Carcinogenesis Advance Access originally published online on September 16, 2004
Carcinogenesis 2005 26(1):37-43; doi:10.1093/carcin/bgh280
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.26 no.1 © Oxford University Press 2005; all rights reserved.
ARTICLE |
Molecular analysis of APC promoter methylation and protein expression in colorectal cancer metastasis
1 Department of Gastroenterology, Hepatology and Infectious Diseases, 2 Institute of Pathology and 3 Department of General Surgery, Otto-von-Guericke University, Magdeburg, Germany, 4 Epigenomics Inc., Seattle, Washington, USA and 5 Max-Planck-Institute of Molecular Physiology, Dortmund, Germany
6 To whom correspondence should be addressed Email: matthias.ebert{at}medizin.uni-magdeburg.de
| Abstract |
|---|
|
|
|---|
APC (adenomatous polyposis coli) promoter methylation has been linked to the early development of colorectal cancers. However, the role of APC methylation and its effect on protein expression in colon cancer metastasis is largely unknown. In this study, we investigated APC promoter methylation by Methylight analysis and analysed the APC protein levels by immunohistochemistry and western blot analysis in 24 liver metastasis and 39 primary colorectal cancers. Promoter methylation of the APC gene was found to be a frequent event in liver metastasis (10/24) and significantly more frequent compared with primary colorectal cancer (7/39, P = 0.047). APC methylation was not found in 14 matched normal colon tissues. APC protein was detected in the cytoplasm of primary and metastatic cancer cells and non-tumorous colon epithelium. By western blot analysis, APC protein levels were found to be decreased in primary tumour tissues compared with the normal colon mucosa. In contrast, APC protein levels were not decreased in the cancer cells that had metastasized to the liver. APC protein levels were independent of the presence of APC promoter methylation or gene mutations. In summary, APC promoter methylation is a frequent epigenetic alteration in colorectal cancer metastasis. However, we observed no significant association between APC promoter methylation or gene mutation and APC protein expression in colorectal metastasis. Therefore, metastatic cancer cells seem to harbour a heterogenous genetic and epigenetic background, in which cancer cells may exhibit APC promoter methylation that is independent of APC expression.
Abbreviations: APC, adenomatous polyposis coli; PCR, polymerase chain reaction
| Introduction |
|---|
|
|
|---|
Colorectal cancer is one of the leading causes of cancer-related death throughout the world, it has a high 5-year mortality rate and 50% of the cases are advanced at the time of diagnosis (1). Advanced colon cancer is often accompanied by metastasis to peritoneum, lymph nodes or other organs. A number of genetic and epigenetic alterations including allelic losses on specific chromosomal arms, mutations of oncogenes, tumour suppressor genes and mismatch repair genes, microsatellite instability in coding repeat sequences of target genes and methylation defects in gene promoters have been described in the tumorigenesis of colorectal cancers and a stepwise model of colorectal carcinogenesis has been proposed (2). However, the molecular mechanisms underlying the progression and the formation of metastasis of colon cancer are still largely unknown.
The adenomatous polyposis coli (APC) tumour suppressor gene, isolated and mapped to chromosomal band 5q21 (3,4), encodes a large 300 kDa protein with multiple cellular functions and interactions, including signal transduction in the Wnt-signalling pathway (5), mediation of intercellular adhesion, stabilization of the cytoskeleton and possibly regulation of the cell cycle and apoptosis (6). Germ-line mutations of the APC gene are associated with hereditary familial adenomatous polyposis (FAP), while somatic mutations in APC occur in
80% of sporadic colorectal tumours and appear very early in colorectal tumour progression (6,7).
Mutation is the most common and primary cause of APC inactivation in colorectal tumours. However, other mechanisms associated with gene inactivation, such as transcriptional silencing by promoter hypermethylation, may also play a role in the loss of APC function in those tumours. DNA methylation is a powerful mechanism for the suppression of gene activity. This frequent epigenetic change in cancer involves aberrantly hypermethylated CpG islands in gene promoters, with loss of transcription of these genes (810). A significant proportion of tumour-related genes, including well-characterized tumour suppressor genes (p16INK4a, p15INK4b, p14ARF, p73), DNA repair genes (hMLH1) and genes related to metastasis and invasion (CDH1, TIMP3 and DAPK) have been demonstrated to be silenced by methylation in different types of cancers (11,12). Recently, hypermethylation of the APC promoter has also been described in a subset of colorectal adenomas and carcinomas and is considered to be an early step in the process of colorectal cancer pathogenesis (1316). In this study, we analysed the APC promoter methylation status in a series of colon cancer metastases as well as primary colon cancers and compared this epigenetic event with the levels of APC protein expression in colon cancer metastases.
| Material and methods |
|---|
|
|
|---|
Subjects
The metastatic lesions were obtained from 24 patients (13 male, 11 female, median age 64.5 years, range 4179) with colorectal cancer that developed liver metastasis after prior successful colon cancer resection. In two patients the primary colon cancer and a single liver metastasis were resected at the same time. Primary colon cancer tissue was obtained by surgical resection from 39 patients (26 male, 13 female; median age of 74 years, range 4093 years) with sporadic colorectal cancer. In 14 of these patients corresponding non-cancer colon tissue was also obtained from a tumour-free location, which was at least 2 cm distant from the tumour and which was confirmed to be without any tumour cell infiltration by histology. Immediately after surgery, tissue samples were put in liquid nitrogen and stored at 80°C until use. Formalin-fixed tissue was processed as described previously and sections were stained with haematoxylin and eosin (H&E) for histology (17). The tumour stage was assessed using the TNM-system.
DNA extraction
Genomic DNA of all samples was extracted from the tissues using the proteinase K digestion method as reported previously (17).
MethyLight analysis of the APC gene
Genomic DNA of all samples was analysed by the MethyLight technique after bisulfite conversion as reported previously by Eads et al. (1820). Briefly, two locus-specific polymerase chain reaction (PCR) primers flank an oligonucleotide probe with a 5' fluorescent reporter dye (6FAM) and a 3' quencher dye (BHQ-1). For this analysis primers and probes are specifically designed to bind to bisulfite-converted DNA, which generally span seven to ten CpG dinucleotides. The gene of interest is then amplified and normalized to a reference set (ß-actin). The specificity of the reactions for methylated DNA is confirmed using unmethylated human sperm DNA and CpGenome Universal Methylated DNA (Chemicon). TaqMan PCR reactions are performed in parallel with primers specific for the bisulfite-converted methylated sequence for a particular locus and with the ACTB reference primers. The ratio between the values is calculated in these two TaqMan analyses. The extent of methylation at a specific locus is determined by the following formula: [(gene/actb)sample: (gene/actb)SssI-treated genomic DNA] x 100. A cut off value of 4% gave the best discrimination between normal and cancerous samples, as reported previously (1820). Therefore, samples with
4% fully methylated molecules were termed methylated, whereas samples with <4% were considered unmethylated. The primer and probe sequences for APC promoter 1A (GeneBank accession number U02509) are: forward primer (5'3'): GAACCAAAACGCTCCCCAT; reverse primer (5'3'): TTATATGTCGGTTACGTGCGTTTATAT; probe sequence (5'3'): 6FAM-CCCGTCGAAAACCCGCCGATTA-BHQ1 (1820).
Detection of APC gene mutation
The mutation cluster region from nucleotides 3570 through to 4800 of the APC gene was screened for sequence alteration by PCR of two overlapping fragments and direct sequencing. The analysed region covers >85% of all published somatic APC mutations (7,21,22). The first fragment was amplified using the primers 5'-TCCTTCATCACAGAAACAGT-3' and 5'-GCTGGATTTGGTTCTAGGG-3', the second fragment using the primers 5'-GGTCAGCTGAAGATCCTGTG-3' and 5'-GATGACTTTGTTGGCATGGCA-3'. Primers were custom-synthesized by MWG Biotech (Munich, Germany). For PCR, 20100 ng of purified chromosomal DNA were used in a total volume of 50 µl containing 10 mM TrisHCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 30 µM each dNTP, 200 nM each primer, 100 µg/ml BSA and 0.51.0 U Taq polymerase (AGS, Heidelberg, Germany). After denaturation at 94°C for 120 s, 30 cycles of PCR were carried out for 60 s at 92°C, 60 s at 62°C and 60 s at 72°C. PCR products were purified from residual primers and non-incorporated nucleotides using standard reagents and protocols (Qiagen, Hilden, Germany). Standard cycle sequencing was performed in the presence of fluorescence-labelled dideoxynucleotides using the upstream PCR primer as a sequencing primer. Reaction products were analysed on an ABI automated sequencer. PCR and sequence analysis of mutated samples were repeated twice to exclude PCR errors (23).
Western blot analysis
Tissues from the non-tumorous colon, colon cancer and liver metastases were lysed in a buffer containing 1 mM EDTA, 50 mM ß-glycerophosphate, 2 mM sodium orthovanadate, 1% Triton-100, 10% glycerol, 1 mM DTT and protease inhibitors (10 mg/ml benzamidine, 2 mg/ml antipain and 1 mg/ml leupeptin). The protein concentration of the supernatants was determined by the BCA assay (Bio-Rad). Twenty micrograms of protein in each sample was adjusted to Laemmli buffer composition [2% SDS, 10% glycerol, 62.5 mM TrisHCl (pH 6.8), 100 mM DTT and 0.1% bromphenol blue], denatured by heating at 95°C for 5 min, and subsequently separated on 5% polyacrylamide gels by SDS-gel electrophoresis. After separation, the proteins were transferred onto immuno-Blot polyvinylidene difluoride membrane (Bio-Rad). The membrane was blocked in 5% non-fat milk in 1% TBST for 1 h at room temperature, and then incubated separately with anti-APC antibody N-15 or anti-APC antibody C-20 (Santa Cruz Biotechology, Santa Cruz, CA) overnight at 4°C (dilution 1:200). These two antibodies react with the N-terminal and C-terminal part of the human APC protein, respectively (Figure 1). Membranes were then washed three times in Tris-bufferd saline/0.1% Tween 20, incubated for 2 h with peroxidase-labelled anti-rabbit IgG (1:2500, KPL) and diluted in blocking solution. Membrane-bound secondary antibodies were detected by an enhanced chemiluminescence method following the instructions of the manufacturer (ECL plus western blotting detection reagents, Amersham Biosciences).
|
Immunohistochemistry
Deparaffinized serial sections were cut at 3 µm for immunohistochemistry and placed on Superfrost Plus glass slides. Prior to immunostaining, sections were deparaffinized in xylene and rehydrated in an alcohol series. Immunostaining was performed with antibodies directed against the N-terminal (N-15; dilution 1:200) and C-terminal (C-20; 1:20; both Santa Cruz, CA) region of the human APC protein. Incubation with the primary antibodies was performed in a moist chamber at 37°C for 1 h. After incubation with the respective secondary antibody (30 min, room temperature; Immunotech, Marseilles, France) slides were washed with Tris-buffered saline. Immunoreactions were visualized via a streptavidinbiotin complex, using the Vectastain ABC alkaline phosphatase kit (distributed by CAMON, Wiesbaden, Germany). Neufuchsin (Sigma-Aldrich, Steinheim, Germany) served as chromogen. The specimens were counter-stained with haematoxylin. Primary antibodies were omitted for negative controls. Evaluation of the slides was performed by an experienced pathologist (C.R.) who was blinded to the results of the methylation and mutation analysis. Immunostaining was graded semi-quantitatively as negative, weak, moderate or strong corresponding to positive staining of 0, <10, 1050 or >50% of the total cells.
Statistical analysis
The PMR (percentage of methylated reference) values of the Methylight assays were dichotomized for statistical purposes as reported previously by Eads et al. (1820). The frequency of APC promoter methylation in primary and metastatic colon cancers was compared by Fisher's exact test. All tests were two-sided, and a P-value of <0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
APC promoter methylation in primary colon cancer and liver metastasis
Using the Methylight assay, we first assessed the promoter 1A methylation status of the APC gene in 39 primary colon cancers and 14 corresponding samples from non-neoplastic colon mucosa. Seven cancers exhibited a PMR >4% (7/39) whereas in none of the 14 non-neoplastic colon samples APC promoter methylation was observed (Figure 2A). We then assessed the frequency of APC promoter methylation in 24 liver metastatases and compared them with 39 primary colon cancers. In this series, primary colon cancer and liver metastases were obtained from the same patients in two cases, while the remaining 22 liver metastasis and 37 primary colon cancer samples were obtained from separate patient populations. Our analysis showed a higher frequency of APC promoter methylation in metastatic colon cancer (10/24) compared with primary colon cancer (7/39) (P = 0.047), although in the two matched primary colon cancer and metastatic tissues, no APC promoter methylation was observed in both, the primary cancer and liver metastases (Figure 2B).
|
Detection of APC protein expression in primary colon cancer and liver metastasis
In order to determine whether APC gene alterations will affect protein expression in primary and metastatic colorectal cancer, we analysed the APC protein expression in primary colon cancers of 20 patients and in the liver metastases of 14 patients and compared these results with the methylation status of the APC promoter (Table I). For the analysis of APC protein expression we used two different antibodies. Since most of the APC gene mutations are present within the mutation cluster region and lead to a truncated protein, we used antibodies directed against both the N-terminus (N-15) and C-terminus (C-20) of the APC protein in our western blot analysis (Figure 1). By western blot analysis two isoforms of the APC protein (300 and 200 kDa, respectively) were identified using both the N-15 and C-20 antibody, while no truncated APC proteins were observed (Figure 3). In general, the level of both APC isoforms was decreased in primary cancer tissues when compared with the corresponding normal colon tissues. However, APC protein levels were similar or even increased in liver metastases when compared with the normal colon and primary colorectal cancer tissues. In one matched primary colon cancer and liver metastasis tissue the expression of the APC protein was completely absent, while in one case APC protein levels were higher in the liver metastasis than in corresponding primary colon cancer. Furthermore, when we assessed the APC protein levels in tumour tissues with regard to the presence of APC promoter methylation, we observed no significant difference among the tissues with methylation of the APC promoter versus cases without methylation. In addition, we also determined the mutational status of the APC gene in two primary and two metastatic colorectal cancers (Table II). Again, the APC protein expression in these samples was independent of the presence of APC mutations and even the presence of APC promoter methylation in these cases (Table II, Figure 3).
|
|
|
Subcellular expression of APC in primary colon cancer and liver metastasis
The distribution and expression pattern of the APC protein in all patients with APC promoter methylation was also investigated by immunohistochemistry with both the N-15 and C-20 antibodies. APC was found in the cytoplasm of the samples obtained from non-tumorous mucosal epithelium, tumorous epithelium of the primary tumour site, lymph node or liver metastases. In general, the intensity of immunostaining and the number of immunoreactive cells were decreased in the tumorous epithelium, when compared with the corresponding non-tumorous epithelium. In contrast, the expression of APC was similar in tumorous and non-tumorous epithelium in five and four patients using immunohistochemical analysis and antibodies N-15 and C-20, respectively. Furthermore APC expression was present in matched primary tumour and lymph node metastases of four patients (C-20) and one patient (N-15), respectively. Specimens from the primary tumour were not available for comparison in all patients with liver metastases (Table I, Figure 4). However, APC expression was observed in nine of the metastatic lesions by immunohistochemistry and in 12 cases by western blot analysis and the presence or absence of the APC protein was independent of the methylation status of the APC promoter.
|
Overall, the pattern of APC immunoreactivity using the two different antibodies was very similar in the normal mucosa, the colon cancers and metastasis. While some cancers exhibited various degrees of APC immunoreactivity as outlined in Table I, in general the presence of APC could be confirmed by both antibodies using immunohistochemistry and western blot analysis (Figures 3 and 5). We identified only one case that exhibited APC protein expression by western blot analysis using the N-15 antibody, whereas in the second analysis using the C-20 antibody no APC protein could be identified (Table I, No. 33). However, in this case no APC promoter methylation was found. In summary, APC levels as assessed by western blot analysis confirmed the expression of APC in the tissue specimen as assessed by immunohistochemistry and the results using the N-15 and C-20 antibodies were very similar (Table I).
|
| Discussion |
|---|
|
|
|---|
Although the genetic and epigenetic changes of the APC gene have been linked to the early development of colorectal cancer in previous studies, its role in colon cancer metastasis is still largely unknown. Blaker et al. compared the loss of heterozygosity (LOH) pattern of 5q in 15 cases of primary colorectal cancer and the corresponding metastatic liver tumours, and found that the LOH patterns of 5q in the primary and the metastatic tumours were identical in eight cases (24). In a recent study, Zauber et al. reported that in their series of 42 colorectal cancers LOH at the APC locus was identical in 39 paired carcinomas and synchronous metastases (25). These studies indicate that genetic changes of the APC gene in metastases are consistent with the primary colorectal cancer. However, other epigenetic changes of the APC gene in colorectal cancer metastasis have not been explored yet.
The APC gene has two promoter regions, 1A and 1B; promoter 1A is most commonly active (6,7). Hypermethylation of the 1A promoter region of APC has been reported previously in some colorectal adenomas and carcinomas, but not in adjacent normal colonic mucosa (13,14). APC 1A promoter methylation has also been found in a number of other human gastrointestinal tumours, including oesophageal, gastric, pancreatic and hepatic cancers. However, there is no evidence for such an epigenetic alteration in the APC 1B promoter (13,20,26). Based on these findings, we analysed the methylation status of the 1A promoter region of the APC gene in our study using the Methylight assay. Methylight is a novel high-throughput methylation assay that utilizes fluorescence-based real-time PCR technology that requires no further manipulation after the PCR step. It is a highly sensitive assay, capable of detecting methylated alleles in the presence of a 10 000-fold excess of unmethylated alleles, and can very accurately determine the relative prevalence of a particular pattern of DNA methylation (1820). Using the Methylight assay, APC promoter 1A methylation was observed in seven of 39 primary colorectal cancers and in none of the matched non-neoplastic colon mucosa samples. This result is comparable with the previous report by Esteller et al. (13). Furthermore, we found a significantly higher frequency (41.67%) of APC promoter methylation in liver metastases of colorectal cancers. To our knowledge this is the first study to address the status of APC promoter methylation in metastatic colorectal cancers. Although the majority of the primary cancers and the liver metastases in our study were from different patients, the fact that the APC promoter was more frequently methylated in the liver metastases of colon cancer still indicates that the epigenetic change of the APC gene may play a role in the progression of colorectal cancer. There are two possibilities for the contribution of APC promoter methylation to the formation of metastasis in colorectal cancer; one possibility is that methylation of the APC gene promoter occurs early in colorectal cancer and increases during disease progression. In fact, increased methylation during the progression of bladder cancer has been reported for the p16, p15 and PAX6 genes by Markl et al. (27). Moreover, our results also indicate the other possibility that methylation of the APC gene promoter may occur de novo in the metastatic cancer cells even in the absence of methylation in the primary cancer cells.
In order to determine if APC promoter methylation and/or APC gene mutation will affect the protein expression, we further analysed APC protein expression in all patients that were analysed for APC promoter methylation. In order to detect both normal and mutant protein we used antibodies directed against both the N-terminus (N-15) and C-terminus (C-20) of the APC protein using western blot analysis and immunohistochemistry. By western blot analysis, two isoforms of the APC protein (300 and 200 kDa, respectively) were observed in the non-neoplastic colon mucosa samples, primary tumours and liver metastases while no truncated APC proteins were detected. The 300 kDa isoform is the conventional form of the APC protein encoded by exons 115 and is critical for the differentiation of intestinal epithelial cells; while the 200 kDa isoform is an alternative splice-form of APC without exon 1 that has been shown to be enriched in non-dividing, terminally differentiated cells and may contribute to the suppression of proliferation (28). In general, the levels of both APC isoforms were decreased in primary cancer tissues when compared with the corresponding non-neoplastic mucosa, but APC levels in colon cancer metastases were similar or even increased compared with the non-neoplastic mucosa or primary cancers. The APC protein distribution pattern in non-neoplastic mucosa, colon cancer and liver metastases was also confirmed by immunohistochemistry. Interestingly, the APC protein levels were independent of the presence of APC gene mutations in these tumours. Thus, by comparing the APC protein levels in tumour tissues with different genetic and/or epigenetic alterations of the APC gene, we found no significant difference in APC protein levels among tissues with unchanged APC gene, methylated APC gene, mutated APC gene or APC gene with both mutation and methylation. The lack of a clear correlation between the genetic and epigenetic APC alterations and APC protein expression in our study may be explained in several ways: samples with APC gene mutations or promoter methylation may have only one allele affected, allowing expression from the unaltered allele, similiar cases were also reported by Esteller et al. (13). Apart from this phenomenon, metastatic cancer cells may harbour a heterogenous epigenetic and genetic background, in which only a few cells exhibit APC methylation and/or mutation. While the Methylight assay detected APC promoter methylation more frequently in metastases compared with primary cancers, this result only indicates the presence of methylation independent of the number of cancer cells exhibiting APC methylation. In contrast, APC protein expression was determined in a tissue homogenate including cells with and without APC methylation. Therefore, despite the fact that APC methylation may be detected in these cancer cells, other cancer cells may retain APC expression due to a normal APC gene.
In summary, we demonstrate that APC promoter methylation is a frequent epigenetic alteration in colorectal cancer metastases. However, the levels of the APC protein may remain unchanged indicating that metastatic cancer cells seem to either harbour a heterogenous epigenetic background, in which only few cells exhibit APC promoter methylation and others retain APC expression, or that the unaltered second allele still allows sufficient APC expression.
| Acknowledgments |
|---|
M.E. is supported by a grant from the DFG (Eb 187/4-1) and by the Heisenberg Programme of the DFG (Eb 187/51). Further support to M.E. was granted from the Land Sachsen-Anhalt (3488A/0103 M), the Forschungszentrum Immunologie (FZI) of the Medical Faculty of the Otto-von-Guericke University Magdeburg and by the Werner-Creutzfeldt-Stipend of the Deutsche Gesellschaft für Verdauungs- und Stoffwechselerkrankungen.
| References |
|---|
|
|
|---|
- McCormick,D., Kibbe,P.J. and Morgan,S.W. (2002) Colon cancer: prevention, diagnosis, treatment. Gastroenterol. Nurs., 25, 204212.[CrossRef][Medline]
- Gayet,J., Zhou,X.P., Duval,A., Rolland,S., Hoang,J.M., Cottu,P. and Hamelin,R. (2001) Extensive characterization of genetic alterations in a series of human colorectal cancer cell lines. Oncogene, 20, 50255032.[CrossRef][Web of Science][Medline]
- Kinzler,K.W., Nilbert,M.C., Su,L.K., Vogelstein,B., Bryan,T.M., Levy,D.B., Smith,K.J., Preisinger,A.C., Hedge,P. and McKechnie,D. (1991) Identification of FAP locus genes from chromosome 5q21. Science, 253, 661665.
[Abstract/Free Full Text] - Nishisho,I., Nakamura,Y., Miyoshi,Y., Miki,Y., Ando,H., Horii,A., Koyama,K., Utsunomiya,J., Baba,S. and Hedge,P. (1991) Mutations of chromosome 5q21 genes in FAP and colorectal cancer patients. Science, 253, 665669.
[Abstract/Free Full Text] - Chung,D.C. (2000) The genetic basis of colorectal cancer: insights into critical pathways of tumorigenesis. Gastroenterology, 119, 854865.[CrossRef][Web of Science][Medline]
- Fearnhead,N.S., Britton,M.P. and Bodmer,W.F. (2001) The ABC of APC. Hum Mol Genet., 10, 721733.
[Abstract/Free Full Text] - Beroud,C. and Soussi,T. (1996) APC gene: database of germline and somatic mutations in human tumors and cell lines. Nucleic Acids Res., 24, 121124.
[Abstract/Free Full Text] - Jones,P.A. and Laird,P.W. (1999) Cancer epigenetics comes of age. Nature Genet., 21, 163167.[CrossRef][Web of Science][Medline]
- Baylin,S.B., Herman,J.G., Graff,J.R., Vertino,P.M. and Issa,J.P. (1998) Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72, 141196.[Web of Science][Medline]
- Baylin,S.B. and Herman,J.G. (2000) DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet., 16, 168174.[CrossRef][Web of Science][Medline]
- Esteller,M. and Herman,J.G. (2002) Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours. J. Pathol., 196, 17.[CrossRef][Web of Science][Medline]
- Esteller,M., Corn,P.G., Baylin,S.B. and Herman,J.G. (2001) A gene hypermethylation profile of human cancer. Cancer Res., 61, 32253229.
[Abstract/Free Full Text] - Esteller,M., Sparks,A., Toyota,M. et al. (2000) Analysis of adenomatous polyposis coli promoter hypermethylation in human cancer. Cancer Res., 60, 43664371.
[Abstract/Free Full Text] - Hiltunen,M.O., Alhonen,L., Koistinaho,J., Myohanen,S., Paakkonen,M., Marin,S., Kosma,V.M. and Janne,J. (1997) Hypermethylation of the APC (adenomatous polyposis coli) gene promoter region in human colorectal carcinoma. Int. J. Cancer, 70, 644648.[CrossRef][Web of Science][Medline]
- Sakamoto,Y., Kitazawa,R., Maeda,S. and Kitazawa,S. (2001) Methylation of CpG loci in 5'-flanking region alters steady-state expression of adenomatous polyposis coli gene in colon cancer cell lines. J. Cell Biochem., 80, 415423.[CrossRef][Web of Science][Medline]
- Eads,C.A., Danenberg,K.D., Kawakami,K., Saltz,L.B., Danenberg,P.V. and Laird,P.W. (1999) CpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpression. Cancer Res., 59, 23022306.
[Abstract/Free Full Text] - Ebert,M.P., Yu,J., Hoffmann,J., Rocco,A., Rocken,C., Kahmann,S., Muller,O., Korc,M., Sung,J.J. and Malfertheiner,P. (2003) Loss of beta-catenin expression in metastatic gastric cancer. J. Clin. Oncol., 21, 17081714.
[Abstract/Free Full Text] - Eads,C.A., Danenberg,K.D., Kawakami,K., Saltz,L.B., Blake,C., Shibata,D., Danenberg,P.V. and Laird,P.W. (2000) MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res., 28, E32.
- Eads,C.A., Lord,R.V., Wickramasinghe,K. et al. (2001) Epigenetic patterns in the progression of esophageal adenocarcinoma. Cancer Res., 61, 34103418.
[Abstract/Free Full Text] - Eads,C.A., Lord,R.V., Kurumboor,S.K. et al. (2000) Fields of aberrant CpG island hypermethylation in Barrett's esophagus and associated adenocarcinoma. Cancer Res., 60, 50215026.
[Abstract/Free Full Text] - Nakatsuru,S., Yanagisawa,A., Ichii,S., Tahara,E., Kato,Y., Nakamura,Y. and Horii,A. (1992) Somatic mutation of the APC gene in gastric cancer: frequent mutations in very well differentiated adenocarcinoma and signet-ring cell carcinoma. Hum Mol Genet., 1, 559563.
[Abstract/Free Full Text] - Miyoshi,Y., Nagase,H., Ando,H., Horii,A., Ichii,S., Nakatsuru,S., Aoki,T., Miki,Y., Mori,T. and Nakamura,Y. (1992) Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in the APC gene. Hum. Mol. Genet., 1, 229233.
[Abstract/Free Full Text] - Ebert,M.P., Fei,G., Kahmann,S., Muller,O., Yu,J., Sung,J.J. and Malfertheiner,P. (2002) Increased beta-catenin mRNA levels and mutational alterations of the APC and beta-catenin gene are present in intestinal-type gastric cancer. Carcinogenesis, 23, 8791.
[Abstract/Free Full Text] - Blaker,H., Graf,M., Rieker,R.J. and Otto,H.F. (1999) Comparison of losses of heterozygosity and replication errors in primary colorectal carcinomas and corresponding liver metastases. J. Pathol., 188, 258262.[CrossRef][Web of Science][Medline]
- Zauber,P., Sabbath-Solitare,M., Marotta,S.P. and Bishop,D.T. (2003) Molecular changes in the Ki-ras and APC genes in primary colorectal carcinoma and synchronous metastases compared with the findings in accompanying adenomas. Mol. Pathol., 56, 137140.
[Abstract/Free Full Text] - Tsuchiya,T., Tamura,G., Sato,K. et al. (2000) Distinct methylation patterns of two APC gene promoters in normal and cancerous gastric epithelia. Oncogene, 19, 36423646.[CrossRef][Web of Science][Medline]
- Markl,I.D., Cheng,J., Liang,G., Shibata,D., Laird,P.W. and Jones,P.A. (2001) Global and gene-specific epigenetic patterns in human bladder cancer genomes are relatively stable in vivo and in vitro over time. Cancer Res., 61, 58755884.
[Abstract/Free Full Text] - Santoro,I.M. and Groden,J. (1997) Alternative splicing of the APC gene and its association with terminal differentiation. Cancer Res., 57, 488494.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. M. McGough, D. Yang, S. Huang, D. Georgi, S. M. Hewitt, C. Rocken, M. Tanzer, M. P.A. Ebert, and K. Liu DNA Methylation Represses IFN-{gamma}-Induced and Signal Transducer and Activator of Transcription 1-Mediated IFN Regulatory Factor 8 Activation in Colon Carcinoma Cells Mol. Cancer Res., December 1, 2008; 6(12): 1841 - 1851. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Baran, K. A. Silverman, J. Zeskand, R. Koratkar, A. Palmer, K. McCullen, W. J. Curran Jr, T. B. Edmonston, L. D. Siracusa, and A. M. Buchberg The modifier of Min 2 (Mom2) locus: Embryonic lethality of a mutation in the Atp5a1 gene suggests a novel mechanism of polyp suppression Genome Res., May 1, 2007; 17(5): 566 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Hitchins, C Suter, J Wong, K Cheong, N Hawkins, B Leggett, R Scott, A Spigelman, I Tomlinson, D Martin, et al. Germline epimutations of APC are not associated with inherited colorectal polyposis. Gut, April 1, 2006; 55(4): 586 - 587. [Full Text] [PDF] |
||||
![]() |
P. Schatz, J. Distler, K. Berlin, and M. Schuster Novel method for high throughput DNA methylation marker evaluation using PNA-probe library hybridization and MALDI-TOF detection. Nucleic Acids Res., January 1, 2006; 34(8): e59 - e59. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Schmiemann, A. Bocking, M. Kazimirek, A. S. C. Onofre, H. E. Gabbert, R. Kappes, C. D. Gerharz, and H. J. Grote Methylation Assay for the Diagnosis of Lung Cancer on Bronchial Aspirates: A Cohort Study Clin. Cancer Res., November 1, 2005; 11(21): 7728 - 7734. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








