Skip Navigation


Carcinogenesis Advance Access originally published online on December 6, 2005
Carcinogenesis 2006 27(4):729-739; doi:10.1093/carcin/bgi289
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
27/4/729    most recent
bgi289v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by McPhillips, F.
Right arrow Articles by Langdon, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McPhillips, F.
Right arrow Articles by Langdon, S. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Raf-1 is the predominant Raf isoform that mediates growth factor-stimulated growth in ovarian cancer cells

Fiona McPhillips, Peter Mullen, Kenneth G. MacLeod, Jane M. Sewell, Brett P. Monia 1, David A. Cameron, John F. Smyth and Simon P. Langdon *

Cancer Research UK Centre, University of Edinburgh, Edinburgh EH4 2XR, UK and 1 Isis Pharmaceuticals, Carlsbad, CA 92008, USA

* To whom correspondence should be addressed. Tel: +44 131 777 3537; Fax: +44 131 777 3520; Email: simon.langdon{at}cancer.org.uk


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 References
 
There is currently much interest in the role of the Raf family in cancer, particularly since mutated B-Raf has been shown to be oncogenic in certain disease types. In this study we have explored the expression, signaling and function of the three known Raf isoforms (Raf-1, A-Raf and B-Raf) in patients with ovarian cancer. While increased expression of Raf-1 was associated with poor survival, increased expression of B-Raf was associated with improved survival. Using a panel of ovarian cancer cell lines, all three isoforms were shown to be involved in growth factor initiated signaling. Antisense inhibition of function in ovarian cancer cell lines indicated that both Raf-1 and A-Raf, but not B-Raf, were linked to cell proliferation. Raf-1 (but not A-Raf or B-Raf) was also associated with reduced apoptosis. While individual Raf reduction by isoform-targeted antisense oligonucleotides (ODNs) produced growth inhibition in some cell lines, similar use of the MEK inhibitor UO126 produced growth inhibition in all cell lines tested. These data suggest that Raf-1 is the predominant Raf isoform responsible for regulating cellular growth in ovarian cancer cells and may be particularly important in high grade serous ovarian cancers.

Abbreviations: ERK, extracellular related kinase; IP, Immunoprecipitate; MBP, myelin basic protein; MEK, mitogen-activated protein (MAP)/ERK kinases; ODN, oligonucleotide; PARP, poly (Adp-ribose) polymerase; TGF{alpha}, tumor growth factor {alpha}


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 References
 
One of the key pathways regulating mammalian cell growth is the extracellular-related kinase (ERK) signal transduction pathway which transmits cell surface receptor-mediated signals to the nucleus via a cascade of specific phosphorylation events involving Ras, Raf, MEK [mitogen-activated protein (MAP)/ERK kinases] and ERK (1–3). The Raf family of serine/threonine kinases is central to this pathway and is expressed in three forms, Raf-1, A-Raf and B-Raf, which all share highly conserved N-terminal regulatory regions and a C-terminal catalytic kinase domain (4). All three Raf proteins are ubiquitously expressed, although expression levels have been reported to differ greatly depending upon the tissue type (3,5). In previous studies of animal tissues, Raf-1 exhibited highest levels in striated muscle, cerebellum and fetal brain (6), B-Raf was predominantly found in neural tissues (7) while A-Raf was expressed at higher levels not only in the epididymis and ovary (6) but also in bladder, kidney, intestine, heart, spleen, thymus and cerebellum (8).

The phenotypes of Raf knockout mice indicate the importance of all three Raf isoforms and suggest that each has distinct functions (3,5). Disruption of the Raf-1 gene results in death during gestation (9,10) or shortly after birth due to growth retardation and developmental defects (11). B-Raf knockout mice die in utero due to vascular hemorrhage caused by apoptotic death of endothelial cells (12), while elimination of A-Raf produces live pups with intestinal and neurological defects (13). All three isoforms interact with the upstream mediator, Ras, which recruits the inactive cytoplasmic Raf to the plasma membrane (14). Once recruited, Raf-1 requires phosphorylation on Tyr340, Tyr341 and Ser338 in order to become fully activated. Similarly, A-Raf requires phosphorylation on the Tyr residue corresponding to Tyr341 in Raf-1 for full functionality (14). In contrast, Ras binding alone is sufficient for B-Raf activation. B-Raf lacks the corresponding tyrosine residues of Raf-1 or A-Raf and features constitutive phosphorylation of the Ser338 residue. B-Raf may therefore be able to at least partially bypass the need for input from additional kinase signals in order to become fully activated (15). Activated Raf proteins phosphorylate and activate the MEKs, dual specificity kinases, that in turn phosphorylate and activate the ERKs (p42/p44 MAP kinases) (5). Of the three isoforms, B-Raf is the most potent MEK activator and A-Raf the weakest with Raf-1 being intermediate between the two (16).

Mutations in B-Raf have recently been identified which may have important consequences for certain cancers, especially malignant melanomas (17). Missense mutations were identified in 66% of malignant melanomas, suggesting that this pathway may have a major significance in this disease. In contrast, only 1 of 25 (4%) ovarian cancer cell lines and 5 of 35 (14%) primary ovarian cancers demonstrated the presence of such a B-Raf mutation (17). Subsequent studies suggested that the mutation was associated with low-grade serous and endometrioid ovarian carcinomas but not high-grade serous carcinomas (18). This has led to the view that activating mutations of either B-Raf or K-Ras are important for the development of low-grade serous and endometrioid tumors (18,19).

In the present study we have investigated for the first time the relative roles and functions of the individual Raf isoforms in ovarian cancer. Despite the presence of B-Raf and A-Raf and their involvement in signaling in many ovarian cancer cell lines, we demonstrate a dominant role for Raf-1 in growth regulation.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 References
 
Tumor samples
Fresh primary ovarian tumor tissue was obtained at initial debulking surgery from 53 previously untreated patients with histologically confirmed epithelial ovarian cancer. The histologies of these tumors were as follows: serous (n = 28), endometrioid (n = 18), clear cell (n = 6) and mucinous (n = 1). Immunohistology sections were prepared and tumor histology was assessed as described previously (20).

Cell lines
The ovarian cancer cell lines PEO1, PEO1CDDP, PEO4, PEO6, PEO14 and PEO16 were established within our unit (21); SKOV-3, CaOV3 and PC12 cells were obtained from the American Type Culture Collection (Manassas, VA); OVCAR-3, OVCAR-4 and OVCAR-5 were obtained from Dr T.C. Hamilton (Fox Chase Institute, Philadelphia, PA); and 41M, 59M, OAW42, A2780 and HeLa cells were obtained from the European Collection of Cell Cultures (ECACC; Porton Down, UK). All cells were routinely grown as monolayer cultures in RPMI 1640 media supplemented with 10% heat-inactivated fetal calf serum (FCS) and 100 IU/ml penicillin/streptomycin in a humidified atmosphere of 5% CO2 at 37°C. Growth inhibition experiments were set up using log-phase cells seeded into 24-well tissue culture plates (optimized around 1 x 104 in 1 ml) and the cells were incubated to reach 40–60% confluence prior to treatment.

Immunohistochemistry
Sections (3 µm) were deparaffinised and rehydrated. Endogenous peroxidase activity was blocked by incubating the sections in 3% H2O2 for 30 min. Sections were then immersed in citric acid buffer (0.005 M, pH 6.0) and microwaved for 3 x 5 min. Slides were washed in 0.05 M Tris-buffered saline (TBS; pH 7.6) and then incubated in 20% FCS/TBS for 10 min. Antibody dilutions were made up in 20% FCS/TBS as follows: anti-Raf-1 (Transduction Laboratories, Lexington, KY; R19120 [GenBank] ) at 1:10, anti B-Raf (Santa Cruz, Santa Cruz, CA; H-145) at 1:20 and anti-A-Raf (Santa Cruz; C-20) at 1:200. Sections (3 µm) were then incubated for 1.5–2 h as appropriate before being stained for 30 min with a secondary multilink antibody at a 1:20 dilution (StrAviGen Multilink kit; Biogenex, San Ramon, CA). After a further 30 min incubation with a horseradish-peroxidase (HRP)-labeled streptavidin complex (StrAviGen Multilink kit; Biogenex) diaminobenzidine tetrachloride was used as chromagen and applied for 5 min before the sections were lightly counterstained in hematoxylin, dehydrated and mounted. Negative controls for each tumor section were included by replacing the primary antibody with Tris buffer. Immunoreactive scores between 0 and 12 were generated for each sample by multiplying staining intensity (0 = negative, 1 = weak, 2 = moderate, 3 = strong) by the percentage positive cell staining (0 = 0%, 1 = 1–25%, 2 = 26–50%, 3 = 51–75% and 4 = 76–100%).

Antisense oligonucleotides
Second-generation 2'-methoxyethoxy phosphorothioate oligonucleotides (ODNs) to A-Raf (ISIS 15489; CTAAGGCACAAGGCGGGCTG), B-Raf (ISIS 15344; CTGCCTGGATGGGTGTTTTT) and Raf-1 (ISIS 13650; TCCCGCCTGTGACATGCATT) were synthesized and supplied by ISIS Pharmaceuticals (Carlsbad, CA), along with a control second-generation mismatch ODN (ISIS 16971; TCACATTGGCGCTTAGCCGT).

Antisense inhibition
Log phase cells were trypsinized and seeded into 24-well tissue culture plates (1 x 104 in 1 ml) and incubated to reach 40–60% confluence. Cells were then washed with phosphate-buffered saline (PBS) before adding 250 µl of Optimem (Gibco BRL, Paisley, UK) containing ‘Lipofectin’ (Gibco BRL; Paisley, U.K., 6 µl/ml). Antisense and random ODNs were added (50–200 nM) from 50 µM stock solutions. Cells were incubated at 37°C for 3 h, washed with PBS, replenished with RPMI (plus 10% FCS and 100 IU/ml penicillin/streptomycin) and replaced in the incubator for the remainder of the time course. Cells were trypsinized and counted at the appropriate time point using a ‘ZM’ Coulter Counter. Protein inhibition experiments were carried out as above except that the cells (2.5 x 105 in 4 ml) were plated into 60 mm diameter Petri dishes and washed with PBS (2 ml) prior to the addition of Optimem/Lipofectin/ASO (1 ml). Cells were lysed and analyzed by western blotting.

Western blotting
Cell lysates were prepared for western blotting as described previously (20). In experiments using transforming growth factor (TGF)-{alpha}, cells were incubated in media with 5% double charcoal stripped serum for 24 h before the addition of TGF{alpha} (1 nM, 5 min). Protein lysates (30 µg) were electrophoretically resolved on 10% SDS–PAGE and transferred to Immobilon-P membranes. After transfer, the membranes were blocked with 1% blocking agent (Roche, East Sussex, UK; no. 1520709) in TBS before probing overnight at 4°C with the appropriate primary antibody. Antibodies used for western blotting were as follows: anti-A-Raf (Transduction Laboratories; no. R14320 [GenBank] ) at 1:2000; anti-B-Raf F-7 (Santa Cruz; no. sc-5284) at 1:2000; anti-Raf-1 (Transduction Laboratories; no. R19120 [GenBank] ) at 1:1000; anti-ERK I/II (Cell Signaling Technology, Beverley, MA; no. 9102) at 1:1000; anti-MEK (Cell Signaling Technology; no. 9122) at 1:1000; anti-phosphoERK I/II (Cell Signaling Technology; no. 9101) at 1:1000; anti-phosphoMEK (Cell Signaling Technology; no. 9121); and anti-actin (Oncogene Research Products; Cambridge, U.K., CP01). Immunoreactive bands were detected using enhanced chemiluminescent reagents (Roche; no. 1520709) and Hyperfilm ECL (Amersham, UK). Integrated absorbance values were obtained by densitometric analysis using a gel scanner and analyzed using the Labworks gel analysis software (UVP Life Sciences, Cambridge, UK).

Raf kinase assay
A two-step assay was used to detect Raf kinase activity (22,23). Cell lysates were prepared as described for western blotting. Protein lysates (500 µg) in 300 µl lysis buffer were incubated overnight at 4°C with antibodies (1 µg) to A-Raf (Santa Cruz C-20; no. sc408), B-Raf F-7 (Santa Cruz; no. 5284) or Raf-1 (Transduction Laboratories; no. R19120 [GenBank] ), together with 15 µl of Protein A/G PLUS Agarose (Santa Cruz; no. sc2003). Immunoprecipitates (IPs) were then centrifuged and the pellet washed three times in ice-cold wash buffer [20 mM Tris–HCl (pH 7.4), 150 mM NaCl and 1% Triton X-100], followed by two further washes in ice-cold Dilution-buffer-1 [50 mM Tris–HCl (pH 7.5), 75 mM NaCl, 5 mM EGTA and 5 mM MgCl2]. Sepharose pellets were resuspended in 30 µl Dilution-buffer-2 (1 mM DTT; 1 mM NaVO3 made up in Dilution-Buffer-1) and transferred to a 96-well round-bottom microtiter plate. Reaction-mixture-A (0.1 µg MEK, 1 µg ERK, 25 mM MgCl2 and 0.25 mM ATP made up in 10 µl Dilution-buffer-2) was added to IPs to allow MEK and subsequent ERK phosphorylation. Reaction-mixture-B [11.5 µg myelin basic protein (MBP) substrate, 2 mM MgCl2, 0.25 mM ATP and [{gamma}-32P]ATP (3000 Ci/mmol, 0.2 µl] made up in 25 µl Dilution-buffer-2] was added to Reaction-mixture-A for a further 20 min and incubated to allow MBP phosphorylation. The reaction was stopped by adding SDS–PAGE sample buffer (25 µl) and the samples were run on a 12% SDS–PAGE gel before exposing them to Hyperfilm ECL overnight at –70°C. Integrated optical density (IOD) values were obtained by densitometric analysis using a gel scanner and the Labworks gel analysis software (UVP Life Sciences).

RNA extraction and measurement
RNA was extracted from the panel of 15 cell lines using commercially available TriReagentTM as per the prescribed protocol (Sigma; T-9429). Treatment with 10 U/ml DNAse 1 (Roche; no. 776785) in the presence of 40 U/ml RNAse Inhibitor (Roche; no. 799017) was followed by re-extraction using a standard phenol–chloroform extraction protocol. RNA was reverse-transcribed into single-stranded cDNA using the first strand cDNA Synthesis kit for RT–PCR (Roche; no. 143188) as described in the protocol provided. 2 µl of cDNA was analyzed by real-time PCR using a Rotorgene 2000 (Corbett Research, Cambridge, UK). Reactions included Excite 2 x Master Mix (Biogene, Cambridge, UK; Ex001), sybr green dye at a final concentration of 1:20 000 (Biogene; 1765), and forward and reverse primers at 0.4 mM. The following primer pairs were used: Raf-1, GGAGACACATGGGATTTTGG and GCTGTGAAAGGAGGACGTGT; A-Raf, ATGTTCGTCTCTGCCCTGAT and GATGGAGGAGCTCCCAAAAT; B-Raf, CATTCCGGAGGAGGTGTG and AGTTCCGTTCCCCAGAGATT; ß-actin, ACGTCGCCCTGGACTTCGAGC and GATGGAGCCGCCGATCCACACGG.

Standard curves were obtained by performing reactions with predetermined amounts of target template DNA for each primer pair. Contamination of RNA by genomic DNA was excluded by performing reactions on RNA which had not been reverse-transcribed. To assess the presence of particular exons of B-Raf, the following primer pairs were used: exons 1 and 2, GCCAGGCTGTTCAACG and GATTATGCTC-CCCACCAAAT; exons 3 and 4, CTGCATCAATGGATACCGTTAC and CTCGGACTGTAACTCCACACC; exons 8–9/10, TTCTCACCAG-TCCGTCTCCT and GTGGTTGATCCTCCATCACC; exons 8–11, CGACCAGCAGATGAAGATCA and CTCGAGTCCCGTCTACCAAG.

PARP cleavage and annexin-V apoptosis assays
SKOV-3 cells were treated with antisense ODNs as described above and apoptosis was measured using an anti-PARP [poly (Adp-ribose) polymerase] antibody (R&D systems, Minneapolis, MN; AF-800-NA). Media was decanted from flasks and transferred to 50 ml tubes to be pooled with cell extracts. Cells were washed with PBS and trypsinized, washing the flask using collected media from the respective flasks. The pooled cells and media were centrifuged at 1500 g for 5 min and resuspended in RPMI 1640 (4 ml), and a 200 µl aliquot was counted. Cells (0.8 x 106) were then taken from each tube and transferred to fresh tubes before again centrifuging and resuspending in lysis buffer (200 µl). After breaking up the pellet, all samples were sonicated for 30 s on ice and stored at –20°C until the analysis. Samples were heated at 65°C for 10 min prior to loading on 7.5% SDS–PAGE gels for western blot detection. Annexin V levels were also measured in similarly treated SKOV-3 cells using the TACS annexin V-FITC kit (R&D Systems; no. TA4638), following the prescribed protocol.

Growth assays
Cell lines were treated with the MEK inhibitors U0126 (Calbiochem, Nottingham, UK) and PD 98059 (Calbiochem). These were added 30 min prior to the addition of TGF{alpha} (1 nM). Drugs and media were replaced on Day 2, and cells were harvested on Day 5 and counted using a Coulter Counter (Coulter Electronics, Luton, UK).

Statistics
Relationships between variables were analyzed by the Student t-test and Mann–Whitney test where appropriate. Correlations were analyzed by the Pearson test. Multivariate analysis was conducted using the ‘Minitab’ software, version 12, copyright Minitab. Differences in survival were determined using the Kaplan–Meier method and groups were compared using the log-rank test.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 References
 
Association of Raf isoforms with expression and survival in ovarian cancer
Protein expression patterns of Raf-1, A-Raf and B-Raf were investigated in normal ovarian surface epithelial tissue and ovarian tumor sections, as well as granulosa cells within a developing follicle. All three protein isoforms were detectable to varying degrees in normal ovarian tissue (Figure 1A–C), granulosa cells (Figure 1E–G) and ovarian cancers (Figure 1I–K) as indicated by immunohistochemistry. Raf-1 was expressed particularly strongly in both the normal surface epithelium of the ovary and also in granulosa cells (Figure 1A and E). B-Raf not only showed a similar expression pattern in surface epithelia and granulosa cells but also demonstrated some stromal staining (Figure 1C and G). In contrast, A-Raf was only weakly expressed in the normal surface epithelium and in granulosa cells (Figure 1B) but stained strongly in the stroma (Figure 1F). Cancer sections were immunoscored with values ranging between 0 (no staining) and 12 (strong expression in >75% cells). Individual values are shown in Figure 2 for the three Raf isoforms. Expression levels of Raf-1, A-Raf and B-Raf varied in a series of 53 ovarian cancers, with increased B-Raf expression being associated with elevated levels of both Raf-1 and A-Raf (P = 0.0046 and 0.0002, respectively). In contrast, high co-expression of Raf-1 and A-Raf (P = 0.098) was not observed (Figure 2). Investigation of clinicopathological parameters indicated that while a higher level of expression of Raf-1 was more strongly associated with serous histology than other subtypes (P = 0.0345), this was not the case for either A-Raf or B-Raf (Table I). None of the Raf-1, A-Raf or B-Raf expression was associated with either tumor stage or grade of differentiation. Higher levels of Raf-1 expression were linked to poor survival for this group of cancers (P = 0.00255; log-rank test) and this was also significant (P = 0.016; log-rank test) for the high-grade serous subgroup. An association with survival was found for B-Raf (P = 0.047; log-rank test), and this was particularly prominent in the subgroup of endometrioid tumors (P = 0.001; log-rank test) where increased expression was associated with increased survival (Table II). In a multivariate analysis using all three Raf isoforms, stage, grade and histological subtype to predict survival times, only stage (P = 0.02), Raf-1 (P = 0.01) and B-Raf (P = 0.046) were significant at the 5% level using a Weibull distribution. These conclusions were not different with other distributions for survival times (data not shown): even if the Raf isoforms were split at the median values rather than the mid-points of the scale (data not shown). Multivariate analysis of the endometrioid subgroup identified both B-Raf (P = 0.011) and grade (P = 0.001) as independent predictors of outcome with high B-Raf predicting good outcome and high grade predicting bad outcome.


Figure 1
View larger version (115K):
[in this window]
[in a new window]
  		Fig. 1. Immunohistological expression of Raf-1, A-Raf and B-Raf in normal ovary and ovarian cancers. Examples of immunoreactivity are illustrated for normal ovarian surface epithelium (A–D), granulosa cells of a developing follicle (E–H) and an ovarian cancer (I–L). Sections were stained by an indirect immunoperoxidase method with antibodies directed against either Raf-1 (A, E and I), A-Raf (B, F and J), B-Raf (C, G and K) or Tris buffer as a negative control (D, H and L). Brown staining indicates immunoreactivity and hematoxylin (blue) was used as the counterstain. All photographs are of the same magnification.

 

Figure 2
View larger version (11K):
[in this window]
[in a new window]
  		Fig. 2. Co-expression of Raf isoforms in individual ovarian cancers. Raf expression was detected by an immunohistochemical method and expression scored as a value between 0 and 12 as described in Materials and methods for each tumor. Points represent immunoscores for individual cancers. B-Raf and Raf-1 were significantly associated (P = 0.0046; Pearson correlation) as was B-Raf and A-Raf (P = 0.0002; Pearson correlation) but not Raf-1 and A-Raf (P = 0.098; Pearson correlation).

 

View this table:
[in this window]
[in a new window]
  		Table I. Association of Raf isoform expression in primary ovarian cancers with clinicopathological parameters

 

View this table:
[in this window]
[in a new window]
  		Table II. Association of Raf isoforms with patient survival

 
All three Raf isoforms are both expressed and have signaling functions in ovarian cancer cell lines
To assess the signaling and functional roles of the separate isoforms, a panel of 15 ovarian cancer cell lines was investigated. All three forms of Raf were detected by western blotting in the panel of cell lines with expression levels varying from cell line to cell line, reflecting the heterogeneity observed in ovarian cancers (Figure 3A). Multiple forms of B-Raf protein have been described based on alternative splicing and these were sought within the cell lines by use of RT–PCR. Since alternative splicing can result in either loss of exons 1 and/or 2, an alternative exon 8, or a loss of exon 10 in the full length B-Raf transcript (7,24), primer pairs were designed to detect the presence of exons 1/2, alternative exons 8 and 10 in addition to a primer pair that spanned exons 3 and 4. In the 13 cell lines examined all transcripts were present indicating the presence of the full-length B-Raf transcript (data not shown).


Figure 3
View larger version (21K):
[in this window]
[in a new window]
  		Fig. 3. Raf-1, A-Raf and B-Raf protein expression and signaling activity in ovarian cancer cell lines. (A) Raf isoform expression in ovarian cancer cell lines. Protein lysates were harvested from 15 ovarian cancer cell lines and relative protein expressions of Raf-1, B-Raf and A-Raf were detected by western blot analysis. Actin levels are also shown to validate gel loading. Representative samples were from one of four independently collected sets of lysates. (B). Raf kinase activity in ovarian cancer cell lines. Lysates growing in 10% FCS/RPMI 1640 were immunoprecipitated with anti-Raf-1, B-Raf or A-Raf and subsequent immunoprecipitates incubated with MEK and ERK to phosphorylate MBP in the presence of [{gamma}-32P]ATP. PC12 rat pheochromocytoma and HeLa human cervical cancer cells were used as positive controls. Data from a representative experiment is shown.

 
To establish that Raf proteins are being activated in ovarian cancer cells, kinase activity was measured in the panel of cell lines during exponential growth (Figure 3B). A two-step Raf kinase assay in which each Raf isoform was individually immunoprecipitated and used to phosphorylate MEK, then ERK and subsequently MBP demonstrated substantial levels of Raf activity. Raf-1 activity was measurable in all cell lines, with highest levels being demonstrated by A2780 and OVCAR-4 cells. Similarly, B-Raf activity was also observed in all cell lines in the study. However, more pronounced variation was seen in levels of A-Raf activity between the cell lines, with PEO1 and OVCAR-4 cells having considerably higher levels than all other cell lines. Since PC12 cells are reported to use both Raf-1 and B-Raf for growth factor-activated signaling (25) and HeLa cells use A-Raf for signaling (26), these two cell lines were used as positive controls.

To examine the involvement of Raf-1, B-Raf and A-Raf in the transduction of growth signals in ovarian cancer systems, the panel of ovarian cancer cells were stimulated with TGF{alpha}. Confirmation that the MAPK pathway had been activated was demonstrated following the treatment in which all cell lines showed increased levels of both pMEK and pERK—examples are shown for PE04, PE014, OAW42 and SKOV-3 (Figure 4A). Increased MEK phosphorylation was generally reflected by an increase in ERK phosphorylation. Since no simple association could be observed between individual Raf isoform activities and MEK activation, it is likely that MEK activation is achieved through combinations of different isoform activities. After treatment with TGF{alpha} (1 nM; 5 min), Raf-1 activity was increased 25-fold in SKOV-3 and OAW42 cells and 10-fold in CaOV3 cells whilst no further induction of Raf-1 activity with TGF{alpha} was seen in PEO14, OVCAR-5 and 59M cells (Figure 4B and C). The remaining cell lines demonstrated 2- to 3-fold increases in Raf-1 activity. SKOV-3 and OAW42 cells also showed large increases (10–20-fold) in B-Raf activity after TGF{alpha} stimulation. PEO4, OVCAR-3 and OVCAR-5 also demonstrated increases in B-Raf activity of 12, 5 and 3-fold, respectively. In the remaining cell lines B-Raf activity was unaffected. A-Raf activity was increased by 18-fold in OAW42 cells after TGF{alpha} treatment; PEO6, OVCAR-3, SKOV-3, A2780 and CaOV3 showed moderate increases and the remaining cell lines were unaffected. These results indicate wide diversity in the use of the separate Raf isoforms in individual cell lines.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
  		Fig. 4. Raf-1, A-Raf and B-Raf kinase activity in TGF{alpha}-induced ovarian cancer cells. (A) Activation of MEK and ERK phosphorylation by TGF{alpha}. Four cell lines (PE04, PE014, OAW42 and SKOV-3) were untreated or treated with 1 nM TGF{alpha} for 5 min after which pMEK and pERK protein expressions were analyzed by western blotting. Total levels of ERK were unchanged by addition of the growth factor (data not shown). (B) Raf kinase activation by TGF{alpha}. Lysates of cells growing in double charcoal stripped serum with or without TGF{alpha} were immunoprecipitated with anti-Raf-1, B-Raf or A-Raf and subsequently incubated with MEK and ERK to phosphorylate MBP in the presence of [{gamma}-32P]ATP. Samples were visualized by western blotting. (C) Induction of kinase activity following treatment with TGF{alpha} (fold-increase). This was determined for the panel of 14 ovarian cancer cell lines, along with PC12 cells as a positive control. All data are representative of more than one experiment.

 
Raf-1 depletion by antisense ODN is associated with marked inhibition of growth
To investigate the involvement of Raf-1, A-Raf and B-Raf in cell proliferation, each of the three Raf isoforms were selectively targeted and removed using specific antisense ODNs. Cell lines in these experiments were selected to give a range of differing Raf activities under normal serum and TGF{alpha}-stimulated conditions. The effect of removing Raf-1, A-Raf and B-Raf was examined in SKOV-3 cells. Both Raf-1 and A-Raf antisense ODNs reduced cell growth in a dose–dependent manner (72 h), while B-Raf antisense and a random control ODN had minimal effect on cell growth (Figure 5A). Each Raf antisense ODN specifically decreased only the targeted Raf without affecting other Raf isoforms (Figure 5B). The growth inhibition produced by the Raf-1 antisense ODN was associated with a reduction in the total Raf-1 protein as well as levels of phospho-ERK. In contrast, while the B-Raf antisense reduced levels of B-Raf protein, it had no effect on either growth or phospho-ERK (Figure 5C). The effects of Raf-1, A-Raf and B-Raf antisense ODNs were further investigated in an additional six ovarian cancer cell lines (Figure 5D). Removal of Raf-1 resulted in substantial growth inhibitory effects in five of these six cell lines (PEO1, OAW42, OVCAR-4, PEO4 and A2780), while the growth of OVCAR-5 cells was unaffected. Although B-Raf had minimal effects on the cell lines, there was minor stimulation of growth in some cell lines. The growth of OAW42, PEO4, OVCAR-4 and A2780 cells was unaffected by the removal of A-Raf, whereas PEO1 and OVCAR-5 were growth inhibited upon A-Raf depletion (Figure 5D).


Figure 5
View larger version (18K):
[in this window]
[in a new window]
  		Fig. 5. Effect of Raf-1, A-Raf and B-Raf antisense ODNs on growth and protein expression in SKOV-3 and other ovarian cancer cell lines. (A) Effect of antisense ODNs targeted against individual Raf isoforms on growth of SKOV-3 cells. Removal of intrinsic Raf-1, A-Raf and B-Raf was achieved in SKOV-3 cells using specific antisense ODNs (50–200 nM; 3 h exposure). Cellular proliferation was determined 72 h after treatment. (B) Effect of antisense ODNs on target mRNA expression. Raf-1, B-Raf and A-Raf mRNA levels were measured in SKOV-3 cells 24 h after treatment. (C) Effect of antisense ODNs on target Raf protein expression. Raf-1, B-Raf and p-ERK protein levels were measured in SKOV-3 cells by western blot analysis 48 h after treatment. Total ERK levels were unchanged (data not shown). (D) Effect of antisense ODNs targeted against individual Raf isoforms on growth of other ovarian cancer cell lines. A further group of six cell lines were treated with Raf-1, B-Raf and A-Raf antisense ODNs (200 nM) and cellular proliferation determined 72 h after treatment as described above.

 
Antisense removal of Raf-1, but not A-Raf or B-Raf, produced apoptosis in ovarian cancer cells
SKOV-3 cells were treated with Raf-1, B-Raf and A-Raf antisense ODNs and the extent of PARP cleavage (indicative of late stage apoptosis) was investigated. Western blotting with anti-PARP antibody demonstrated that only Raf-1 antisense ODN treatment resulted in PARP cleavage (Figure 6A), suggesting that the reduction in cell number after removing Raf-1 is at least in part due to increased apoptosis. Treatment with B-Raf and A-Raf antisense ODNs did not cause PARP cleavage. These results were corroborated by annexin V staining after antisense treatment, which again indicated that only Raf-1 was associated with cell survival (Figure 6A).


Figure 6
View larger version (15K):
[in this window]
[in a new window]
  		Fig. 6. Effect of Raf-1, A-Raf and B-Raf antisense ODNs and geldanamycin on cell growth in PE01, A2780 and SKOV-3 cells. (A) SKOV-3 cells were treated for 3 h with antisense ODNs and PARP cleavage assessed by western blot analysis 48 h after initiation of treatment. Apoptosis was indicated by cleavage of full-length 116 kDa PARP (upper band) to the 85 kDa fragment (lower band). Apoptosis levels were also assayed in similarly treated SKOV-3 cells that had been incubated with FITC-labeled annexin V and counterstained with propidium iodide. Cells were analyzed on a FACScan flow cytometer. Data shown are representative of multiple independent experiments. (B) PE01, A2780 and SKOV-3 cells were treated with geldanamycin (500 nM) and counted after 48 h. Cell counts are expressed relative to untreated control cells as described previously. (C) Raf-1, B-Raf and A-Raf protein expressions (along with actin) were also measured by western blot in lysates prepared 24 h after initial treatment.

 
Destabilization of Raf-1 by geldanamycin is accompanied with growth inhibition
Geldanamycin has been shown to deplete Raf-1 protein through destabilization of the Raf-1/HSP90 complex leading to degradation of Raf-1 and so represents an alternative strategy for removing Raf-1 from the Ras/Raf/MEK/ERK pathway (27). Treatment of PE01, A2780 and SKOV-3 cells with 500 nM geldanamycin resulted in significant growth inhibition (Figure 6B). This was accompanied by reduced protein expression of Raf-1, but not B-Raf or A-Raf, in these cell lines (Figure 6C).

Growth inhibition and reduced ERK phosphorylation with UO126
In order to simultaneously block cellular signaling via the Raf-1, A-Raf and B-Raf pathways, SKOV-3, PEO1, OVCAR-5 and A2780 cells were treated with the MEK inhibitor UO126. All four cell lines studied showed a dose-dependent growth inhibition, both in the absence or presence of a TGF{alpha} stimulation (Figure 7A). This was confirmed by reduced pERK expression following treatment (Figure 7B). Similar effects on both growth and signaling were obtained with the compound PD98059 (data not shown).


Figure 7
View larger version (16K):
[in this window]
[in a new window]
  		Fig. 7. TGF{alpha}-stimulated phosphorylation of MEK and ERK in the panel of ovarian cancer cell lines and their inhibition by UO126. (A) Four cell lines (PEO1, A2780, SKOV-3 and OVCAR-5) were grown in reduced media conditions and treated with UO126 (0–100 µM) in the presence or absence of TGF{alpha} (1 nM) for 5 days. Cellular proliferation was determined by cell counter and expressed relative to untreated control cells. Thus samples where growth in the presence of the inhibitor was statistically different from that in its absence are shown (*P < 0.05). Results represent the mean ± SE of two experiments. (B) Western blots of TGF{alpha}-induced phosphorylation of ERK in the presence or absence of UO126 are shown for the four cell lines shown above. Cells were treated with UO126 (0–50 µM) for 5 min prior to the addition of media with or without TGF{alpha} (1 nM) for 15 min at 37°C. Activity was determined by immunoblotting with antibodies specific for phosphorylated ERK 1/2. Total ERK levels were unchanged (data not shown). Results shown are representative of two experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
References
 
These investigations indicate that all three forms of Raf are expressed in ovarian cancer and moreover all contribute to signaling. Selective removal of individual Raf isoforms by use of antisense ODNs indicated a major growth role for Raf-1, a minor role for A-Raf and no obvious role for B-Raf. We have previously reported that increased expression of Raf-1 is associated with reduced patient survival in ovarian cancer (20), and in the present study we observed that removal of Raf-1 by antisense treatment had the greatest effect of all three Raf isoforms on cell growth. This would be consistent with Raf-1 being predominantly responsible for driving tumor cell proliferation. Similarly, only Raf-1 depletion by antisense treatment increased apoptosis (as indicated by both PARP cleavage and annexin V positivity). Raf-mediated signaling therefore plays an essential role not only in cell cycle progression but also in inhibiting apoptosis (9,10,28). The majority of the cell lines studied are known to be derived from high-grade tumors although, apart from the PE0 series of cell lines which are of serous origin, the histology has generally not been reported in the initial characterization reports. Certainly, the PE01 and PE04 cell lines are derived from high-grade serous carcinomas and reflect the other cell lines tested. If these cell lines which show dependency on Raf-1 are representative of the major sub-group of ovarian cancer, namely high grade serous cancers, this would be consistent with increased expression of Raf-1 being associated with poor survival in this subgroup.

The positive association of B-Raf expression with patient survival and the relatively minor growth-associated effects associated with B-Raf knockout were unexpected as B-Raf has been demonstrated to have a dominant role in a number of tumor types and is the most potent MEK activator. In PC12 cells (a rat pheochromocytoma model which has been used extensively to study MAP kinase signaling) activation of the ERKs has been shown to be almost exclusively (>90%) due to the action of B-Raf (24). It is however clear from our data that in ovarian cancer there is extensive variability in both the expression of the individual isoform proteins and in the respective kinase activities that they contribute. The study by Davies et al. (17) exploring B-Raf mutations in different cancers found only 1 of 25 ovarian cancer cell lines to be mutated. It was in the HX62-26 cell line that a G1388A mutation was demonstrated. Since 8 of the 15 cell lines (41M, 59M, A2780, CAOV-3, OAW 42, OVCAR-3, OVCAR-4 and SKOV-3) used in our study had been investigated by others and shown to be mutation-free, this appears to be a relatively uncommon event in ovarian cancers when compared with the very high rate (66%) seen in melanoma. Subsequent studies suggested that while high-grade serous ovarian cancers (the predominant histological subtype) had a 0% (0/72) incidence rate of the B-Raf codon 599 mutation, the low-grade subtype micropapillary serous carcinoma had a 33% incidence rate while the borderline precursor had a 28% incidence (18). The apparent restriction of B-Raf mutations to low-grade serous ovarian carcinomas and its precursors strongly suggests that low grade and high grade ovarian serous cancers develop through independent pathways and have different molecular routes (18). In that same report, ovarian endometrioid carcinomas had a 24% incidence rate. In our study, the only observed association of B-Raf with any clinical or pathological parameter was with improved, rather than reduced, survival and this was predominantly the case for the endometrioid subtype. It would appear therefore that B-Raf activation is not clearly linked with proliferation in ovarian cancer (as it is in melanoma) but rather that high expression or mutations are linked to a more favorable outcome. Another modification of B-Raf that has been described and which might have functional consequences is differential splicing to create variant forms of differing lengths (7,24). We observed no losses in the previously identified B-Raf regions in the cell lines when examined by RT–PCR. This is consistent with the cell lines all expressing the full length B-Raf molecule.

Of the three Raf isoforms, the least studied and characterized is A-Raf. A-Raf is known to play a major role in hematopoietic cells (5,29). Its pattern of expression in the normal ovary was different from that of either Raf-1 or B-Raf and it was expressed poorly in surface epithelial cells or granulosa cells. Most ovarian cancers expressed relatively high levels of A-Raf and there were no obvious associations with clinical or pathological parameters. While SKOV-3 cells demonstrated marked sensitivity to antisense ODN reduction of A-Raf, other cell lines responded poorly if at all.

Another modulator of Raf-1 is geldanamycin, which has been shown to deplete Raf-1 protein via binding of HSP90 leading to Raf destabilization (26). We investigated the effects of geldanamycin on three ovarian cancer cell lines and found inhibition of cellular proliferation consistent with depletion of Raf-1.

We next investigated the effect of inhibiting MEK since all three Raf isoforms activate this downstream effector and therefore blockade of MEK should inhibit all Raf-mediated signaling. Use of the MEK1/2 inhibitor UO126 demonstrated effective growth inhibition in the four cell lines studied. While this approach has the advantage of a more complete blockade of Raf signaling, it is less selective and does not exploit the specificity of Raf-1 dominance. The therapeutic targeting of components of the Ras/Raf/MEK/ERK pathway as a potential cancer treatment is currently attracting much interest. In a parallel study, we have shown that Raf-1 dependent ovarian cancer cell lines can be identified and targeted with antisense ODNs (30). The small molecule Raf-inhibitor, Bay 43-9006, is also being studied in clinical trials and in combination with gemcitabine has produced partial responses in ovarian cancer (31).

In conclusion, these data suggest that Raf-1 is likely to be the predominant Raf isoform used in ovarian cancer growth-regulated signaling particularly in high-grade serous tumors. While B-Raf appears critical for signaling in brain cancers and melanoma, it plays a lesser role in ovarian cancer than its related isoforms but its effect on survival suggests that it may be important in the endometrioid subtype. These data also support the view that Raf-1 is a potential therapeutic target in ovarian cancer.

Conflict of Interest Statement: Brett P.Monia is sponsored for conducting research currently and holds stock of ISIS Pharmaceuticals.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Davis,R.J. (1993) The mitogen-activated protein kinase signal transduction pathway. J. Biol. Chem., 268, 14553–14556.[Free Full Text]
  2. Cobb,M.H. and Goldsmith,E.J. (1995) How MAP kinases are regulated. J. Biol. Chem., 270, 14843–14846.[Free Full Text]
  3. Kolch,W. (2000) Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions. Biochem. J., 351,289–305.[CrossRef][Web of Science][Medline]
  4. Daum,G., Eisenmann-Tappe,I., Fries,H.-W., Troppmair,J. and Rapp,U.R. (1994) The ins and outs of Raf kinases. TIBS, 19, 474–480.[Medline]
  5. Hagemann,C. and Rapp,U.R. (1999) Isotype-specific functions of Raf kinases. Exp. Cell Res., 253, 34–46.[CrossRef][Web of Science][Medline]
  6. Storm,S.M., Cleveland,J.L. and Rapp,U.R. (1990) Expression of raf family proto-oncogenes in normal mouse tissues. Oncogene, 5, 345–351.[Web of Science][Medline]
  7. Barnier,J.V., Papin,C., Eychene,A., Lecoq,O. and Calothy,G. (1995) The mouse B-raf gene encodes multiple protein isoforms with tissue-specific expression. J. Biol. Chem., 270, 23381–23389.[Abstract/Free Full Text]
  8. Luckett,J.C., Huser,M.B., Giagtzoglou,N., Brown,J.E. and Pritchard,C.A. (2000) Expression of the A-raf proto-oncogene in the normal adult and embryonic mouse. Cell Growth Differ., 11, 163–171.[Abstract/Free Full Text]
  9. Mikula,M., Schreiber,M., Husak,Z., Kucerova,L., Ruth,J., Wieser,R., Zatloukal,K., Beug,H., Wagner,E.F. and Baccarini,M. (2001) Embryonic lethality and fetal liver apoptosis in mice lacking the c-raf-1 gene. EMBO J., 20, 1952–1962.[CrossRef][Web of Science][Medline]
  10. Huser,M., Luckett,J., Chiloeches,A., Mercer,K., Iwobi,M., Giblett,S., Sun,X.M., Brown,J., Marais,R. and Pritchard,C. (2001) MEK kinase activity is not necessary for Raf-1 function. EMBO J., 20, 1940–1951.[CrossRef][Web of Science][Medline]
  11. Wojnowski,L., Stancato,L.F., Zimmer,A.M., Hahn,H., Beck,T.W., Larner,A.C., Rapp,U.R. and Zimmer,A. (1988) Craf-1 protein kinase is essential for mouse development. Mech. Dev., 76, 141–149.
  12. Wojnowski,L., Zimmer,A.M., Beck,T.W., Hahn,H., Bernal,R., Rapp,U.R. and Zimmer,A. (1997) Endothelial apoptosis in Braf-deficient mice. Nat. Genet., 16, 293–297.[CrossRef][Web of Science][Medline]
  13. Pritchard,C.A., Bolin,L., Lattery,R., Murray,R. and McMahon,M. (1996) Post-natal lethality and neurological and gastrointestinal defects in mice with targeted disruption of the A-Raf protein kinase gene. Curr. Biol., 6, 614–617.[CrossRef][Web of Science][Medline]
  14. Marais,R., Light,Y., Paterson,H.F., Mason,C.S. and Marshall,C.J. (1997) Differential regulation of Raf-1, A-Raf, and B-Raf by oncogenic ras and tyrosine kinases. J. Biol. Chem., 272, 4378–4383.[Abstract/Free Full Text]
  15. Mason,C.S., Springer,C.J., Cooper,R.G., Superti-Furga,G., Marshall,C.J. and Marais,R. (1999) Serine and tyrosine phosphorylations cooperate in Raf-1, but not B-Raf activation. EMBO J., 18, 2137–2148.[CrossRef][Web of Science][Medline]
  16. Bosch,E., Cherwinski,H., Peterson,D. and McMahon,M. (1997) Mutations of critical amino acids affect the biological and biochemical properties of oncogenic A-Raf and Raf-1. Oncogene, 15, 1021–1033.[CrossRef][Web of Science][Medline]
  17. Davies,H., Bignell,G.R., Cox,C. et al. (2002) Mutations of the BRAF gene in human cancer. Nature, 417, 949–954.[CrossRef][Medline]
  18. Singer,G., Oldt,R., Cohen,Y., Wang,B.G., Sidransky,D., Kurman,R.J. and, Shih,I. (2003) Mutations in BRAF and KRAS characterize the development of low-grade ovarian serous carcinoma. J. Natl Cancer Inst., 95, 484–486.[Abstract/Free Full Text]
  19. Hsu,C.-Y., Bristow,R., Cha,M.S., Wang,B.G., Ho,C.-L., Kurman,R.J., Wang,T.-L. and Shih,I-M. (2004) Characterization of active mitogen-activated protein kinase in ovarian serous carcinomas. Clin. Cancer Res., 10, 6432–6436.[Abstract/Free Full Text]
  20. McPhillips,F., Mullen,P., Monia,B.P., Ritchie,A.A., Dorr,F.A., Smyth,J.F. and Langdon,S.P. (2001) Association of c-Raf expression with survival and its targeting with antisense oligonucleotides in ovarian cancer. Br. J. Cancer, 85, 1753–1758.[CrossRef][Medline]
  21. Langdon,S.P., Lawrie,S.S., Hay,F.G., Hawkes,M.M., McDonald,A., Hayward,I.P., Schol,D.J., Hilgers,J., Leonard,R.C. and Smyth,J.F. (1988) Characterization and properties of nine human ovarian adenocarcinoma cell lines. Cancer Res., 48, 6166–6172.[Abstract/Free Full Text]
  22. Alessi,D.R., Cohen,P., Ashworth,A., Cowley,S., Leevers,S.J. and Marshall,C.J. (1995) Assay and expression of mitogen-activated protein kinase, MAP kinase kinase, and Raf. Methods Enzymol., 255, 279–290.[Web of Science][Medline]
  23. Barnard,D., Diaz,B., Clawson,D. and Marshall,M. (1998) Oncogenes, growth factors and phorbol esters regulate Raf-1 through common mechanisms. Oncogene, 17, 1539–1547.[CrossRef][Web of Science][Medline]
  24. Papin,C., Denouel-Galy,A., Laugier,D., Calothy,G. and Eychene,A. (1998) Modulation of kinase activity and oncogenic properties by alternative splicing reveals a novel regulatory mechanism for B-Raf. J. Biol. Chem., 273, 4939–4947.
  25. Kao,S., Jaiswal,R.K., Kolch,W. and Landreth,G.E. (2001) Identification of the mechanisms regulating the differential activation of the MAPK cascade by epidermal growth factor and nerve growth factor in PC12 cells. J. Biol. Chem., 276, 18169–18177.[Abstract/Free Full Text]
  26. Wu,X., Noh,S.J., Zhou,G., Dixon,J.E. and Guan,K.-L. (1996) Selective activation of MEK1 but not MEK2 by A-Raf from epidermal growth factor-stimulated HeLa cells. J. Biol. Chem., 271, 3265–3271.[Abstract/Free Full Text]
  27. Schulte,T.W., Blagosklonny,M.V., Romanova,L., Mushinski,J.F., Monia,B.P., Johnston,J.F., Nguyen,P., Trepel,J. and Neckers,L.M. (1996) Destabilization of Raf-1 by geldanamycin leads to disruption of the Raf-1-MEK-mitogen-activated protein kinase signalling pathway. Mol. Cell. Biol., 16, 5839–5845.[Abstract]
  28. Slater,E.P., Stubig,T., Lau,Q.C., Achenbach,T.V., Rapp,U.R. and Muller,R. (2003) C-Raf controlled pathways in the protection of tumor cells from apoptosis. Int. J. Cancer, 104, 425–432.[CrossRef][Web of Science][Medline]
  29. McCubrey,J.A., Steelman,L.S., Hoyle,P.E., Blalock,W.L., Weinstein-Oppenheimer,C., Franklin,R.A., Cherwinski,H., Bosch,E. and McMahon,M. (1998) Differential abilities of activated Raf oncoproteins to abrogate cytokine dependency, prevent apoptosis and induce autocrine growth factor synthesis in human hematopoietic cells. Leukemia, 12, 1903–1929.[CrossRef][Web of Science][Medline]
  30. Mullen,P., McPhillips,F., MacLeod,K., Monia,B., Smyth,J.F. and Langdon,S.P. (2004) Antisense oligonucleotide targeting of Raf-1: importance of raf-1 mRNA expression levels and raf-1-dependent signaling in determining growth response in ovarian cancer. Clin. Cancer Res., 10, 2100–2108.[Abstract/Free Full Text]
  31. Siu,L.L., Takimoto,C.H., Awada,A., Moore,M.J., Piccart,M., Poulin-Costello,M., Lathia,C. and Petrenciuc,O. (2004) A phase I/II trial of BAY 43-9006 and gemcitabine in advanced solid tumors and in advanced pancreatic cancer. Proc. ASCO, 23, 3059.
Received July 29, 2005; revised November 20, 2005; accepted November 22, 2005.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 CarcinogenesisHome page
F. Fan, L. Feng, J. He, X. Wang, X. Jiang, Y. Zhang, Z. Wang, and Y. Chen
RKTG sequesters B-Raf to the Golgi apparatus and inhibits the proliferation and tumorigenicity of human malignant melanoma cells
Carcinogenesis, June 1, 2008; 29(6): 1157 - 1163.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
27/4/729    most recent
bgi289v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by McPhillips, F.
Right arrow Articles by Langdon, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McPhillips, F.
Right arrow Articles by Langdon, S. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?