accumulation for the onset of colorectal carcinogenesis in rats initiated with 1,2-dimethylhydrazine
Carcinogenesis, October 1, 2007; 28(10): 2199 - 2206.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Suzuki, H. Kohno, S. Sugie, H. Nakagama, and T. Tanaka
Strain differences in the susceptibility to azoxymethane and dextran sodium sulfate-induced colon carcinogenesis in mice
Carcinogenesis, January 1, 2006; 27(1): 162 - 169.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
A. Nishikawa, T. Imazawa, Y. Kuroiwa, Y. Kitamura, K. Kanki, Y. Ishii, T. Umemura, and M. Hirose
Induction of Colon Tumors in C57BL/6J Mice Fed MeIQx, IQ, or PhIP Followed by Dextran Sulfate Sodium Treatment
Toxicol. Sci., April 1, 2005; 84(2): 243 - 248.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
26/1/229    most recent
bgh292v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tanaka, T.
Right arrow Articles by Wakabayashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, T.
Right arrow Articles by Wakabayashi, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?