Carcinogenesis Advance Access originally published online on May 19, 2005
Carcinogenesis 2005 26(10):1741-1747; doi:10.1093/carcin/bgi126
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.26 no.10 © Oxford University Press 2005; all rights reserved.
Roles of tumor suppressor and telomere maintenance genes in cancer and agingan epidemiological study
Department of Epidemiology and 1 Department of Urology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX, USA
* To whom correspondence should be addressed. Tel: +1 713 745 2485; Fax: +1 713 792 4657 Email: xwu{at}mdanderson.org
| Abstract |
|---|
|
|
|---|
Advanced age is strikingly linked to increased incidence of cancer. To gain insight into the mechanism underlying the association between increased cancer incidence and aging in normal human physiological conditions, we used a case-control design and measured the mRNA expression levels of p53, ATM, hTERT and TRF2, the four major protectors of genomic integrity, in isolated peripheral blood lymphocytes from 202 confirmed bladder cancer (BC) patients and 199 healthy controls. Significant age effects on expression levels were observed. When we divided the study subjects into three age groups (<57, 5765 and
65), the expressions of p53, ATM and TRF2 significantly decreased with advancing age in cases (P for trend
0.001, 0.01 and 0.01 for p53, ATM and TRF2, respectively). In controls, however, p53 expression significantly increased with advancing age (P for trend = 0.05). Among subjects
65 years of age, the expressions of p53, ATM and TRF2 were significantly lower in cases than in controls (P = 0.003, 0.04 and 0.05 for p53, ATM and TRF2, respectively), suggesting that attenuated genomic maintenance mechanisms lead to increased cancer risk in older individuals. When we dichotomized our study population at the median age of study subjects (61 years old), low p53 expression was associated with a significantly increased BC risk in older people (OR = 2.27, 95% CI = 1.005.16). In addition, older subjects without detectable hTERT expression had a significantly reduced BC risk (OR = 0.41, 95% CI = 0.170.99). Our study provides the first epidemiologic evidence that the increased genomic instability resulting from the combination of telomere dysfunction, impaired ATM- and p53-mediated DNA damage, and/or telomere dysfunction response pathway contributes to increased cancer incidence in the elderly population.
Abbreviations: BC, bladder cancer; FP, forward primer; RP, reverse primer
| Introduction |
|---|
|
|
|---|
In the US, cancer is the second leading cause of death after heart disease. The majority of cancers affect older people disproportionately. According to the NCI Surveillance, Epidemiology and End Results (SEER) program data for 19951999, close to 60% of all newly diagnosed malignant tumors and 71% of all cancer deaths occur in persons
65 years of age. The age-adjusted cancer incidence rate for this age group is 10 times greater than the rate for persons under 65 years. It is apparent, therefore, that aging is a major risk factor for cancer. Although the reason for the connection between increased cancer risk and aging is not well understood, it is becoming increasingly clear that cancer and aging are connected in several ways at the cellular and molecular levels. Genomic instability is considered a major causal factor for both cancer and aging. Age-related accumulation of somatic DNA mutationswhich may activate and/or inactivate specific genes involved in key cellular functions such as DNA repair, apoptosis and cell cycle controlis likely a major contributing factor for the increased cancer incidence with age. Evidence from animal studies and human genetics research suggests that tumor suppressor genes may also play distinct roles in the mammalian aging process. Tumor suppressor genes can be generally grouped into two classes: caretakers, which act to protect the genome from damage and mutation, and gatekeepers, which function to prevent the proliferation of potential cancer cells by inducing either cellular senescence or apoptosis (1). Proteins encoded by caretaker genes include all major DNA repair pathway components, such as ATM (DSB repair), the XP family (NER), the RecQ family of DNA helicases (WRN, BLM, etc.) and telomere maintenance proteins. Caretaker genes mostly function to protect the organism from cancer and slow the aging process. Therefore, increased cancer incidence and premature aging usually accompany many human genetic diseases that result from defects in caretaker genes, such as ataxiatelangiectasia (AT, ATM mutation), xeroderma pigmentosum (XP gene mutation) and Werner's syndrome (WRN mutation). In contrast, gatekeeper genes, the most prominent of which is p53, may contribute directly to the aging process. It is well known that p53 is the most mutated gene in human cancers, p53 deficiency favors cancer development and forced overexpression of wild-type p53 elicits strong anti-cancer effects by inducing cell cycle arrest and/or apoptosis. Owing to two surprising findings, the study of p53's role in the aging process is receiving increasing attention. Tyner et al. (2) and Maier et al. (3) independently created two different lines of transgenic mice with hyperactive p53 alleles. Despite the strong cancer resistance of these mice, both lines displayed shortened life spans and accelerated aging phenotypes, thus providing support for the antagonistic pleiotropy theory of aging (4). Antagonistic pleiotropy has been used to explain how genetic traits can have both beneficial and deleterious effects on a species (4). By virtue of its conference of protection against cancer at the cost of accelerated aging, p53 may qualify as an antagonistic pleiotropic trait. Many studies, from in vivo animal models and in vitro cell culture, have shown that aberrant gene expressions play significant roles in both cancer and aging. However, data from these studies may not be fully extrapolative to normal human aging in vivo. Welle et al. (5) found that only about one-third of genes showed similar age-related change in expression in mice and humans. For in vitro cultured human cells, growth conditions may affect gene expression profoundly. In this bladder cancer (BC) casecontrol study, we used real-time PCR to measure the expression of four critical genomic maintenance genes in non-cultured peripheral blood lymphocytes directly isolated from 202 confirmed BC patients and 199 healthy controls. We selected p53, ATM, hTERT and TRF2 for analysis because evidence suggests that the ATM-p53-telomere axis plays a key role in both aging and cancer (6,7). ATM is a caretaker gene mutated in the autosomal recessive disorder ataxiatelangiectasia, which is characterized by progressive neurological degeneration, growth retardation, accelerated telomere shortening, genomic instability, premature aging and increased risk of cancer (8). hTERT is the rate-limiting catalytic subunit of telomerase. TRF2 is a major telomere maintenance protein that protects chromosome ends by maintaining the correct structure and repressing chromosome end-to-end fusion. We hypothesize that there might be deficient expressions of critical genomic maintenance genes in elderly people, which predispose them to BC. Our aim was to evaluate gene expression variations in cancer and aging under normal physiological conditions and gain insight into the potential mechanism of increased cancer incidence in elderly people. The relatively large sample size allows us to perform stratified analysis and determine the expression pattern of these critical genes in different age groups among cancer patients and controls.
| Materials and methods |
|---|
|
|
|---|
Study population
For the study, 202 newly diagnosed, histologically confirmed BC patients were recruited from The University of Texas MD Anderson Cancer Center and the Methodist Hospital (Houston, TX) between 1999 and 2002. These patients had been diagnosed within 1 year of recruitment and had not received chemotherapy, radiotherapy and immune therapy before enrollment. There were no age, gender, ethnicity or tumor stage restrictions. 199 control subjects with no prior history of cancer (except non-melanoma skin cancer) were recruited from Kelsey Seybold, the largest multi-specialty managed-care physician group in the Houston metropolitan area. Control subjects were matched to the case patients by age (±5 years), sex and ethnicity. Informed consent was obtained from all study participants before the collection of epidemiological data by trained MD Anderson staff interviewers. Data were collected on demographics, smoking history, alcohol consumption, family history of cancer, medical history, and occupational history and exposures.
Sample collection
Blood samples were collected before any treatment. Immediately after the interview, a 40 ml sample of blood from each participant was collected into heparinized tubes. The tubes were first coded with a unique identification number to ensure that laboratory personnel were blinded to casecontrol status and then transported immediately to the laboratory where the specimens were processed. Lymphocytes were isolated by FicollHypaque centrifugation and aliquots of 4 x 106 isolated lymphocytes per vial were stored in liquid nitrogen as described previously (9).
RNA isolation
Total RNA was isolated from lymphocytes using the micro-column-based E.Z.N.A. RNA kit (Omega Bio-Tek, Doraville, GA) according to the manufacturer's protocol. The kit utilizes the reversible binding property of RNA to HiBind matrix, a silica-based material. Briefly, 4 x 106 isolated lymphocytes were lysed in 400 µl lysis buffer and mixed with 400 µl 70% ethanol; then, the mixtures were applied onto HiBind RNA spin columns. After two rounds of column-washing with washing buffers, total RNA was eluted with 50 µl DEPC-treated water.
Quantitative real-time RTPCR
Quantitative real-time RTPCR was performed with a two-step procedure. In the RT step, 200 ng of total RNA per sample was reverse transcribed into cDNA using the MultiScribe reverse transcriptase (Applied Biosystems, Foster City, CA). Each reaction (20 µl) contained total RNA, 10x RT buffer (2 µl); 200 µM each of dATP, dCTP, dGTP and dUTP; 5 mM MgCl2; 2.5 U of MultiScribe reverse transcriptase; 1 U of RNase inhibitor, and 2.5 µM of the random hexamer. The reaction occurred at 42°C for 30 min, 99°C for 5 min and 4°C for 5 min. An aliquot of 2 µl of RT product from each sample was used for each gene in the subsequent quantitative real-time PCR amplification. The probes and primers used for real-time RTPCR were designed using the Primer Express software (version 2.0; Applied Biosystems). To avoid amplification of the contaminating residual genomic DNA, the probe and primer sets for each gene were designed around the junction region of two exons so that they were mRNA-specific. The sequences of primers and probes are as follows: p53, forward primer (FP): CCTATGGAAACTACTTCCTGAAAACAA, reverse primer (RP): ACAGCATCAAATCATCCATTGC, Probe: TCTGTCCCCCTTGCCGTCCCA; ATM, FP: TTATTTACTGGGTCAGCCTGCA, RP: GAACTATACTGGTGGTCAGTGCCA, Probe: ACCTTCATGTCCTGCAGTATGCTGTTTGACT; hTERT, FP: TGCAGAGCGACTACTCCAGCTA, RP: GAAGCCGCGGTTGAAGGT, Probe: CCCGGACCTCCATCAGAGCCAGTC; TRF2, FP: ACCAGGGCCTGTGGAAAAG, RP: GGTGGTTGGAGGATTCCGTA, Probe: CACCCAGAGAACCCGCAAGGCAG.
Human total RNA was used as a relative standard and the human GAPDH gene was used as an internal control to normalize input RNA amount, RNA quality and reverse transcription efficiency. The sequences of primers and probe for GAPDH are as follows: FP: AAGGCTGAGAACGGGAAGC, RP: GAGGGATCTCGCTCCTGGA, Probe: TGTCATCAATGGAAATCCCATCACCATC. Real-time PCR was performed using the ABI Prism 7700 Sequence Detection System according to the manufacturer's protocol. Typical amplification mixtures (25 µl) contained the sample DNA (or cDNA); 10x TaqMan buffer (2.5 µl); 200 µM of each dATP, dCTP, dGTP and 400 µM dUTP; 5 mM MgCl2; 0.65 U of AmpliTaq Gold; 0.25 U of AmpErase uracil N-glycosylase; 200 nM each primer and 100 nM probe. The thermal cycling conditions consisted of 1 cycle for 2 min at 50°C and for 10 min at 95°C, and 50 cycles for 15 s at 95°C and for 1 min at 60°C. The relative quantification values were obtained automatically based on the standard curve of human control RNA for each gene. The quantitative PCRs were performed in duplicate for each sample, and the mean was used as the relative quantification value. The tested gene expression level was then normalized to GAPDH gene expression.
Statistical analysis
Among cases and controls, smoking status was defined as follows: 100 cigarettes or more in his/her lifetime = ever-smoker; smoking cessation of at least 1 year prior to diagnosis for cases and 1 year prior to interview for controls = former. Pack-years were computed as the number of cigarettes/day divided by 20 and then multiplied by the number of years smoked. The
2-test was used to assess differences between cases and controls in the distributions of gender, ethnicity and smoking status, and the Student's t-test was used to assess differences between cases and controls for age, pack years and gene expression. Odds ratios (ORs) with 95% confidence limits were calculated as estimates of the relative risk by dichotomizing each gene expression at the 75th percentile of controls. The crude ORs were calculated by the Woolf method. The adjusted ORs were calculated by logistic regression to control for age, ethnicity and smoking status, whereever appropriate. Pearson's correlation coefficient was used to measure the correlation between the gene expression and age. The STATA statistical software (College Station, TX) was used to perform all statistical analyses for this study.
| Results |
|---|
|
|
|---|
Characteristics of the study population
A total of 202 confirmed BC cases and 199 controls were included in the current study. Owing to the small numbers of subjects from minority groups, only Caucasians were included in the data analysis (190 cases and 192 controls). Table I shows selected characteristics of the study population. The cases and controls were well matched on gender and age. As would be predicted, the cases had significantly higher percentage of current smokers (32%) than controls (9%), half of whom were never smokers.
|
mRNA expression levels in cases and controls and correlation with age
As shown in Table II, overall, there were no significant differences in levels of gene expressions by casecontrol status. However, an evident age effect on gene expressions was observed. When we divided the study subjects into three age groups (<57, 5765 and
65), the expressions of p53, ATM and TRF2 significantly decreased with advancing age in cases (P for trend
0.001, 0.01 and 0.01 for p53, ATM and TRF2, respectively). In controls, however, p53 expression significantly increased with advancing age (P for trend = 0.05). Among subjects
65 years of age, the expressions of p53 ATM and TRF2 were significantly lower in cases than in controls (P = 0.003, 0.04 and 0.05 for p53, ATM and TRF2, respectively). hTERT expression was very low and showed no obvious difference either between age groups (P for trend = 0.57) or between cases and controls in any age group. When the correlation between mRNA expression and age as a continuous variable was assessed, significant inverse correlations were observed between p53 and age (P = 0.002), ATM and age (P = 0.006) and TRF2 and age (P = 0.003) in the cases (Figure 1). The controls showed a trend of increasing p53 expression with advancing age, although the correlation did not reach statistical significance (P = 0.18), probably owing to the high heterogeneity of expression among individuals (Figure 1). We also performed multiple linear regression to further elucidate the relationship between gene expression and age while adjusting for confounding of smoking and gender. Consistent with the results obtained from the correlation analysis, multiple linear regression showed that the expression of p53, ATM and TRF2 significantly decreased with increasing age in cases (P = 0.003, 0.006 and 0.012, respectively). In controls, there was a trend of borderline significance for increasing gene expression with increasing age for p53 (P = 0.08).
|
|
mRNA expression levels in controls by smoking status and in cases by tumor stage
To evaluate the impact of important confounders on mRNA expression, we performed stratified analyses in controls by smoking status and in cases by tumor stage (Table III). There were no significant differences on mRNA levels of any of these four genes among never, former and current smokers. The cases were grouped into two categories, superficial (stages T0 and T1) and invasive (stages T2T4). There were no significant differences between these two groups in any mRNA level. We also compared the expression level in T0 and T1 stage superficial bladder cases and did not find any significant associations (data not shown). We did not have a detailed stage information in invasive cases and did not perform further analyses among this group.
|
Risk estimates based on mRNA expression
Table IV shows the association of BC risk with relative expression of the tested genes. For p53, ATM and TRF2, ORs with 95% confidence limits were calculated as estimates of the relative risk by dichotomizing each gene expression at the 75th percentile value in the controls. For hTERT, we estimated the risk based on the number of subjects without detectable mRNA expression in cases and controls because relative hTERT expression was very low in normal lymphocytes (Table II) and a substantial percentage of subjects lacked detectable hTERT mRNA (33 out of 192 in controls and 24 out of 190 in cases). Overall, although not statistically significant, low expression of p53 or ATM was associated with slightly increased BC risk (OR = 1.36 and 1.22, respectively), whereas no hTERT expression or low TRF2 expression conferred a slightly reduced BC risk (OR = 0.66 and 0.75, respectively). When we dichotomized our study population at the median age of the study subjects (61 years old), low p53 expression was associated with a significantly increased BC risk in older people (OR = 2.27, 95% CI = 1.005.16). The percentage of subjects without detectable hTERT expression in older subjects was 21.4% (22 out of 103) for controls and 10.2% (10 out of 98) for cases, indicating that older subjects without detectable hTERT expression had a significantly reduced BC risk (OR = 0.41, 95% CI = 0.170.99).
|
Correlations of mRNA expression among the four genes in cases and controls
Since all four of these genes play major roles in maintaining genomic integrity and there is an intricate functional interplay among them as reported in the literature, we assessed whether their expression levels were correlated. As shown in Table V, there were significant correlations in mRNA expressions in both controls and cases. For example, in controls, the correlation coefficients between p53 and ATM, hTERT and TRF2 were 0.40 (P < 0.001), 0.22 (P = 0.006) and 0.52 (P < 0.001), respectively; in cases, the correlation coefficients were 0.48 (P < 0.001), 0.21 (P = 0.005) and 0.62 (P < 0.001), respectively. Similarly, significant correlations among ATM, hTERT and TRF2 genes were observed in cases and controls. These data suggest that there are highly coordinated expressions in genomic maintenance genes in both healthy and disease states.
|
| Discussion |
|---|
|
|
|---|
This study yielded the following major findings: (i) p53 expression increases in controls but decreases in cases with advancing age, and low p53 expression confers a 2.3-fold increased BC risk in older subjects; (ii) there were concomitant reductions of p53, ATM and TRF2 expressions with advancing age in cancer patients; (iii) the expressions of p53, ATM, hTERT and TRF2 were significantly correlated in both normal and cancer states; (iv) a lack of detectable hTERT expression in older age is associated with a 59% reduced risk of BC cancer.
Cancer is a disease of aging and is increasing in magnitude as people live longer. Compelling evidence has shown that imperfect genome maintenance of DNA damage is partly responsible for aging (10,11). Experimental and epidemiological data consistently demonstrate that DNA repair capacity declines with increased age (1214). On the other hand, numerous phenotypic assays have also shown that deficient DNA repair capacity and genomic instability confer higher cancer risk (9,15). Therefore, a deficient genome maintenance mechanism might be an important contributor to increased cancer incidences in an aged population. Defects in p53, ATM and TRF2genes that maintain genomic integrityultimately cause cancer. p53 is the most prominent genomic guardian gene and plays a pivotal role in many critical cellular events related to human aging and cancer, including DNA damage, apoptosis, cell cycle control, telomere shortening and oxidative stress (16). ATM is a central player in DNA repair and checkpoint activation, which upon activation by double strand breaks, phosphorylates a plethora of downstream target proteins and promotes cell cycle arrest and DNA repair. TRF2 is a sequence-specific DNA binding protein that protects telomere termini and represses chromosome end-to-end fusion in cultured primary cells. The correlation of advancing age in cancer patients with the reduced expression of these three genesp53, ATM and TRF2acting in distinct genome maintenance pathways strongly suggests that compromised DNA repair and/or genotoxic attack response contribute to increased cancer incidence in elderly people.
A few recent studies showed that mRNA expression level of DNA repair or methylation-related gene in peripheral blood lymphocytes is associated with altered cancer risk. For example, reduced expression of mismatch repair genes and nucleotide excision repair genes confers significantly increased risk for head and neck cancer (17,18). Increased expression of MBD2, a gene involved in transcriptional repression and methylation, was associated with a significantly reduced BC risk (19). In this study, we found a significant lower expression of genomic maintenance genes in patients than in controls among individuals >65 years of age, suggesting that reduced mRNA expression in genomic maintenance genes is a predisposing factor for BC in elderly people. Biologically, decreased gene expression involved in DNA repair pathway is an important mechanism for age-related reduction in DNA repair capacity (13,14). It should be pointed out that mRNA level in peripheral blood lymphocytes is a cross-sectional measurement and may be affected by many factors, such as host characteristics, smoking status, disease stage and therapy. In this regard, a couple of studies showed that the mRNA levels of DNA repair genes were relatively consistent within an individual over a period of 1 year in peripheral blood cells from healthy controls (20,21). The inter-person variation is far larger than the intra-person variation, supporting the use of mRNA expression as potential biomarkers (20,21). We attempted to address these limitations by evaluating the impact of smoking status and tumor stage on the expression of these genes and did not find significant associations (Table III). Suzuki et al. (22) reported that Fas, Bcl-2 and p53 expressions in PBLs were not significantly different between normal individuals with chronic cigarette smoking and those without smoking. Nevertheless, mRNA expression is an intermediate event, which might be affected by genetic or environmental factors as well as disease process; therefore, a causeeffect relationship between reduced mRNA expression and increased cancer risk cannot be drawn from the descriptive data reported in this cross-sectional study.
Telomeres and telomerase clearly have implications for both cancer and aging (2325). Telomere maintenance is essential for the protection of chromosome ends and genome integrity. Telomere dysfunction, including shortening in length or structural changes, has been shown to contribute to cancer and aging. Increased hTERT expression leading to telomerase activation is one of the most common features of human cancer: over 80% of all human cancers showed increased telomerase activities (26,27). The decline of telomere length with age in peripheral blood cells has also been reported (28). Recently Wu et al. have shown that telomere length in peripheral blood cells from cancer patients is significantly shorter than those in healthy controls (9). In this study, we found that the expression of hTERT is consistently low in cases and controls, and a substantial percentage of subjects have no detectable hTERT expression. However, we found that compared with elderly patients, significantly more elderly controls had no detectable hTERT expression (10.2% versus 21.4% for patients and controls, respectively), which is consistent with many previous studies showing increased hTERT detection in the peripheral blood from cancer patients. The increase in hTERT detection in elderly cancer patients is likely a response of telomere shortening. The decline of TRF2 expression coupled with advancing age in cases, telomere dysfunction resulting from both telomere shortening and telomere structure disruption may play significant roles in predisposing elderly people to cancer.
hTERT and TRF2 are arguably the two most critical components in telomere maintenance. p53 and ATM are two of the most critical players in telomere dysfunction-mediated cellular response pathways. Telomere shortening activates p53 and results in growth arrest and/or apoptosis. Deletion of p53 significantly attenuates the adverse effects of telomere attrition and, in conjunction with telomere dysfunction, accelerates carcinogenesis (6). Herbig et al. (29) showed that telomere shortening triggers senescence of human cells through the ATM-p53-p21 pathway. ATM deficiency and telomere loss act together to impair cellular and whole-organism viability and accelerates aging in double knockout mice (7). Telomere structure disruption by a dominant-negative TRF2 allele and the ensuing de-protection of telomeres result in apoptosis via activation of the ATM and p53 DNA damage response pathway (30). These highly intertwined functional interactions among p53, ATM, TRF2 and hTERT may explain their correlated expressions observed in this study. This association in both cases and controls suggests that genomic maintenance genes act in concert to protect cells against genotoxic attacks and that genome-wide deficiency in DNA damage response and genetic integrity may account for the increased cancer risk in the aged population.
In conclusion, this is the largest epidemiologic study to examine the roles of genomic maintenance genes in cancer by measuring expression levels of the genes. Our study suggests that the increased genomic instability resulting from the combination of telomere dysfunction and impaired ATM- and p53-mediated DNA damage and/or telomere dysfunction response pathway contributes to the increased cancer incidence in the elderly.
| Supplementary material |
|---|
|
|
|---|
Supplementary material is available online at: http://carcin.oxfordjournals.org/
| Acknowledgments |
|---|
This study was supported by the NCI grants CA 74880 and CA 91846.
Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Campisi,J. (2003) Cancer and ageing: rival demons? Nat. Rev. Cancer, 3, 339349.[CrossRef][ISI][Medline]
- Tyner,S.D., Venkatachalam,S., Choi,J. et al. (2002) p53 mutant mice that display early ageing-associated phenotypes. Nature, 415, 4553.[CrossRef][Medline]
- Maier,B., Gluba,W., Bernier,B., Turner,T., Mohammad,K., Guise,T., Sutherland,A., Thorner,M. and Scrable,H. (2004) Modulation of mammalian life span by the short isoform of p53. Genes Dev., 18, 306319.
[Abstract/Free Full Text] - Kirkwood,T.B. and Austad,S.N. (2004) Why do we age? Nature, 408, 233238.
- Welle,S., Brooks,A. and Thornton,C.A. (2001) Senescence-related changes in gene expression in muscle: similarities and differences between mice and men. Physiol. Genomics, 5, 6773.
[Abstract/Free Full Text] - Chin,L., Artandi,S.E., Shen,Q., Tam,A., Lee,S.L., Gottlieb,G.J., Greider,C.W. and DePinho,R.A. (1999) p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis. Cell, 97, 527538.[CrossRef][ISI][Medline]
- Wong,K.K., Maser,R.S., Bachoo,R.M., Menon,J., Carrasco,D.R., Gu,Y., Alt,F.W. and DePinho,R.A. (2003) Telomere dysfunction and Atm deficiency compromises organ homeostasis and accelerates ageing. Nature, 421, 643648.[CrossRef][Medline]
- Shiloh,Y. and Kastan,M.B. (2001) ATM: genome stability, neuronal development, and cancer cross paths. Adv. Cancer Res., 83, 209254.[ISI][Medline]
- Wu,X., Amos,C.I., Zhu,Y., Zhao,H., Grossman,B.H., Shay,J.W., Luo,S., Hong,W.K. and Spitz,M.R. (2003) Telomere dysfunction: a potential cancer predisposition factor. J. Natl Cancer. Inst., 95, 12111218.
[Abstract/Free Full Text] - Hasty,P. and Vijg,J. (2003) Genomic priorities in aging. Science, 296, 12501251.
- de Boer,J., Andressoo,J.O., de Wit,J. et al. (2002) Premature aging in mice deficient in DNA repair and transcription. Science, 296, 12761279.
[Abstract/Free Full Text] - Wei,Q., Matanoski,G.M., Farmer,E.R., Hedayati,M.A. and Grossman,L. (1993) DNA repair and aging in basal cell carcinoma: a molecular epidemiology study. Proc. Natl Acad. Sci. USA, 90, 16141618.
[Abstract/Free Full Text] - Goukassian,D., Gad,F., Yaar,M., Eller,M.S., Nehal,U.S. and Gilchrest,B.A. (2000) Mechanisms and implications of the age-associated decrease in, DNA repair capacity. FASEB J., 14, 13251334.
[Abstract/Free Full Text] - Takahashi,Y., Moriwaki,S., Sugiyama,Y., Endo,Y., Yamazaki,K., Mori,T., Takigawa,M. and Inoue,S. (2005) Decreased gene expression responsible for post-ultraviolet, DNA repair synthesis in aging: a possible mechanism of age-related reduction in DNA repair capacity. J. Invest. Dermatol., 124, 435442.[CrossRef][ISI]
- Berwick,M. and Vineis,P. (2000) Markers of, DNA repair and susceptibility to cancer in humans: an epidemiologic review. J. Natl Cancer Inst., 92, 874897.
[Abstract/Free Full Text] - Sharpless,N.E. and DePinho,R.A. (2002) p53: good cop/bad cop. Cell, 110, 912.[CrossRef][ISI][Medline]
- Cheng,L., Sturgis,E.M., Eicher,S.A., Spitz,M.R. and Wei,Q. (2002) Expression of nucleotide excision repair genes and the risk for squamous cell carcinoma of the head and neck. Cancer, 94, 393397.[CrossRef][ISI][Medline]
- Wei,Q., Eicher,S.A., Guan,Y., Cheng,L., Xu,J., Young,L.N., Saunders,K.C., Jiang,H., Hong,W.K., Spitz,M.R. and Strom,S.S. (1998) Reduced expression of hMLH1 and hGTBP/hMSH6: a risk factor for head and neck cancer. Cancer Epidemiol. Biomarkers Prev., 7, 309314.[Abstract]
- Zhu,Y., Spitz,M.R., Zhang,H., Grossman,H.B., Frazier,M.L. and Wu,X. (2004) Methyl-CpG-binding domain 2: a protective role in bladder carcinoma. Cancer, 100, 18531858.[CrossRef][ISI][Medline]
- Vogel,U., Moller,P., Dragsted,L., Loft,S., Pedersen,A. and Sandstrom,B. (2002) Inter-individual variation, seasonal variation and close correlation of, OGG1 and, ERCC1 mRNA levels in full blood from healthy volunteers. Carcinogenesis, 23, 15051509.
[Abstract/Free Full Text] - Hanaoka,T., Yamano,Y., Hashimoto,H., Kagawa,J. and Tsugane,S. (2000) A preliminary evaluation of intra- and interindividual variations of hOGG1 messenger, RNA levels in peripheral blood cells as determined by a real-time polymerase chain reaction technique. Cancer Epidemiol. Biomarkers Prev., 9, 12551258.
[Abstract/Free Full Text] - Suzuki,N., Wakisaka,S., Takeba,Y., Mihara,S. and Sakane,T. (1999) Effects of cigarette smoking on Fas/Fas ligand expression of human lymphocytes. Cell. Immunol., 192, 4853.[CrossRef][ISI][Medline]
- Shay,J.W. and Wright,W.E. (2001) Telomeres and telomerase: implications for cancer and aging. Radiat. Res., 155, 188193.[CrossRef][ISI][Medline]
- Kim, Sh,S.H., Kaminker,P. and Campisi,J. (2002) Telomeres, aging and cancer: in search of a happy ending. Oncogene, 21, 503511.[CrossRef][ISI][Medline]
- Sharpless,N.E. and DePinho,R.A. (2004) Telomeres, stem cells, senescence, and cancer. J. Clin. Invest., 113, 160168.[CrossRef][ISI][Medline]
- Kim,N.W., Piatyszek,M.A., Prowse,K.R., Harley,C.B., West,M.D., Ho,P.L., Coviello,G.M., Wright,W.E., Weinrich,S.L. and Shay,J.W. (1994) Specific association of human telomerase activity with immortal cells and cancer. Science, 266, 20112015.
[Abstract/Free Full Text] - Shay,J.W. and Bacchetti,S. (1997) A survey of telomerase activity in human cancer. Eur. J. Cancer, 33, 787791.[CrossRef][ISI][Medline]
- Weng,N.P., Levine,B.L., June,C.H. and Hodes,R.J. (1995) Human naive and memory T lymphocytes differ in telomeric length and replicative potential. Proc. Natl Acad. Sci. USA, 92, 1109111094.
[Abstract/Free Full Text] - Herbig,U., Jobling,W.A., Chen,B.P., Chen,D.J. and Sedivy,J.M. (2004) Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a). Mol. Cell, 14, 501513.[CrossRef][ISI][Medline]
- Karlseder,J., Broccoli,D., Dai,Y., Hardy,S. and de Lange,T. (1999) p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science, 283, 13211325.
[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
W. Wang, M. R. Spitz, H. Yang, C. Lu, D. J. Stewart, and X. Wu Genetic Variants in Cell Cycle Control Pathway Confer Susceptibility to Lung Cancer Clin. Cancer Res., October 1, 2007; 13(19): 5974 - 5981. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. P. Kodavanti, M. C. Schladweiler, A. D. Ledbetter, R. V. Ortuno, M. Suffia, P. Evansky, J. H. Richards, R. H. Jaskot, R. Thomas, E. Karoly, et al. The Spontaneously Hypertensive Rat: An Experimental Model of Sulfur Dioxide-Induced Airways Disease Toxicol. Sci., November 1, 2006; 94(1): 193 - 205. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


