Carcinogenesis Advance Access originally published online on May 19, 2005
Carcinogenesis 2005 26(10):1731-1740; doi:10.1093/carcin/bgi134
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.26 no.10 © Oxford University Press 2005; all rights reserved.
The Fanconi anemia group A protein modulates homologous repair of DNA double-strand breaks in mammalian cells
International Agency for Research on Cancer (IARC), 150 cours Albert Thomas, F-69008 Lyon, France, 1 Memorial Sloan-Kettering Cancer Center, New York, NY 10021, USA and 2 Institut fur Humangenetik, Charite-Campus Virchow-Klinikum, Humboldt Universitat zu Berlin, Augustenburger Platz 1, 13353 Berlin, Germany
* To whom correspondence should be addressed. Tel: +33 4 72 73 85 10; Fax:+33 4 72 73 83 29; Email: zqwang{at}iarc.fr
| Abstract |
|---|
|
|
|---|
Fanconi anemia (FA) cells exhibit hypersensitivity to DNA interstrand cross-links (ICLs) and high levels of chromosome instability. FA gene products have been shown to functionally or physically interact with BRCA1, RAD51 and the MRE11/RAD50/NBS1 complex, suggesting that the FA complex may be involved in the repair of DNA double-strand breaks (DSBs). Here, we have investigated specifically the function of the FA group A protein (FANCA) in the repair of DSBs in mammalian cells. We show that the targeted deletion of Fanca exons 3739 generates a null for Fanca in mice and abolishes ubiquitination of Fancd2, the downstream effector of the FA complex. Cells lacking Fanca exhibit increased chromosomal aberrations and attenuated accumulation of Brca1 and Rad51 foci in response to DNA damage. The absence of Fanca greatly reduces gene-targeting efficiency in mouse embryonic stem (ES) cells and compromises the survival of fibroblast cells in response to ICL agent treatment. Fanca-null cells exhibit compromised homology-directed repair (HDR) of DSBs, particularly affecting the single-strand annealing pathway. These data identify the Fanca protein as an integral component in the early step of HDR of DSBs and thereby minimizing the genomic instability.
Abbreviations: DSB, double-strand break; ES, embryonic stem; FA, Fanconi anemia; HDR, homology-directed repair; ICLs, interstrand cross-links; LTGC, long-tract gene conversion; MMC, mitomycin C; NHEJ, nonhomologous end-joining; SSA, single-strand annealing; STGC, short-tract gene conversion
| Introduction |
|---|
|
|
|---|
Fanconi anemia (FA) is a genetically heterogeneous disease characterized by bone marrow failure, congenital abnormalities and an increased incidence of cancer (1,2). Cells of FA patients exhibit hypersensitivity to bifunctional crosslinking agents, such as mitomycin C (MMC), and an elevated frequency of spontaneous chromosome breaks and translocations, which is further increased after exposure to MMC (3,4). The cellular defect responsible for FA is caused by mutation of any of 11 genes defined by the complementation groups, from FA-A to FA-L, established by somatic cell hybridization of patient cells. Nine of the FA genes have been identified: FANCA, FANCB, FANCC, FANCD1/BRCA2, FANCD2, FANCE, FANCF, FANCG and FANCL (2,5,6).
MMC induces DNA interstrand cross-links (ICLs) that result in DNA double-strand breaks (DSBs) during DNA replication (79). The hypersensitivity of FA cells to ICL agents may be due to the defects in homology-directed repair (HDR) of DSBs. Human FA fibroblasts also exhibit hypersensitivity to restriction enzyme-induced chromosomal DNA DSBs (10). In addition, some FA patients and cells exhibit a mild radiosensitivity, which may reflect the small proportion of radiation-induced DSBs that are repaired by HDR (11). Biochemical studies have indicated that the FA proteins, FANCA, FANCB, FANCC, FANCE, FANCF, FANCG and FANCL form a multisubunit nuclear core complex (6,12). The monoubiquitination of FANCD2 by FANCL (an E3 ubiquitin ligase) is impaired in cells lacking any member of the upstream FA core complex (12,13), thus explaining their common hypersensitivity to DNA cross-linking agents.
FANCD1/BRCA2 has been shown to be involved in the HDR of DSBs presumably through its physical interaction with RAD51 (1416). Direct interactions between FANCA and BRCA1, FANCG and FANCD1/BRCA2, and between FANCD2 and FANCD1/BRCA2 have been described (1720). After monoubiquitination, FANCD2 interacts with NBS1 and colocalizes with RAD51 and BRCA1 in nuclear foci as a response to DNA damage (13,21,22), and this is believed to be essential for its function in DNA DSB repair. Therefore, FA proteins are anticipated to repair DSBs generated when the replication machinery encounters an ICL. However, the precise pathway used by FA proteins in DSB repair remains elusive.
Recent studies have shown that the inactivation of the FANCG, FANCC or FANCD2 homologues in chicken B lymphoma-derived DT40 cells results in deficient homologous repair, which strengthens this hypothesis (2325). However, since human FANCG has only 39% identity to the chicken homologue, and is unable to complement chicken cells lacking Fancg, the relevance of results from this system for the mammalian FA complex remains largely unknown. Finally, FA group A accounts for >60% of total FA patients, and the function of the protein (FANCA) in the DNA repair process has not been studied in mammalian system, nor in chicken cells. Despite great effort, the exact molecular pathways by which FANCA participates in the repair of DSBs in vivo have not been established.
In order to seek direct evidence for the involvement of the FA proteins in the repair of DSBs in mammalian cells, we engineered mouse cells null for the Fanca protein and analysed the repair pathways of DSBs. Fanca knock-out mice and cells with a defined genetic background, provide a powerful tool for investigation of the authentic functions of Fanca in DSB repair. We show that Fanca is directly involved in the repair of DNA DSBs by promoting both HDR and, particularly single-strand annealing (SSA), pathways. Failure to activate DSB repair by appropriate pathways is expected to lead to increased use of alternative, error-prone repair processes thus explaining the chromosome instability phenotype of FA patients.
| Materials and methods |
|---|
|
|
|---|
Gene targeting and cell lines
Targeting vector pTVFlox-Fanca was constructed by cloning PCR-amplified genomic FA fragments into the vector pTVFlox. One lox-P site was inserted into intron 39 and two lox-P sites flanking the neomycin-resistance gene (neo) were introduced into intron 36. A thymidine kinase gene (tk) was used for negative selection. The linearized targeting vector was electroporated into E14.1 embryonic stem (ES) cells and targeted ES clones (Fanca+/t) were identified by PCR and Southern blotting. To generate the Fanca deletion allele, Fanca+/t ES clones were transiently transfected with a Cre-expressing plasmid pMC-Cre, and Fanca+/
clones were identified by PCR and Southern-blotting. To delete the remaining wild-type allele of Fanca, two independent Fanca+/
ES clones were electroporated with pTVFlox-Fanca and subsequently pMC-Cre. Fanca
/
clones were identified by Southern blotting and Western blotting. Dermal fibroblasts were established from ear biopsies of Fanca+/+ and Fanca
/
mice, and immortalized with the transfection of the SV40 large T-antigen-expressing vector, pPrSty, as described previously (26).
Construction of stable cell lines and recombination assay
ES cell lines, containing a single intact copy of reporter substrate DRGFP at the hprt locus, and fibroblast cell lines that have the substrate integrated at a random locus, were constructed as described previously (2729). Endonuclease I-SceI-expressing plasmid pCBASce and mock vector pCAGGS (without the I-SceI gene) were electroporated into cells for recombination assay and controls, respectively. Flow cytometric analysis was performed as described previously (28).
Physical analysis of DSBs repair
A DNA fragment surrounding the original location of the I-SceI site was amplified by PCR from the genome of mock or I-SceI-transfected cells as described previously (28). The pathway of DSB repair via either HDR, such as short-track gene conversion (STGC), SSA, long-tract gene conversion (LTGC), or nonhomologous end-joining (NHEJ) was measured by the density of DNA bands after staining with ethidium bromide, as described previously (28). The STGC, SSA or LTGC events measured by the BcgI-site gains is similar to that obtained by direct sequencing of I-SceI resistant fragments as described previously (28). To investigate SSA pathway, we used a combined PCR-Southern blotting method. After I-SceI expression, genomic DNA was used as PCR template for 2 pairs of PCR primers, either SA-F and SA-R1, or SA-F and SA-R2 (SA-F: GCAACGTGCTGGTTATTGTG; SA-R1 CAAATGTGGTATGGCTGATTATG; SA-R2 ATGACCATGATTACGCCAAG). Amplification was for 20 cycles, which was determined to be in the linear range. Southern blots of the PCR products were probed with 32P-labeled fragment from DR GFP, which was cut with HindIII/BamHI.
Colony survival assay
Fibroblast cells were plated in duplicate at 250 cells/10 cm culture dish and MMC (Sigma, St Louis, MO, USA) was added to various concentrations. After 10 days of growth, cells in the dishes were fixed in methanol/acetic acid and stained with Giemsa. Colonies per dish were counted and expressed as a percentage of the untreated controls.
Chromosome analysis
Fibroblasts were plated in 10 cm culture dishes and harvested 2 days later in the logarithmic phase. Mitomycin C was added to a final concentration of 40 or 80 ng/ml, 24 h before harvesting. Mitotic cells in the medium above the monolayers were added back to the trypsinized adherent cells before incubation in hypotonic KCl solution (0.4%). Chromosome breakage was assessed blindly with coded slides. Chromatid breaks and translocation figures were scored as well as chromosome aberrations, including ring chromosomes, isochromatid breaks and dicentric chromosomes. Chromosome translocations and fusions were counted as two breaks, chromatid breaks were counted as one.
Western blotting and immunoprecipitation
Proteins (50 µg) extracted from cells in RIPA buffer were resolved by 8% SDSPAGE and electroblotted onto nitrocellulose membranes. The following antibodies were used to probe blots: Guinea pig anti-Fanca serum (1:200) and rabbit anti-Fanca serum (1:3000) [both antibodies were raised against amino acids 1454 of the Fanca protein; kindly provided by Dr Fre Arwert; (30)], and mouse anti-actin serum (1:5000; Santa Cruz, CA, USA). Chemiluminiscent detection was performed using the ECL reagent (Amersham Pharmacia Biotech, Freiburg, Germany). For immunoprecipitation, 800 µg of whole cell lysate was incubated with 50 µl of rabbit anti-Fanca serum and antibody-bound proteins were collected by incubation for 16 h with magnetic beads conjugated with sheep anti-rabbit IgG (Dynal Biotech GmbH, Hamburg, Germany).
Detection of monoubiquitinated Fancd2
Cells were treated or untreated with 50 ng/ml of MMC or 5 mM of hydroxyurea for 24 h. Proteins (80 µg) extracted from cells in lysis buffer (1% TritonX-100, 0.1% SDS, 0.25% DOC, 1 mM EDTA, 50 mM NaF and proteinase inhibitors) were resolved by 6% SDSPAGE, and electroblotted to nitrocellulose membrane. To detect ubiquitinated Fancd2, an anti-FANCD2 antibody E35 [kindly provided by Dr Alan D.D'Andrea; (13)] was used.
Immunofluorescence staining for foci formation
Cells grown on glass coverslips were treated with 100 ng/ml MMC for 1 h, fixed at indicated time points with ice-cold methanol for 15 min, and permeabilized with ice-cold acetone for 2 min. Cells were stained with rabbit polyclonal anti-Rad51 (1:200, Oncogene, Cambridge, MA, USA), or mouse monoclonal anti-Brca1 (1:10, kindly provided by Dr David M.Livingston) antibodies. Slides were mounted in Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA, USA) and visualized under a Zeiss Axioskop fluorescence microscope equipped with a CCD imaging system (IP Lab Spectrum, NY, USA). For each sample, at least 300 nuclei were scored. A cell with at least five distinct foci in the nucleus was scored as a foci-positive cell.
| Results |
|---|
|
|
|---|
Generation and characterization of Fanca-null mouse embryonic stem and fibroblast cells
So far, several Fanca mutant mouse strains that carry a homozygous germ-line mutation of Fanca have been reported (3133). While the deletion of exons 47 rendered mice infertile (31), mice carrying exons 16 deletion showed various FA symptoms, some of which were dependent on the genetic background (33). In addition, mice with the deletion of exon 37 exhibited some cellular phenotypes mimicking FA, although this strategy generated a leaky deletion of Fanca (32). Because intragenic deletion in the region of exons 3739 are often detected in FA patients, we aimed to investigate the possible effect of mutations in C-terminus of Fanca. To this end, we generated new mouse strains carrying the Fanca gene disrupted in this area. To generate Fanca-null mouse ES and fibroblast cells, we constructed the targeting vector pTVFlox-Fanca by inserting the neomycin gene (neo) cassette flanked by two loxP sites into intron 36 and by placing the third loxP site in intron 39 (Figure 1A). We obtained Fanca+/
ES clones (carrying a deletion of exons 3739) after transiently transfecting a Cre-expressing plasmid into targeted (Fanca+/t) ES clones that were generated by gene targeting using the targeting vector pTVFlox-Fanca in E14.1 ES cells (Figure 1B). To disrupt the remaining wild-type allele of Fanca+/
cells, we generated Fancat/
ES clones by electroporating the same targeting vector into Fanca+/
cells. After transfecton with the Cre-expressing construct into two independent Fancat/
ES clones, five homozygous Fanca
/
ES clones were identified by Southern blotting (Figure 1B). Western-blot analysis using antibodies raised against amino acids 1454 of the Fanca protein detected no protein in these ES clones (Figure 1C), indicating that the deletion of exons 3739 of Fanca in our knock-out cells and mice is a null mutation.
|
To study the role of Fanca in the repair of DSBs, we generated Fanca-deficient mice and cells using two Fanca+/
ES clones that were microinjected into blastocysts to generate germline chimeric mice. The Fanca
/
mice were obtained at a normal mendelian ratio after intercrossing of Fanca+/
mice (M.Digweed and Z.-Q.Wang, unpublished data). To carry out the following studies, we isolated ear fibroblast cells from wild-type and Fanca
/
mice. Fanca
/
fibroblasts were devoid of the Fanca protein as determined by western blotting and immunoprecipitation (Figure 1D).
Compromised DNA damage response and increased chromosome instability in Fanca-null cells
To test the biological consequences of Fanca deletion, we performed colony survival assay using Fanca-null mutant fibroblasts. Fibroblast cells were plated at 250 cells/10 cm culture dish and treated with various doses of MMC. After 10 days of growth, we found that the number of colonies of Fanca
/
cells was greatly reduced compared with that of wild-type controls (Figure 2A). Because chromosome instability is a hallmark of FA lymphocytes and fibroblasts (34,35), we next investigated, using mouse Fanca-null cells, the instrumental role of Fanca deficiency in chromosome aberrations. We found a very large increase of spontaneous chromatid breaks, translocations and other chromosome aberrations in Fanca
/
cells compared with controls. These chromosomal aberrations were significantly elevated in Fanca
/
cells after MMC treatment (Figure 2B). This hypersensitivity of Fance-null cells is consistent with the characteristics of the FA phenotype and indicates a defect in the repair of DNA lesions.
|
Because FANCA interacts with BRCA1 (17) and the FA complex is important in the DNA damage response (2), we next investigated whether Fanca deletion would affect the accumulation of DSB repair molecules after MMC treatment. While 70% of wild-type cells contained Brca1 foci, only 51% of Fanca
/
cells showed foci formation after MMC treatment (Figure 2C). We also found that the population positive for Rad51 foci was always lower in Fanca
/
cells than that of wild-type cells (Figure 2D). These results suggest that the recruitment of DNA repair molecules to the DSBs is attenuated in the absence of Fanca. It has been shown that monoubiquitinated FANCD2 colocalizes with RAD51 and BRCA1 in nuclear foci as a response to DNA damage, and Fanca is in the core complex upstream of the Fancd2 pathway (2), we next tested whether the inactivation of Fanca would affect the modification of Fancd2. As expected, after treatment with MMC and hydroxyurea (HU), the monoubiquitination of Fancd2 was induced in wild-type cells. However, Fancd2 monoubiquitination was not detectable in Fanca-null cells (Figure 2E). These data are consistent with the notion that Fanca is important in response to DNA damage by modulating the Fancd2 pathway, and suggest a role for Fanca in the repair of DSBs.
Deficient gene-targeting efficiency in Fanca-null ES cells
The gene-targeting efficiency is a surrogate marker reflecting the relevant homologous recombination activity at a cellular level. To investigate the effect of Fanca depletion on the gene-targeting efficiency, a gene-targeting vector hprt-DRGFP (27) was electroporated into two ES cell clones of wild-type (W1, W2) and Fanca
/
(H1, C8) genotype. The gene-targeting efficiency to the hprt locus (i.e. homologous versus total integration) is significantly reduced in Fanca
/
ES cells compared with wild-type cells (Table I), suggesting that the disruption of Fanca compromises homologous recombination leading to reduced gene-targeting efficiency.
|
Compromised HDR in Fanca-null fibroblast cells
To investigate the role of Fanca in DSB repair, we transfected the fluorescence-based reporter substrate (DRGFP) (29) into wild-type and Fanca
/
fibroblasts and isolated clones containing a single intact copy of DRGFP analysed by Southern blotting (Figure 3A and B). In order to minimize sources of variability, at least seven independent clones of each genotype were used in the recombination assay. In the presence of I-SceI, a 3-fold reduction of GFP-positive cells (
0.5%) was observed in Fanca
/
cells compared with wild-type cells (
1.5% GFP-positive cells) (Figure 3C and D). As expected, we found almost no GFP-positive cells in mock-vector (without the I-SceI gene)-transfected populations for both genotypes (Figure 3C). Moreover, a comparable transfection efficiency with I-SceI expression plasmids was observed for wild-type and Fanca
/
fibroblast cells as examined by transfection with a GFP-expressing plasmid (data not shown). The decreased number of the GFP-positive Fanca-null cells suggests that HDR of genomic DSBs is impaired in the absence of Fanca.
|
The SSA pathway is particularly affected in Fanca-null cells
We next dissected the recombination repair pathways of I-SceI-induced DSBs. In the reporter system used here, either HDR or NHEJ can repair the DSB generated at the I-SceI site (Figure 4A). Pathways of HDR are STGC, LTGC or SSA (Figure 4A). Only the STGC-HDR pathway will restore a functional GFP; SSA and LTGC will cause homologous deletion, resulting in a non-functional GFP; NHEJ may undergo precise or imprecise pathways (Figure 4A). The repair of a DSB via STGC, SSA, LTGC or imprecise NHEJ causes I-SceI-site loss and therefore resistance to endonuclease I-SceI. In contrast, SSA and LTGC generate a BcgI site that replaces the I-SceI site in the substrate, rendering sensitivity to BcgI. We amplified by PCR a DNA fragment containing the original location of the I-SceI site from the genome of mock (without the I-SceI gene) or I-SceI-transfected ES cells and digested these PCR products with I-SceI or BcgI. While similar proportions of I-SceI-site loss (
3035% of PCR products) were detected in both wild-type and Fanca
/
cells (Figure 4B), the relative amount of BcgI-site gain, indicative of STGC, SSA or LTGC, were significantly reduced to 1215% in Fanca
/
cells compared with 2325% in wild-type cells (Figure 4C). These results indicate that the ablation of Fanca affects repair of DSBs by HDR pathways.
|
We further analysed the status of SSA after the repair of DSBs induced by I-SceI in Fanca
/
cells by PCR amplification using the primer set (SAF and SA-R2), and compared these PCR products with PCR products generated through STGC and NHEJ and uncut substrate DRGFP (using primers SAF and SA-R1) (Figure 4A). SSA generated products were significantly reduced in Fanca
/
cells compared with wild-type cells (Figure 5A and B). As a control, Brca2/Fancd1-null Chinese hamster ovary cells displayed an elevated SSA activity (Figure 5A and B), consistent with previous observations (36). To test the potential contribution of LTGC, also measured by PCR with primers SAF and SA-R2, to the authentic SSA events, we grew cells in the presence of puromycin after DSBs repair, which would eliminate cells which had undergone SSA and lost the puromycin resistant gene (Figure 4A). To this end, we used one primer set (SAF and SA-R2) that would solely amplify the regions around the BcgI site via LTGC after puromycin drug selection, and another primer set (SAF and SA-R1) as an internal control (Figure 4A). In this assay, we hardly detected any products from PCR amplifications using primers SAF and SA-R2 (data not shown), ruling out a significant contribution of the LTGC event to the putative SSA product shown in Figure 5A. Taken together, the absence of Fanca reduces HDR mainly in the SSA pathway, whereas the deletion of Brca2/Fancd1 seems to enhance SSA.
|
| Discussion |
|---|
|
|
|---|
Studies using human FA cells and mutant chicken DT40 cells have suggested a role for various FA proteins in the repair of DSBs. The present study, using mouse Fanca-null cells, identifies Fanca for the first time as an integral component in the biological response cascade of DNA DSBs by promoting both HDR and, particularly, SSA, pathways. The present study ties the FANCA protein to an early step in the homologous recombination repair process.
FA patients show a high heterogeneity in genetic background and mutations in the FANCA gene range from intragenic deletion, protein truncation to null mutation. Because intragenic deletion in the region of exons 3739 has been detected in FA patients, we generated cells with a corresponding disruption at the C-terminus of the Fanca gene. Western-blot analysis confirmed the complete absence of the Fanca protein in these cells. Using newly engineered Fanca-null mouse cells, the present study shows direct genetic evidence for a role of the FA complex in HDR repair of DSBs in mammalian cells. The homologous repair defects in Fanca mutant cells are most likely to be responsible for chromosomal instability phenotype (chromatid breaks and chromosome fusions) observed in FA cells as well as in our Fanca knock-out cells. There are several putative mechanisms by which Fanca may participate in HDR. Fanca may modulate the recruitment of molecules that are operative in DSB repair or signaling to DSB sites. It has been shown that FANCA is required for a stable, functioning core complex and thus for monoubiquitination of FANCD2 and only the monoubiquitinated form of FANCD2 is able to co-localize with BRCA1 and RAD51 (13,22). In this regard, we found that Fanca is required for monoubiquitination of Fancd2 and that the foci formation of Rad51 and Brca1 at DNA breaks was reduced in Fanca-null murine cells. These findings are consistent with previous studies showing attenuated recruitment of BRCA1 and RAD51 to nuclear foci in human FA cells (FANCA/C/G) (37,38). It is possible that Fanca is involved in homologues repair directly through its interaction with Brca1 (17). Moreover, Fanca may serve as a docking point at DSB sites for the assembly of component of the BRCA1-associated complex, such as BRCA1 and RAD51. Finally, Fanca may be involved in the initial detection of DSBs. In this regard, it is worth noting that FANCD2 interacts with NBS1 in DNA damage response (21) and delayed Mre11 foci formation has been found in FANCC/G cells after MMC treatment (37). A recent study also shows that ATR couples FANCD2 monoubiquitination to the DNA-damage response (39). Interestingly, we also found that
-H2Ax foci formation was down-regulated in Fanca-null cells (data not shown).
The gene conversion pathway repairs DSBs by retrieving genetic information from an intact homologue (sister chromatid or homologous chromosome), through strand exchange. As an alternative homology-dependent DSB repair pathway, SSA events may cause deletions of certain sequences (error prone) (40). SSA and gene conversion have some common characteristics, as they both use single-stranded DNA as a common intermediate and share components, such as RAD52 (40). We show that the absence of Fanca abolished ubiquitination of the downstream effector of the FA complex, Fancd2 and that the repair products through the SSA pathway are specifically low in Fanca-null cells, which contributes to the overall HDR deficiency. These data are in agreement with observations in human FA cells showing that the FA complex and FANCAD2 ubiquitination are involved in SSA and HDR (41). Therefore, although the reduction of the SSA pathway (error prone) would have caused less genomic instability, the general defects in HDR are most probably responsible for the chromosomal instability phenotype of FA cells. Taken together, our data place the FA pathway in the early step of HDR of DSBs. These findings also suggest that DNA strand resection is one step that could be regulated by the FA pathway, given the importance of single strands as substrates for both gene conversion and SSA.
While global DSB repair by HDR is predominant in lower eukaryotes, e.g. yeast, higher eukaryotic cells have evolved multiple pathways to repair DNA DSB lesions, namely by NHEJ and HDR (42). FA cells, which are defective in SSA, are unable to fine-tune their choice of the HDR pathways and may use NHEJ more extensively, and this may increase the frequency of chromosome aberrations and mutation rates leading to neoplasia.
| Supplementary material |
|---|
|
|
|---|
Supplementary material is available online at: http://carcin.oxfordjournals.org/
| Acknowledgments |
|---|
We thank Dr Dieter Rietmacher for the pTV-Flox vector, Dr Fre Arwert for the anti-Fanca antibodies, Dr David M.Livingston for the mouse monoclonal anti-BRCA1 antibody, Dr Alan D.D'Andrea for the anti-FANCD2 rabbit antibody E35. We are also grateful to Janina Radszweski, Susanne Rothe, Srinivas Patnaik and Cuenin Cyrille for excellent technical assistance. This work was supported by the Fritz-Thyssen-Stiftung and the Association pour la Recherche sur le Cancer (ARC).
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Fanconi,G. (1967) Familial constitutional panmyelocytopathy, Fanconi's anemia (F.A.). I. Clinical aspects. Semin. Hematol., 4, 233240.[Medline]
- D'Andrea,A.D. and Grompe,M. (2003) The Fanconi anaemia/BRCA pathway. Nat. Rev. Cancer, 3, 2334.[CrossRef][Web of Science][Medline]
- Sasaki,M.S. and Tonomura,A. (1973) A high susceptiblity of Fanconi's anemia to chromosome breakage by DNA cross linking agents. Cancer Res., 33, 18291836.
[Abstract/Free Full Text] - Ishida,R. and Buchwald,M. (1982) Susceptibility of Fanconi's anemia lymphoblasts to DNA-cross-linking and alkylating agents. Cancer Res., 42, 40004006.
[Abstract/Free Full Text] - Joenje,H. and Patel,K.J. (2001) The emerging genetic and molecular basis of Fanconi anaemia. Nat. Rev. Genet., 2, 446457.[CrossRef][Web of Science][Medline]
- Meetei,A.R., Levitus,M., Xue,Y. et al. (2004) X-linked inheritance of Fanconi anemia complementation group B. Nat. Genet., 36, 12191224.[CrossRef][Web of Science][Medline]
- Rothfuss,A. and Grompe,M. (2004) Repair kinetics of genomic interstrand DNA cross-links: evidence for DNA double-strand break-dependent activation of the Fanconi anemia/BRCA pathway. Mol. Cell. Biol., 24, 123134.
[Abstract/Free Full Text] - Akkari,Y.M., Bateman,R.L., Reifsteck,C.A., Olson,S.B. and Grompe,M. (2000) DNA replication is required to elicit cellular responses to psoralen-induced DNA interstrand cross-links. Mol. Cell. Biol., 20, 82838289.
[Abstract/Free Full Text] - Dronkert,M.L. and Kanaar,R. (2001) Repair of DNA interstrand cross-links. Mutat. Res., 486, 217247.[Web of Science][Medline]
- Donahue,S.L. and Campbell,C. (2002) A DNA double strand break repair defect in Fanconi anemia fibroblasts. J. Biol. Chem., 277, 4624346247.
[Abstract/Free Full Text] - Digweed,M. (2003) Response to environmental carcinogens in DNA repair deficient disorders. Toxicology, 193, 111124.[CrossRef][Web of Science][Medline]
- Meetei,A.R., de Winter,J.P., Medhurst,A.L. et al. (2003) A novel ubiquitin ligase is deficient in Fanconi anemia. Nat. Genet., 35, 165170.[CrossRef][Web of Science][Medline]
- Garcia-Higuera,I., Taniguchi,T., Ganesan,S., Meyn,M.S., Timmers,C., Hejna,J., Grompe,M. and D'Andrea,A.D. (2001) Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol. Cell, 7, 249262.[CrossRef][Web of Science][Medline]
- Moynahan,M.E., Pierce,A.J. and Jasin,M. (2001) BRCA2 is required for homology-directed repair of chromosomal breaks. Mol. Cell, 7, 263272.[CrossRef][Web of Science][Medline]
- Davies,A.A., Masson,J.Y., McIlwraith,M.J., Stasiak,A.Z., Stasiak,A., Venkitaraman,A.R. and West,S.C. (2001) Role of BRCA2 in control of the RAD51 recombination and DNA repair protein. Mol. Cell, 7, 273282.[CrossRef][Web of Science][Medline]
- Yang,H., Jeffrey,P.D., Miller,J., Kinnucan,E., Sun,Y., Thoma,N.H., Zheng,N., Chen,P.L., Lee,W.H. and Pavletich,N.P. (2002) BRCA2 function in DNA binding and recombination from a BRCA2-DSS1-ssDNA structure. Science, 297, 18371848.
[Abstract/Free Full Text] - Folias,A., Matkovic,M., Bruun,D., Reid,S., Hejna,J., Grompe,M., D'Andrea,A. and Moses,R. (2002) BRCA1 interacts directly with the Fanconi anemia protein FANCA. Hum. Mol. Genet., 11, 25912597.
[Abstract/Free Full Text] - Hussain,S., Wilson,J.B., Medhurst,A.L. et al. (2004) Direct interaction of FANCD2 with BRCA2 in DNA damage response pathways. Hum. Mol. Genet., 13, 12411248.
[Abstract/Free Full Text] - Hussain,S., Witt,E., Huber,P.A., Medhurst,A.L., Ashworth,A. and Mathew,C.G. (2003) Direct interaction of the Fanconi anaemia protein FANCG with BRCA2/FANCD1. Hum. Mol. Genet., 12, 25032510.
[Abstract/Free Full Text] - Wang,X., Andreassen,P.R. and D'Andrea,A.D. (2004) Functional interaction of monoubiquitinated FANCD2 and BRCA2/FANCD1 in chromatin. Mol. Cell. Biol., 24, 58505862.
[Abstract/Free Full Text] - Nakanishi,K., Taniguchi,T., Ranganathan,V., New,H.V., Moreau,L.A., Stotsky,M., Mathew,C.G., Kastan,M.B., Weaver,D.T. and D'Andrea,A.D. (2002) Interaction of FANCD2 and NBS1 in the DNA damage response. Nat. Cell Biol., 4, 913920.[CrossRef][Web of Science][Medline]
- Taniguchi,T., Garcia-Higuera,I., Andreassen,P.R., Gregory,R.C., Grompe,M. and D'Andrea,A.D. (2002) S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood, 100, 24142420.
[Abstract/Free Full Text] - Yamamoto,K., Ishiai,M., Matsushita,N., Arakawa,H., Lamerdin,J.E., Buerstedde,J.M., Tanimoto,M., Harada,M., Thompson,L.H. and Takata,M. (2003) Fanconi anemia FANCG protein in mitigating radiation- and enzyme-induced DNA double-strand breaks by homologous recombination in vertebrate cells. Mol. Cell. Biol., 23, 54215430.
[Abstract/Free Full Text] - Niedzwiedz,W., Mosedale,G., Johnson,M., Ong,C.Y., Pace,P. and Patel,K.J. (2004) The Fanconi anaemia gene FANCC promotes homologous recombination and error-prone DNA repair. Mol. Cell, 15, 607620.[CrossRef][Web of Science][Medline]
- Yamamoto,K., Hirano,S., Ishiai,M. et al. (2005) Fanconi anemia protein FANCD2 promotes immunoglobulin gene conversion and DNA repair through a mechanism related to homologous recombination. Mol. Cell. Biol., 25, 3443.
[Abstract/Free Full Text] - Mostoslavsky,R., Singh,N., Tenzen,T. et al. (2001) Asynchronous replication and allelic exclusion in the immune system. Nature, 414, 221225.[CrossRef][Medline]
- Pierce,A.J., Hu,P., Han,M., Ellis,N. and Jasin,M. (2001) Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev., 15, 32373242.
[Abstract/Free Full Text] - Yang,Y.G., Cortes,U., Patnaik,S., Jasin,M. and Wang,Z.Q. (2004) Ablation of PARP-1 does not interfere with the repair of DNA double-strand breaks, but compromises the reactivation of stalled replication forks. Oncogene, 23, 38723882.[CrossRef][Web of Science][Medline]
- Pierce,A.J., Johnson,R.D., Thompson,L.H. and Jasin,M. (1999) XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev., 13, 26332638.
[Abstract/Free Full Text] - van de Vrugt,H.J., Cheng,N.C., de Vries,Y., Rooimans,M.A., de Groot,J., Scheper,R.J., Zhi,Y., Hoatlin,M.E., Joenje,H. and Arwert,F. (2000) Cloning and characterization of the murine Fanconi anemia group A gene: Fanca protein is expressed in lymphoid tissues, testis and ovary. Mamm. Genome, 11, 326331.[CrossRef][Web of Science][Medline]
- Cheng,N.C., van de Vrugt,H.J., van der Valk,M.A., Oostra,A.B., Krimpenfort,P., de Vries,Y., Joenje,H., Berns,A. and Arwert,F. (2000) Mice with a targeted disruption of the Fanconi anemia homolog Fanca. Hum. Mol. Genet., 9, 18051811.
[Abstract/Free Full Text] - Noll,M., Battaile,K.P., Bateman,R., Lax,T.P., Rathbun,K., Reifsteck,C., Bagby,G., Finegold,M., Olson,S. and Grompe,M. (2002) Fanconi anemia group A and C double-mutant mice: functional evidence for a multi-protein Fanconi anemia complex. Exp. Hematol., 30, 679688.[CrossRef][Web of Science][Medline]
- Wong,J.C., Alon,N., Mckerlie,C., Huang,J.R., Meyn,M.S. and Buchwald,M. (2003) Targeted disruption of exons 1 to 6 of the Fanconi anemia group A gene leads to growth retardation, strain-specific microphthalmia, meiotic defects and primordial germ cell hypoplasia. Hum. Mol. Genet., 12, 20632076.
[Abstract/Free Full Text] - Bigelow,S.B., Rary,J.M. and Bender,M.A. (1979) G2 chromosomal radiosensitivity in Fanconi's anemia. Mutat. Res., 63, 189199.[CrossRef][Web of Science][Medline]
- Heddle,J.A., Lue,C.B., Saunders,E.F. and Benz,R.D. (1978) Sensitivity to five mutagens in Fanconi's anemia as measured by the micronucleus method. Cancer Res., 38, 29832988.
[Abstract/Free Full Text] - Stark,J.M., Pierce,A.J., Oh,J., Pastink,A. and Jasin,M. (2004) Genetic steps of mammalian homologous repair with distinct mutagenic consequences. Mol. Cell. Biol., 24, 93059316.
[Abstract/Free Full Text] - Pichierri,P., Averbeck,D. and Rosselli,F. (2002) DNA cross-link-dependent RAD50/MRE11/NBS1 subnuclear assembly requires the Fanconi anemia C protein. Hum. Mol. Genet., 11, 25312546.
[Abstract/Free Full Text] - Digweed,M., Rothe,S., Demuth,I., Scholz,R., Schindler,D., Stumm,M., Grompe,M., Jordan,A. and Sperling,K. (2002) Attenuation of the formation of DNA-repair foci containing RAD51 in Fanconi anaemia. Carcinogenesis, 23, 11211126.
[Abstract/Free Full Text] - Andreassen,P.R., D'Andrea,A.D. and Taniguchi,T. (2004) ATR couples FANCD2 monoubiquitination to the DNA-damage response. Genes Dev., 18, 19581963.
[Abstract/Free Full Text] - Dudas,A. and Chovanec,M. (2004) DNA double-strand break repair by homologous recombination. Mutat. Res., 566, 131167.[CrossRef][Web of Science][Medline]
- Nakanishi,K., Yang,Y.G., Pierce,A.J., Taniguchi,T., Digweed,M., D'Andrea,A.D., Wang,Z.Q. and Jasin,M. (2005) Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair. Proc. Natl Acad. Sci. USA, 102, 11101115.
[Abstract/Free Full Text] - West,S.C. (2003) Molecular views of recombination proteins and their control. Nat. Rev. Mol. Cell Biol., 4, 435445.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Michiels, A. Laplanche, T. Boulet, P. Dessen, B. Guillonneau, A. Mejean, F. Desgrandchamps, M. Lathrop, A. Sarasin, and S. Benhamou Genetic polymorphisms in 85 DNA repair genes and bladder cancer risk Carcinogenesis, May 1, 2009; 30(5): 763 - 768. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Fan, F. Zhang, B. Barrett, K. Ren, and P. R. Andreassen A role for monoubiquitinated FANCD2 at telomeres in ALT cells Nucleic Acids Res., April 1, 2009; 37(6): 1740 - 1754. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kitao, K. Yamamoto, N. Matsushita, M. Ohzeki, M. Ishiai, and M. Takata Functional Interplay between BRCA2/FancD1 and FancC in DNA Repair J. Biol. Chem., July 28, 2006; 281(30): 21312 - 21320. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhu and A. Dutta An ATR- and BRCA1-Mediated Fanconi Anemia Pathway Is Required for Activating the G2/M Checkpoint and DNA Damage Repair upon Rereplication Mol. Cell. Biol., June 15, 2006; 26(12): 4601 - 4611. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Taniguchi and A. D. D'Andrea Molecular pathogenesis of Fanconi anemia: recent progress Blood, June 1, 2006; 107(11): 4223 - 4233. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Kennedy and A. D. D'Andrea The Fanconi Anemia/BRCA pathway: new faces in the crowd Genes & Dev., December 15, 2005; 19(24): 2925 - 2940. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










