Carcinogenesis Advance Access originally published online on June 15, 2005
Carcinogenesis 2005 26(11):1934-1939; doi:10.1093/carcin/bgi154
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carcinogenesis vol.26 no.11 © Oxford University Press 2005; all rights reserved.
The extract of huanglian, a medicinal herb, induces cell growth arrest and apoptosis by upregulation of interferon-ß and TNF-
in human breast cancer cells
Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA and 1 Dana Farber Cancer Institute, Harvard Medical School, Boston, MA 02115, USA
* To whom correspondence and reprints should be addressed at: Massachusetts General Hospital, Room 4433, 149 13th Street, Charlestown, MA 02129, USA. Tel: +1 617 726 8509; Fax: +1 617 726 6144; Email: kang.jing{at}mgh.harvard.edu
| Abstract |
|---|
|
|
|---|
Huanglian (Coptidis rhizoma), a widely used herb in traditional Chinese medicine, has been shown recently to possess anticancer activities. However, the molecular mechanism underlying the anticancer effect of the herb is poorly understood. Specifically, whether huanglian extract affects the expression of cancer-related genes has not been defined. This study used DNA microarray technology to examine the effect of the herbal extract on expression of the common genes involved in carcinogenesis in two human breast cancer cell lines, the ER-positive MCF-7 and ER-negative MDA-MB-231 cells. Treatment of the cancer cells with huanglian extract markedly inhibited their proliferation in a dose- and time-dependent manner. The growth inhibitory effect was much more profound in MCF-7 cell line than that in MDA-MB-231 cells. DNA microarray assay revealed that treatment with huanglian dramatically increased the mRNA expression of interferon-ß (IFN-ß) and tumor necrosis factor-
in MCF-7 cells. Quantitative analysis by real-time PCR or western blotting confirmed the upregulation of the two genes (especially IFN-ß) in MCF-7 cells, but not in MDA-MB-231 cells. Addition of neutralizing antibody against IFN-ß to culture medium markedly inhibited the huanglian-induced antiproliferative effect, confirming the involvement of IFN-ß in the huanglian's effect and also suggesting an autocrine pathway for the action of IFN-ß in this setting. Given that IFN-ß is among the most important anticancer cytokines, the upregulation of this gene by huanglian is, at least in part, responsible for its antiproliferative effect. The results of this study implicate huanglian as a promising herb for chemoprevention and chemotherapy of certain cancers.
Abbreviations: IFN-ß, interferon-ß; TNF-
, tumor necrosis factor-
| Introduction |
|---|
|
|
|---|
The use of herbal intervention is widespread in all regions of the developing world, and is rapidly growing in industrialized countries (1,2). Despite broad use, there are insufficient scientific data on the safety and efficacy of herbal therapies. Some herbs have been shown to possess anticancer activities, but how they work is poorly understood. Lack of scientific evidence showing the molecular pathways of their action diminishes their clinical utility. Therefore, basic research aimed at elucidating the mechanisms of action underlying the herbal effects should have a high priority.
Regardless of peripheral mediators, the behavior of a cell is ultimately dictated by its genetic profile. Thus, investigating changes in gene expression profiles as a result of herbal treatment may help define the underlying mechanisms of action and validate the efficacy of these anticancer herbs. Microarrays have emerged as invaluable tools in characterization and examination of gene expression (3,4). This technology allows monitoring gene expression of hundreds and thousands of genes simultaneously. Thus, it is possible to generate more comprehensive data on changes that occur within a cell as a result of treatment, and identify specific signaling pathways activated by the treatment.
Huanglian (Coptidis rhizoma) is a herb that is widely used in traditional Chinese medicine as an antimicrobial in the treatment of dysentery, gastroenteritis as well as other inflammatory conditions, such as pneumonia and infection of the head and face (5). Recent studies have shown that huanglian extract and its major component, berberine, possess anticancer activities, as indicated by their abilities to inhibit cell growth and induce apoptosis in several different cancer cell lines (613). Despite these reports, huanglian's role as an anticancer agent has not been established. To identify potential anticancer pathways for huanglian in human breast cancer, we examined the molecular effects of this herb in two breast cancer cell lines using a DNA microarray technology. We found that upregulation of the two anticancer cytokines, interferon-ß (IFN-ß) and tumor necrosis factor-
(TNF-
), may be responsible for the potent antiproliferative effect of huanglian in MCF-7 cancer cells.
| Materials and methods |
|---|
|
|
|---|
Cell lines
The human breast cancer cell lines MCF-7 and MDA-MB-231 were purchased from the American Type Culture Collection. The cells were maintained in DMEM/F-12 supplemented with 10% fetal bovine serum (FBS), penicillin and streptomycin at 37°C in a humidified atmosphere containing 5% CO2. The media was changed every other day.
Preparation of herbal extracts
Huanglian (C.rhizoma) powder was made from Coptis japonica Makino by boiling in water followed by spray-drying and provided by Tigen Herb (Boston, MA). The powder was first dissolved in 70% ethanol and subsequently diluted in 35% ethanol at a stock concentration of 10 mg/ml. The mixture was vortexed rigorously for 2 min followed by 5 min sonication. After centrifugation (2000 g, 10 min), the supernatant was collected and stored at 20°C until use. For treatment, a range of 0.32 µl was added to 1 ml of culture medium.
Assessment of cell growth inhibition induced by huanglian
Cell proliferation was assessed by using the MTT assay as described previously (14). Cells were plated at 3 x 103/50 µl in 96-well plates in DMEM/F12 with 10% FBS and allowed to attach overnight. Then the medium was removed and replaced with fresh medium with or without varying concentrations (2.5, 5 and 10 µg/ml) of huanglian extract. At different time points (24, 48 and 72 h) after exposure to huanglian, the number of viable cells in each well was estimated by adding 10 µl of MTT solution. Following 4 h of incubation at 37°C, the stain was diluted with 100 µl of dimethyl sulfoxide. The optical densities were quantified at a test wavelength of 550 nm and a reference wavelength of 630 nm using a multi-well spectrophotometer. Results were calculated as the percentage of unexposed control cultures.
Assay of cell apoptosis induced by huanglian
Apoptotic cells were detected using an Annexin-V Apoptosis Assay Kit (Molecular Probe, Eugene, Oregon) following the manufacturer's instructions. After 72 h of treatment with huanglian, cells were incubated briefly with FITC-Annexin-V and propidium iodide, and dead cells were identified under fluorescence microscope. The results were compared between control cells and huanglian-treated cells.
Flow cytometry analysis of cell cycle and apoptosis
For cell cycle analysis, MCF-7 cells (2.0 x 106 ) were synchronized by serum starvation for 24 h followed by re-feeding serum and treating with 5.0 µg/ml of huanglian for 24 h. For apoptosis analysis, cells were treated with 10 µg/ml of huanglian for 72 h. The adhered and floating cells were harvested and washed twice with phosphate-buffered saline, and fixed in 100% ethanol. The cells were stained with 50 µg/ml propidium iodide solution containing 1 mg/ml RNase and 0.1% NP40, then analyzed by FACScan (Becton Dickson, Mountain View, CA) using CellQuest software.
Microarray assay of gene expression
Total RNA was extracted using an RNeasy Mini kit (Qiagen, Valencia, CA) from cells treated with or without huanglian according to the protocol suggested by the manufacturer. Concentration and purity of extracted RNA were determined using a Shimadzu UV1600 spectrophotometer (Shimadzu, Kyoto, Japan). The quality of RNA was checked by the 1% agarose gel electrophoresis. Total RNA (5 µg) was used for synthesis of cDNA probe following the manufacturer's protocol. Microarray assay was carried out by using the low-density oligonucleotide arrays, Human Cancer Pathway Finder Gene Array, that contains 96 cancer-related genes (SupperArray Biosci., Frederick, MD). Hybridization was performed according to the manufacturer's instructions. Hybridized arrays were scanned with a HP ScannJet. The images were quantified using the imaging software GeArray Analyzer from SuperArray, and a smoothed T-value cutoff of 2.0 was used.
Real-time quantitative RTPCR
Oligonucleotide primers were designed using the Primer Express software (Applied Biosystems, Foster City, CA) and synthesized by Invitrogen (Carlsbad, CA). Forward primers (5'3'): AACTGCAACCTTTCGAAGCC, CACCACTTCGAAACCTGGGA and TCCTGCACCA CCAACTGCTTAG for IFN-ß, TNF-
and GAPDH, respectively. Reverse primers (5'3'): TGTCGCCTACTACCTGTTGTGC, CAATTCACTGTGCAGGCCAC and GGCATGGACTGTGG TCATGAGT for IFN-ß, TNF-
and GAPDH, respectively. The fluorescent dye SYBR green was ordered from Stratagene (La Jolla, CA). GAPDH gene was used as an endogenous control to normalize the expression of these genes. Quantitative real-time RTPCR was performed in triplicate using a 96-well optic tray on an ABI Prism 7000 sequence detection system (Applied Biosystems). The negative controls lacking template RNA were included in each experiment. PCR products were then run on a 1% agarose gel in order to confirm the presence of a single band with the expected size. Data collection and analysis was performed with SDS version 1.7 software (Applied Biosystems). Data were then exported and further analyzed in Excel. Results, expressed as N-fold differences in target gene expression relative to the control gene, termed N, were determined by the formula: N = 2
Ctsample, where
Ct value of the sample was determined by subtracting the average Ct value of the target gene from the average Ct value of the control gene. All Ct values of the samples were normalized by human GAPGH.
Western blotting analysis
The proteins of cell extracts from treated and non-treated cells were prepared using an M-PER Mammalian Protein Extraction Reagent (Pierce, Rockford, IL) and fractionated by SDSPAGE. Approximately 10 µg of cell lysate proteins for each sample were loaded onto the mini gel. Separated proteins were transferred to blot membranes. The protein blots were first probed with a rabbit polyclonal anti-human IFN-ß antibody (Calbiochem, CA) and then with goat-anti-rabbit antibody conjugated with horseradish peroxidase (Bio-Rad, CA). The signals were detected by enhanced chemiluminescence (Renaissance, NEN Life Science Products, Boston, MA). Mouse monoclonal antibody specific to human ß-actin was used as a control antibody to normalize the quantity of protein loaded. Image was scanned with hp Scanjet 5550c, and signal intensity of each band was quantified using HIN Image analysis.
Antibody neutralizing assay
Equal number of cells were plated into each well of a 6-well plate and allowed to attach overnight. Then the medium was removed and replaced with fresh medium with (4 wells) or without (2 wells) huanglian. In the meantime, 10 µl (200 neutralization units/µl) of rabbit polyclonal anti-human IFN-ß antibody (Calbiochem) was added to 2 of the 4 wells treated with huanglian. After 48 h culture, cell growth status was examined by microscopy and cell counting. This experiment was repeated three times.
| Results |
|---|
|
|
|---|
Effect of huanglian on cell growth and apoptosis
Treatment of the breast cancer cell lines, MCF-7 and MDA-MB-231, with the extract of huanglian exhibited differential growth responses (Figure 1). In MCF-7 cells, the inhibition of cell growth by huanglian was so obvious that one could observe the difference easily under a microscope (Figure 1). This inhibitory effect was dose and time-dependent (Figure 2). A dose as low as 2.5 µg/ml was quite effective, and treatment with 10 µg/ml for 72 h could result in a 6070% inhibition (Figure 2). To test if treatment of cells with huanglian may cause cell cycle arrest, cell cycle distribution was analyzed by flow cytometry following treatment of MCF-7 cells with 5.0 µg/ml of huanglian for 24 h (Figure 3). In control cells, the percentages of cells in G0/G1, S and G2/M phases were 40.5 ± 2.4, 32.9 ± 2.1 and 28.6 ± 2.0, respectively. After 24 h of incubation with huanglian, the percentage of cells in G0/G1 increased to 64.3 ± 2.5% (P < 0.001), whereas the cells in S and G2/M phase decreased to 17.0 ± 0.4 (P < 0.001) and 18.7 ± 2.0 (P < 0.005), respectively. These results suggest that huanglian may induce cell cycle arrest at G0/G1 phase.
|
|
|
In addition, cell death (apoptosis) was also apparent, as indicated by the increased number of Annexine-V stained cells (green cells), in the MCF-7 cells treated with huanglian (Figure 4). Quantitative analysis by flow cytometry showed that treatment of MCF-7 cells with 10 µg/ml huanglian for 72 h resulted in 35.6 ± 9.5% apoptotic cells (Figure 5). In contrast, MDA-MB-231 cells were much less sensitive to the herb as the growth inhibition by 10 µg/ml of huanglian for 72 h was only 2030% and very few apoptotic cells were found. Interestingly, the major component of huanglian, berberine, was not as effective as the whole extract of huanglian in both the cell lines (data not shown).
|
|
Effect of huanglian on the expression of cancer-related genes
To identify the molecular mechanism (gene expression) underlying the observed growth-inhibitory effect of huanglian, we utilized the SuperArray's low density DNA chips to profile the expression of 96 cancer-related genes in the control and huanglian-treated cells. Figure 6 is a representative set of array results. As shown clearly, two genes that encode the anticancer cytokines, IFN-ß and TNF-
, were strikingly upregulated in the MCF-7 cells treated with huanglian. This change was confirmed by real-time PCR. As shown in Table I, there is a large difference in PCR cycle between the control and treated MCF-7 cells. Statistic analysis of the PCR data from five assays revealed
200-fold increase in IFN-ß expression and a 17-fold upregulation of TNF-
(Table I). In addition, the results of western blot analysis indicated an increased amount of cellular IFN protein in the MCF-7 cells treated with huanglian (Figure 7). (Note that this assay measured only the amount of IFN-ß retained inside the cells, but not that of IFN secreted to medium.) These changes in gene expression (IFN-ß and TNF-2) were not observed in MDA-MB-231 cells.
|
|
|
Effect of neutralizing anti-IFN antibody on the huanglian-induced growth inhibition
The data reported above have clearly shown that huanglian increases the synthesis of IFN-ß in MCF-7 cells. Next, we verified if the increased production of the cytokine was primarily responsible for the growth-inhibitory effect of huanglian. It could be the case that the cytokine synthesized in the cancer cells would be released to culture medium and then bind to their receptors on cell surface, leading to cell growth arrest and apoptosis (an autocrine pathway). To test this hypothesis, we added a neutralizing anti-IFN-ß antibody to culture medium to see if it could attenuate the effect of huanglian. As shown in Figure 8, addition of an antibody against human IFN-ß to culture medium largely blocked the huanglian-induced growth inhibition. Cells treated with huanglian alone (10 µg/ml for 48 h) showed almost no cell proliferation or colony formation, whereas cells treated with huanglian plus the anti-IFN-ß antibody exhibited a growth pattern similar to that of control cells (Figure 8). Cell counting showed that the number of viable cells in the samples treated with huanglian and in the samples treated with huanglian plus antibody were 45 ± 5% and 85 ± 8% of the cells in control samples, respectively (Figure 8). These results clearly indicate that IFN-ß indeed mediates the growth inhibitory effect of huanglian extract.
|
| Discussion |
|---|
|
|
|---|
The data presented here demonstrate that huanglian extract is highly effective in inhibiting cell proliferation and inducing apoptotic cell death in MCF-7 breast cancer cells. The observed anticancer effects of the herbal extract result mainly from its ability to enhance the expression of two anticancer cytokines, IFN-ß and TNF-
(especially IFN-ß), as evidenced by the increased levels of mRNA and protein of these cytokines in the cells treated with the herbal extract. The upregulated cytokines act through an autocrine pathway to induce cell growth arrest and apoptosis, as indicated by the fact that addition of a neutralizing antibody against IFN-ß to culture medium could significantly attenuate the growth inhibitory effect of huanglian extract. Thus, the results of this study provide evidence for the anticancer activity of huanglian and, more importantly, the molecular basis for its effect.
Our results showed that the two breast cancer cell lines MCF-7 (estrogen receptor positive) and MDA-MB-231 (estrogen receptor negative) responded to the herbal treatment differently. The MDA-MB-231 cells did not increase the synthesis of IFN-ß and TNF-
in response to huanglian treatment and, accordingly, exhibited a much smaller degree of growth arrest and apoptosis when compared with the MCF-7 cells. This phenomenon supports the notion that the upregulation of IFN-ß and TNF-
is probably the mechanism underlying the growth inhibitory effect of huanglian in this particular cell type. The differential responses of the two cell lines also raise a question as to whether estrogen receptor is involved in or essential for the action of huanglian. Future study on this subject matter and experiments to elucidate the whole signal transduction pathway for huanglian are warranted.
The extract of huanglian contains several components (15). Berberine is known to be the dominant one (7,15). In this study, we found that purified berberine was significantly less effective than the whole huanglian extract. Similar results have been reported previously by others (7,8). This indicates that there are constituents in the herb other than berberine that are critical for its growth inhibitory effect. In this context, it seems better to develop the whole herbal extract, rather than its dominant components, for cancer therapy. Nevertheless, identification and characterization of the active components present in the whole extract of huanglian is needed.
Both INF-ß and TNF-
are the important cytokines that regulate cell growth and death (1619). The biological effects of these cytokines have been investigated extensively over the last decades. The anticancer activity of INF-ß has been well recognized (1619), whereas TNF-
plays a paradoxical role in carcinogenesis (20). It is well known that IFN-ß can inhibit cell growth and kill cancer cells. Thus, enhancing the production of IFN-ß in cancer cells seems to be an effective anticancer mechanism and the identification of compounds that have such a property should be a new direction of cancer drug development. Our finding that huanglian is highly effective in enhancing synthesis of IFN-ß in MCF-7 cancer cells provides a molecular basis for huanglian as a promising anticancer agent. Although huanglian has been previously shown to alter expression of some genes in several different cancer cell lines (7,8), the present study is the first to show upregulation by huanglian of the two anticancer cytokines, IFN-ß and TNF-
, in human cancer cells. Previously, Iizuka et al. (8) reported that use of oligonucleotide microarray identified 13 various genes whose levels of expression were correlated with the ID50 values of both berberine and C.rhizoma in pancreatic cancer cell lines. Li et al. (7) found that huanglian extract suppressed the expression of cyclin B1 in a human gastric cancer cell line (MKN-74). It is possible that the genetic effects of huanglian are different in different cell types. Whether the effect of huanglian on cytokine expression also occurs in non-cancer cells are now under investigation in our laboratory.
Since IFN and TNF are also potent immunomodulators and play critical roles in treatment of certain infections, the finding of the present study that huanglian can enhance the expression of these two cytokines (especially IFN) might provide an explanation for the use of huanglian as a key herb to treat infectious conditions in Chinese medicine.
A full understanding of molecular effect (i.e. gene expression) of a herb is very important for evaluation of its efficacy as well as safety (side effect). Microarray technology seems to be quite helpful in this regard. DNA chip studies may help identifying compounds with novel therapeutic effect and clarify the roles of various compounds of herbs in the physiological activity. Our strategy, as used in the present study, could serve as a framework to study medicinal herbs.
Huanglian has been widely used in China for several thousand years, mainly, for the treatment of infectious conditions. This herb has been shown to be quite safe for human consumption (21). This advantage plus the emerging evidence of its anticancer effects make huanglian a very promising candidate for being an effective and safe anticancer agent.
| Acknowledgments |
|---|
This study was supported by the Starr Foundation and the American Cancer Society (RSG-03-140-01-CNE to J.X.K.). F.P.L. is a Harry and Elisa Jiler American Cancer Society clinical research professor. Conflict of Interest Statement: None declared.
| References |
|---|
|
|
|---|
- Eisenberg,D.M., Kessler,R.C., Foster,C., Norlock,F.E., Calkins,D.R. and Delbanco,T.L. (1993) Unconventional medicine in the United States: prevalence, costs, and patterns of use. N. Engl. J. Med., 328, 246252.
[Abstract/Free Full Text] - Cassileth,B.R. (1995) Alternative and complementary medicine. Cancer, 86, 19001902.
- Schena,M., Shalon,D., Davis,R.W. and Brown,P.O. (1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science, 270, 467470.
[Abstract/Free Full Text] - DeRisi,J., Penland,L., Brown,P.O., Bittner,M.L., Meltzer,P.S., Ray,M., Chen,Y., Su,Y.A. and Trent,J.M. (1996) Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat. Genet., 14, 457460.[CrossRef][Web of Science][Medline]
- Franzblau,S.G. and Cross,C. (1986) Comparative in vitro antimicrobial activity of Chinese medicinal herbs. J. Ethnopharmacol., 15, 279288.[CrossRef][Web of Science][Medline]
- Iizuka,N., Miyamoto,K., Okita,K., Tangoku,A., Hayashi,H., Yosino,S., Abe,T., Morioka,T., Hazama,S. and Oka,M. (2000) Inhibitory effect of Coptidis rhizoma and berberine on the proliferation of human esophageal cancer cell lines. Cancer Lett., 148, 1925.[CrossRef][Web of Science][Medline]
- Li,X.K., Motwani,M., Tong,W., Bornmann,W. and Schwartz,G.K. (2000) Huanglian, a Chinese herbal extract, inhibits cell growth by suppressing the expression of cyclin B1 and inhibiting CDC2 kinase activity in human cancer cells. Mol. Pharmacol., 58, 12871293.
- Iizuka,N., Oka,M., Yamamoto,K., Tangoku,A., Miyamoto,K., Miyamoto,T., Uchimura,S., Hamamoto,Y. and Okita,K. (2003) Identification of common or distinct genes related to antitumor activities of a medicinal herb and its major component by oligonucleotide microarray. Int. J. Cancer, 107, 666672.[CrossRef][Web of Science][Medline]
- Iizuka,N., Miyamoto,K., Hazama,S., Yoshino,S., Yoshimura,K., Okita,K., Fukumoto,T., Yamamoto,S., Tangoku,A. and Oka,M. (2000) Anticachectic effects of Coptidis rhizoma, an anti-inflammatory herb, on esophageal cancer cells that produce interleukin 6. Cancer Lett., 158, 3541.[CrossRef][Web of Science][Medline]
- Iizuka,N., Hazama,S., Yoshimura,K., Yoshino,S., Tangoku,A., Miyamoto,K., Okita,K. and Oka,M. (2002) Anticachectic effects of the natural herb Coptidis rhizoma and berberine on mice bearing colon 26/clone 20 adenocarcinoma. Int. J. Cancer, 99, 286291.[CrossRef][Web of Science][Medline]
- Fukutake,M., Yokota,S., Kawamura,H., Iizuka,A., Amagaya,S., Fukuda,K. and Komatsu,Y. (1998) Inhibitory effect of Coptidis rhizoma and Scutellariae radix on azoxymethane-induced aberrant crypt foci formation in rat colon. Biol. Pharmacol. Bull., 21, 814817.
- Lin,H.L., Liu,T.Y., Wu,C.W. and Chi,C.W. (1999) Berberine modulates expression of mdr1 gene product and the responses of digestive track cancer cells to paclitaxel. Br. J. Cancer, 81, 416422.[CrossRef][Web of Science][Medline]
- Wu,H.L., Hsu,C.Y., Liu,W.H. and Yung,B.Y. (1999) Berberine-induced apoptosis of human leukemia HL-60 cells is associated with down-regulation of nucleophosmin/B23 and telomerase activity. Int. J. Cancer, 81, 923929.[CrossRef][Web of Science][Medline]
- Chen, Z., Ge,Y., Landman,N. and Kang,J.X. (2002) Decreased expression of the mannose 6-phosphate/insulin-like growth factor-II receptor promotes growth of human breast cancer cells. BMC Cancer, 2, 18.[CrossRef][Medline]
- Fang,X.P., Wang,T.Z., Shang,H., Shuai,H., Li,D. and Xie,C.K. (1989) Quantitative determination of 5 alkaloids in plants of coptis from China. Chung Kuo Yao Tsa Chih, 14, 3335.
- Repetto,L., Venturino,A., Simoni,C., Rosso,M., Melioli,G. and Rosso,R. (1993) Interferons in the treatment of advanced breast cancer. J. Biol. Regul. Homeost. Agents, 7, 109114.[Web of Science][Medline]
- Brierley,M.M. and Fish,E.N. (2002) Review: IFN-alpha/beta receptor interactions to biologic outcomes: understanding the circuitry. J. Interferon Cytokine Res., 22, 835845.[CrossRef][Web of Science][Medline]
- Rosfjord,E.C. and Dickson,R.B. (1999) Growth factors, apoptosis, and survival of mammary epithelial cells. J. Mammary Gland Biol. Neoplasia, 4, 229237.[CrossRef][Web of Science][Medline]
- Iqbal Ahmed,C.M. and Johnson,H.M. (2003) Interferon gene therapy for the treatment of cancer and viral infections. Drugs Today, 39, 763766.
- Anderson,G.M., Nakada,M.T. and DeWitte,M. (2004) Tumor necrosis factor-alpha in the pathogenesis and treatment of cancer. Curr. Opin. Phramacol., 4, 314320.
- Qin,C.L., Liu,J.Y. and Cheng,Z.M. (1994) Pharmacological studies on the effect of huanglian decoction on experimental gastric lesions in rats and antiemetic in pigeons. Chung Kuo Chung Yao Tsa Chih, 19, 427430.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. W. Tyner, D. K. Walters, S. G. Willis, M. Luttropp, J. Oost, M. Loriaux, H. Erickson, A. S. Corbin, T. O'Hare, M. C. Heinrich, et al. RNAi screening of the tyrosine kinome identifies therapeutic targets in acute myeloid leukemia Blood, February 15, 2008; 111(4): 2238 - 2245. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







